Merge pull request #149 from PolinaBevad/f_fix_sv_realignment_disable_option

Fix sv realignment - added delete duplicates option

Author: pcingola

Readme.md

@@ -431,7 +431,9 @@ Variant frequency is more than 10% for the non-monomer MSI and 25% for the monom
 - `-Y|--ref-extension INT`  
     Extension of bp of reference to build lookup table. Default to 1200 bp. Increase the number will slowdown the program. 
     The main purpose is to call large indels with 1000 bp that can be missed by discordant mate pairs. 
-      
+- `--deldupvar`  
+  Turn on deleting of duplicate variants in output that can appear due to VarDict linear work on regions. Variants in this mode are 
+  considered and outputted only if start position of variant is inside the region interest.
 ## Output columns
 
 1. Sample - sample name

src/main/java/com/astrazeneca/vardict/Configuration.java

@@ -217,6 +217,11 @@ public class Configuration {
      */
     public boolean disableSV = false; //-U
 
+    /**
+     * Turn on deleting of duplicate variants that can appear due to VarDict linear work on regions.
+     */
+    public boolean deleteDuplicateVariants = false;
+
     /**
      * The minimum distance between two SV clusters in term of read length
      */

src/main/java/com/astrazeneca/vardict/Main.java

@@ -140,6 +140,7 @@ private void run(CommandLine cmd) throws ParseException, IOException {
         conf.disableSV = cmd.hasOption("U");
         conf.uniqueModeSecondInPairEnabled = cmd.hasOption("UN");
         conf.uniqueModeAlignmentEnabled = cmd.hasOption("u");
+        conf.deleteDuplicateVariants = cmd.hasOption("deldupvar");
 
         conf.INSSIZE = getIntValue(cmd, "w", 300);
         conf.INSSTD = getIntValue(cmd, "W", 100);
@@ -197,6 +198,7 @@ private static Options buildOptions() {
         options.addOption("u", false, "Indicate unique mode, which when mate pairs overlap, the overlapping part will be counted only once using forward read only.");
         options.addOption("UN", false, "Indicate unique mode, which when mate pairs overlap, the overlapping part will be counted only once using first read only.");
         options.addOption("chimeric", false, "Indicate to turn off chimeric reads filtering.");
+        options.addOption("deldupvar", false, "Turn on deleting of duplicate variants. Variants in this mode are considered and outputted only if start position of variant is inside the region interest.");
         options.addOption("U", "nosv", false, "Turn off structural variant calling.");
 
         options.addOption(OptionBuilder.withArgName("bit")

src/main/java/com/astrazeneca/vardict/modules/ToVarsBuilder.java

@@ -89,16 +89,18 @@ public static Tuple.Tuple2<Integer, Map<Integer, Vars>> toVars(Region region,
             if (v.isEmpty()) {
                 continue;
             }
-            //Skip if position is outside region of interest
-            if (v.sv == null) {
+
+            //Skip if there are no structural variants on position or if the delete duplication option is on
+            if (v.sv == null || conf.deleteDuplicateVariants) {
+                //Skip if start position is outside region of interest
                 if (p < region.start || p > region.end) {
                     continue;
                 }
-                //skip position if it has no coverage
-                if (!cov.containsKey(p)) {
-                    continue;
-                }
+            }
 
+            //Skip position if it has no coverage (except SVs)
+            if (v.sv == null && !cov.containsKey(p)) {
+                continue;
             }
 
             Set<String> vk = new HashSet<String>(v.keySet());

src/test/resources/com/astrazeneca/vardict/integrationtests/DelOutOfBound.chr1_150578117_150578617.bam

@@ -0,0 +1,10 @@
+Simple,hg38.fa,DelOutOfBound.chr1_150578117_150578617.bam,chr1,150578117,150578617,-f 0.001 --deldupvar
+DelOutOfBound.chr1_150578117_150578617	testbed	chr1	150578429	150578429	T	C	4965	5	2527	2432	1	4	T/C	0.0010	2;2	48.4	1	45.0	0	60.0	10.000	0.0010	0	1	2.000	3	2.2	5	4965	GCCGTCGCTGAAAACATGGA	CATCACTCGAGACAACGATT	chr1:150578118-150578617	SNV	0	0
+DelOutOfBound.chr1_150578117_150578617	testbed	chr1	150578557	150578557	C	T	1965	2	591	1372	1	1	C/T	0.0010	2;2	41.5	1	42.0	1	60.0	4.000	0.0010	0	1	3.000	1	1.0	2	1965	ACCGGCGCAAGATTCGCCTG	CCACCCGCGGCGGGAAAATC	chr1:150578118-150578617	SNV	0	0
+DelOutOfBound.chr1_150578117_150578617	testbed	chr1	150578606	150578606	A	G	1560	3	506	1051	0	3	A/G	0.0019	2;0	37.0	0	45.0	0	60.0	6.000	0.0019	0	0	4.000	1	2.0	3	1558	GATTTACAGAACTCAGGTTG	CCCCACTTGAAATTGACATC	chr1:150578118-150578617	SNV	0	0
+DelOutOfBound.chr1_150578117_150578617	testbed	chr1	150578577	150578577	C	T	1847	2	542	1303	1	1	C/T	0.0011	2;2	28.0	1	45.0	0	60.0	4.000	0.0011	0	0	1.000	1	1.0	2	1847	CCCACCCGCGGCGGGAAAAT	GCTACTGGGATTTACAGAAC	chr1:150578118-150578617	SNV	0	0
+DelOutOfBound.chr1_150578117_150578617	testbed	chr1	150578149	150578149	C	T	1673	2	1306	365	2	0	C/T	0.0012	2;0	63.5	1	45.0	0	60.0	4.000	0.0012	0	2	1.000	1	1.0	2	1671	AGAGCCTGCAAACAGCCGTG	GTCATAAAAACCTTTAGATA	chr1:150578118-150578617	SNV	0	0
+DelOutOfBound.chr1_150578117_150578617	testbed	chr1	150578151	150578151	T	C	1683	2	1308	373	1	1	T/C	0.0012	2;2	38.0	1	45.0	0	60.0	4.000	0.0012	0	0	1.000	1	1.0	2	1682	AGCCTGCAAACAGCCGTGCG	CATAAAAACCTTTAGATATC	chr1:150578118-150578617	SNV	0	0
+DelOutOfBound.chr1_150578117_150578617	testbed	chr1	150578182	150578183	TA	T	2219	3	1580	636	2	1	A/-1	0.0014	2;2	62.3	1	45.0	0	60.0	6.000	0.0014	0	7	8.000	1	0.0	3	2219	TTTAGATATCCCCACCTCTC	AAAAAAATCCTTCATTCTAC	chr1:150578118-150578617	Deletion	0	0
+DelOutOfBound.chr1_150578117_150578617	testbed	chr1	150578182	150578182	T	TA	2182	6	1414	565	5	1	T/+1	0.0027	2;2	33.3	1	47.0	1	62.8	12.000	0.0030	0.0005	8	9.000	1	0.3	6	1982	TTTAGATATCCCCACCTCTC	AAAAAAAATCCTTCATTCTA	chr1:150578118-150578617	Insertion	0	0
+

src/test/resources/com/astrazeneca/vardict/integrationtests/DelOutOfBound.chr1_150578117_150578617.bam.bai

@@ -0,0 +1,10 @@
+Simple,hg38.fa,DelOutOfBound.chr1_150578117_150578617.bam,chr1,150578117,150578617,-f 0.001
+DelOutOfBound.chr1_150578117_150578617	testbed	chr1	150578429	150578429	T	C	4965	5	2527	2432	1	4	T/C	0.0010	2;2	48.4	1	45.0	0	60.0	10.000	0.0010	0	1	2.000	3	2.2	5	4965	GCCGTCGCTGAAAACATGGA	CATCACTCGAGACAACGATT	chr1:150578118-150578617	SNV	0	0
+DelOutOfBound.chr1_150578117_150578617	testbed	chr1	150578557	150578557	C	T	1965	2	591	1372	1	1	C/T	0.0010	2;2	41.5	1	42.0	1	60.0	4.000	0.0010	0	1	3.000	1	1.0	2	1965	ACCGGCGCAAGATTCGCCTG	CCACCCGCGGCGGGAAAATC	chr1:150578118-150578617	SNV	0	0
+DelOutOfBound.chr1_150578117_150578617	testbed	chr1	150578606	150578606	A	G	1560	3	506	1051	0	3	A/G	0.0019	2;0	37.0	0	45.0	0	60.0	6.000	0.0019	0	0	4.000	1	2.0	3	1558	GATTTACAGAACTCAGGTTG	CCCCACTTGAAATTGACATC	chr1:150578118-150578617	SNV	0	0
+DelOutOfBound.chr1_150578117_150578617	testbed	chr1	150578577	150578577	C	T	1847	2	542	1303	1	1	C/T	0.0011	2;2	28.0	1	45.0	0	60.0	4.000	0.0011	0	0	1.000	1	1.0	2	1847	CCCACCCGCGGCGGGAAAAT	GCTACTGGGATTTACAGAAC	chr1:150578118-150578617	SNV	0	0
+DelOutOfBound.chr1_150578117_150578617	testbed	chr1	150577490	150578242	TCCTAGAAAACAAAAAAGAAAAGCACATTTTCAAGTATGGGTTTCTGCTCTCTTACAACACTACTATCCAGAGAGAAGGTAAATTAAAATATCTAAGGTTTCCCCCTAAAGCAATAGTAAACCAATTATTATTCACCCCGGGGCAAAAAAAGAAAATAAGTTCTTCAGTTTCTTAAGCGGGGACCCATGATAATTAAACTTCATTTTACAGTACTATCTTGGTCTTATTAGGATTTATCCTAACAAAAGGACTTCCAGAGTTCCCATGAGGTAAAAGACGAAAACCCTTATTCTCAAATCTCCACCACCTAATATTTCAGTAACGCCTCAATTGCGCAGATCAGTTTTTCTCAACGTAGTTAAGTACATCCTGCATCAGATCTGGGTTTGTTTAAAACGCAGGCTCCACCCCATATCTTCTCCATTAAAACAGGCACCGCCTTAGGAATTATTTCAGCTATCCTCCCCTGGTGACTTATTTTTTCATGGTTTGAATCCACTGAAGAGTATTCAACTGAATTGGAACAAAAAATTGCCTAGAGAAAACCAAGATTTTTGATACAATTCAAGACCGCCATACCACTATCTCTAAGGATCCACTACTTAAATCAACATCAAATAAACAATGGTCCTTTAGTTAGAGCCTGCAAACAGCCGTGCGTCATAAAAACCTTTAGATATCCCCACCTCTCTAAAAAAAATCCTTCATTCTACTTCCACTCCAAGGCCCCTTTCATCCTTAAGGCAAACTTA	T	3528	1377	1307	1553	768	609	C/-752	0.3903	2;2	37.2	1	44.9	1	60.0	2754.000	0.3257	0.3903	2	1.000	1	0.1	1377	4228	GGAAGAACTCCACAAACCCA	CCCAGCCTCTTTGTTTAACT	chr1:150578118-150578617	Deletion	0	713-722-1
+DelOutOfBound.chr1_150578117_150578617	testbed	chr1	150578149	150578149	C	T	1673	2	1306	365	2	0	C/T	0.0012	2;0	63.5	1	45.0	0	60.0	4.000	0.0012	0	2	1.000	1	1.0	2	1671	AGAGCCTGCAAACAGCCGTG	GTCATAAAAACCTTTAGATA	chr1:150578118-150578617	SNV	0	0
+DelOutOfBound.chr1_150578117_150578617	testbed	chr1	150578151	150578151	T	C	1683	2	1308	373	1	1	T/C	0.0012	2;2	38.0	1	45.0	0	60.0	4.000	0.0012	0	0	1.000	1	1.0	2	1682	AGCCTGCAAACAGCCGTGCG	CATAAAAACCTTTAGATATC	chr1:150578118-150578617	SNV	0	0
+DelOutOfBound.chr1_150578117_150578617	testbed	chr1	150578182	150578183	TA	T	2219	3	1580	636	2	1	A/-1	0.0014	2;2	62.3	1	45.0	0	60.0	6.000	0.0014	0	7	8.000	1	0.0	3	2219	TTTAGATATCCCCACCTCTC	AAAAAAATCCTTCATTCTAC	chr1:150578118-150578617	Deletion	0	0
+DelOutOfBound.chr1_150578117_150578617	testbed	chr1	150578182	150578182	T	TA	2182	6	1414	565	5	1	T/+1	0.0027	2;2	33.3	1	47.0	1	62.8	12.000	0.0030	0.0005	8	9.000	1	0.3	6	1982	TTTAGATATCCCCACCTCTC	AAAAAAAATCCTTCATTCTA	chr1:150578118-150578617	Insertion	0	0