diff --git a/.github/.keep b/.github/.keep new file mode 100644 index 0000000000..e69de29bb2 diff --git a/.github/workflows/test.yml b/.github/workflows/test.yml new file mode 100644 index 0000000000..35e854789a --- /dev/null +++ b/.github/workflows/test.yml @@ -0,0 +1,251 @@ +name: Run Tests + +on: + push: + branches: + - main + - staging + - frontend-websocket-test + pull_request: + branches: + - main + - staging + workflow_dispatch: + +jobs: + question-service-tests: + runs-on: ubuntu-latest + + steps: + - name: Checkout repository + uses: actions/checkout@v2 + + - name: Set up .env + env: + QUESTION_FIREBASE_CREDENTIAL_PATH: ${{ vars.QUESTION_SERVICE_FIREBASE_CREDENTIAL_PATH }} + JWT_SECRET: ${{ secrets.JWT_SECRET }} + EXECUTION_SERVICE_URL: ${{ vars.EXECUTION_SERVICE_URL }} + run: | + cd ./apps/question-service + echo "FIREBASE_CREDENTIAL_PATH=$QUESTION_FIREBASE_CREDENTIAL_PATH" >> .env + echo "JWT_SECRET=$JWT_SECRET" >> .env + echo "EXECUTION_SERVICE_URL=$EXECUTION_SERVICE_URL" >> .env + + - name: Set up credentials + env: + QUESTION_FIREBASE_JSON: ${{ secrets.QUESTION_SERVICE_FIREBASE_CREDENTIAL }} + QUESTION_FIREBASE_CREDENTIAL_PATH: ${{ vars.QUESTION_SERVICE_FIREBASE_CREDENTIAL_PATH }} + run: | + cd ./apps/question-service + echo "$QUESTION_FIREBASE_JSON" > "./$QUESTION_FIREBASE_CREDENTIAL_PATH" + + - name: Setup Go + uses: actions/setup-go@v5 + with: + go-version: "1.23.x" + + - name: Install Go dependencies + run: | + cd ./apps/question-service + go mod tidy + + - name: Install firebase tools + run: curl -sL firebase.tools | bash + + - name: Run Go tests with Firebase emulator + run: firebase emulators:exec --only firestore 'cd ./apps/question-service; go test -v ./tests' + + frontend-unit-tests: + runs-on: ubuntu-latest + + steps: + - name: Checkout repository + uses: actions/checkout@v2 + + - name: Setup .env + run: | + cd ./apps/frontend + cp .env.example .env + + - name: Set up Node.js + uses: actions/setup-node@v2 + with: + node-version: "22" + + - name: Install pnpm + run: npm i -g pnpm + + - name: Install dependencies + run: | + cd ./apps/frontend + pnpm i + + - name: Run tests + run: | + cd ./apps/frontend + pnpm unit-test + + test-docker-compose: + runs-on: ubuntu-latest + + steps: + - name: Checkout code + uses: actions/checkout@v4 + + - name: Set up Docker Compose + run: | + sudo apt-get update + sudo apt-get install -y docker-compose + + - name: Create Environment Files + env: + QUESTION_SERVICE_URL: ${{ vars.QUESTION_SERVICE_URL }} + USER_SERVICE_URL: ${{ vars.USER_SERVICE_URL }} + MATCHING_SERVICE_URL: ${{ vars.MATCHING_SERVICE_URL }} + HISTORY_SERVICE_URL: ${{ vars.HISTORY_SERVICE_URL }} + SIGNALLING_SERVICE_URL: ${{ vars.SIGNALLING_SERVICE_URL }} + EXECUTION_SERVICE_URL: ${{ vars.EXECUTION_SERVICE_URL }} + JWT_SECRET: ${{ secrets.JWT_SECRET }} + QUESTION_FIREBASE_CREDENTIAL_PATH: ${{ vars.QUESTION_SERVICE_FIREBASE_CREDENTIAL_PATH }} + HISTORY_FIREBASE_CREDENTIAL_PATH: ${{ vars.HISTORY_SERVICE_FIREBASE_CREDENTIAL_PATH }} + EXECUTION_FIREBASE_CREDENTIAL_PATH: ${{ vars.EXECUTION_SERVICE_FIREBASE_CREDENTIAL_PATH }} + DB_CLOUD_URI: ${{ secrets.USER_SERVICE_DB_CLOUD_URI }} + USER_SERVICE_PORT: ${{ vars.USER_SERVICE_PORT }} + MATCHING_SERVICE_PORT: ${{ vars.MATCHING_SERVICE_PORT }} + HISTORY_SERVICE_PORT: ${{ vars.HISTORY_SERVICE_PORT }} + SIGNALLING_SERVICE_PORT: ${{ vars.SIGNALLING_SERVICE_PORT }} + EXECUTION_SERVICE_PORT: ${{ vars.EXECUTION_SERVICE_PORT }} + MATCHING_SERVICE_TIMEOUT: ${{ vars.MATCHING_SERVICE_TIMEOUT }} + REDIS_URL: ${{ vars.REDIS_URL }} + QUESTION_SERVICE_GRPC_URL: ${{ vars.QUESTION_SERVICE_GPRC_URL }} + run: | + cd ./apps/frontend + echo "NEXT_PUBLIC_QUESTION_SERVICE_URL=$QUESTION_SERVICE_URL" >> .env + echo "NEXT_PUBLIC_USER_SERVICE_URL=$USER_SERVICE_URL" >> .env + echo "NEXT_PUBLIC_MATCHING_SERVICE_URL=$MATCHING_SERVICE_URL" >> .env + echo "NEXT_PUBLIC_HISTORY_SERVICE_URL=$HISTORY_SERVICE_URL" >> .env + echo "NEXT_PUBLIC_SIGNALLING_SERVICE_URL=$SIGNALLING_SERVICE_URL" >> .env + echo "NEXT_PUBLIC_EXECUTION_SERVICE_URL=EXECUTION_SERVICE_URL" >> .env + + cd ../question-service + echo "FIREBASE_CREDENTIAL_PATH=$QUESTION_FIREBASE_CREDENTIAL_PATH" >> .env + echo "JWT_SECRET=$JWT_SECRET" >> .env + echo "EXECUTION_SERVICE_URL=$EXECUTION_SERVICE_URL" >> .env + + cd ../user-service + echo "DB_CLOUD_URI=$DB_CLOUD_URI" >> .env + echo "PORT=$USER_SERVICE_PORT" >> .env + echo "JWT_SECRET=$JWT_SECRET" >> .env + + cd ../matching-service + echo "PORT=$MATCHING_SERVICE_PORT" >> .env + echo "MATCH_TIMEOUT=$MATCHING_SERVICE_TIMEOUT" >> .env + echo "JWT_SECRET=$JWT_SECRET" >> .env + echo "REDIS_URL=$REDIS_URL" >> .env + echo "QUESTION_SERVICE_GRPC_URL=$QUESTION_SERVICE_GRPC_URL" >> .env + + cd ../history-service + echo "FIREBASE_CREDENTIAL_PATH=$HISTORY_FIREBASE_CREDENTIAL_PATH" >> .env + echo "PORT=$HISTORY_SERVICE_PORT" >> .env + + cd ../execution-service + echo "FIREBASE_CREDENTIAL_PATH=$EXECUTION_FIREBASE_CREDENTIAL_PATH" >> .env + echo "PORT=$EXECUTION_SERVICE_PORT" >> .env + echo "HISTORY_SERVICE_URL=$HISTORY_SERVICE_URL" >> .env + + cd ../signalling-service + echo "PORT=$SIGNALLING_SERVICE_PORT" >> .env + + - name: Create Database Credential Files + env: + QUESTION_FIREBASE_JSON: ${{ secrets.QUESTION_SERVICE_FIREBASE_CREDENTIAL }} + QUESTION_FIREBASE_CREDENTIAL_PATH: ${{ vars.QUESTION_SERVICE_FIREBASE_CREDENTIAL_PATH }} + HISTORY_FIREBASE_JSON: ${{ secrets.HISTORY_SERVICE_FIREBASE_CREDENTIAL }} + HISTORY_FIREBASE_CREDENTIAL_PATH: ${{ vars.HISTORY_SERVICE_FIREBASE_CREDENTIAL_PATH }} + EXECUTION_FIREBASE_JSON: ${{ secrets.EXECUTION_SERVICE_FIREBASE_CREDENTIAL }} + EXECUTION_FIREBASE_CREDENTIAL_PATH: ${{ vars.EXECUTION_SERVICE_FIREBASE_CREDENTIAL_PATH }} + run: | + cd ./apps/question-service + echo "$QUESTION_FIREBASE_JSON" > "./$QUESTION_FIREBASE_CREDENTIAL_PATH" + + cd ../history-service + echo "$HISTORY_FIREBASE_JSON" > "./$HISTORY_FIREBASE_CREDENTIAL_PATH" + + cd ../execution-service + echo "$EXECUTION_FIREBASE_JSON" > "./$EXECUTION_FIREBASE_CREDENTIAL_PATH" + + - name: Build and Run Services + run: | + cd ./apps + docker-compose up --build -d + + - name: Wait for services to be ready + run: sleep 30 + + - name: Install websocat + run: | + sudo wget -qO /usr/local/bin/websocat https://github.com/vi/websocat/releases/latest/download/websocat.x86_64-unknown-linux-musl + sudo chmod a+x /usr/local/bin/websocat + websocat --version + + - name: Run Tests + env: + FRONTEND_URL: ${{ vars.FRONTEND_URL }} + USER_SERVICE_URL: ${{ vars.USER_SERVICE_URL }} + QUESTION_SERVICE_URL: ${{ vars.QUESTION_SERVICE_URL }} + MATCHING_SERVICE_URL: ${{ vars.MATCHING_SERVICE_URL }} + HISTORY_SERVICE_URL: ${{ vars.HISTORY_SERVICE_URL }} + SIGNALLING_SERVICE_URL: ${{ vars.SIGNALLING_SERVICE_URL }} + EXECUTION_SERVICE_URL: ${{ vars.EXECUTION_SERVICE_URL }} + run: | + echo "Testing Question Service..." + curl -sSL -o /dev/null $QUESTION_SERVICE_URL && echo "Question Service is up" + echo "Testing User Service..." + curl -fsSL -o /dev/null $USER_SERVICE_URL && echo "User Service is up" + echo "Testing Frontend..." + curl -fsSL -o /dev/null $FRONTEND_URL && echo "Frontend is up" + echo "Testing History Service..." + curl -fsSL -o /dev/null $HISTORY_SERVICE_URL && echo "History Service is up" + echo "Testing Execution Service..." + curl -fsSL -o /dev/null $EXECUTION_SERVICE_URL && echo "Execution Service is up" + echo "Testing Matching Service..." + if ! (echo "Hello" | websocat $MATCHING_SERVICE_URL); then + echo "WebSocket for Matching Service is not live" + else + echo "WebSocket for Matching Service is live" + fi + # Add in test for matching service in the future + echo "Testing Signalling Service..." + if ! (echo "Hello" | websocat $SIGNALLING_SERVICE_URL); then + echo "WebSocket for Signalling Service is not live" + else + echo "WebSocket for Signalling Service is live" + fi + # We can add more tests here + + - name: Install pnpm + uses: pnpm/action-setup@v4 + with: + version: 9.1.4 + + - name: Install dependencies + run: | + cd ./apps/frontend + pnpm i + + - name: Install Chrome WebDriver + uses: nanasess/setup-chromedriver@v2 + with: + chromedriver-version: '130.0.6723.116' + - name: Install Edge + uses: browser-actions/setup-edge@v1 + with: + edge-version: stable + + - name: Install Geckodriver + uses: browser-actions/setup-geckodriver@latest + + - name: Run Browser Test + run: | + cd ./apps/frontend + pnpm browser-test diff --git a/.gitignore b/.gitignore new file mode 100644 index 0000000000..ce52d57a96 --- /dev/null +++ b/.gitignore @@ -0,0 +1,5 @@ +apps/question-service/.next/ +apps/question-service/next-env.d.ts +apps/question-service/node_modules/ +services/question-service/cs3219-g24-firebase-adminsdk-9cm7h-b1675603ab.json + diff --git a/README.md b/README.md index 259f7bba2e..bdb87090be 100644 --- a/README.md +++ b/README.md @@ -1,7 +1,11 @@ +[![Review Assignment Due Date](https://classroom.github.com/assets/deadline-readme-button-22041afd0340ce965d47ae6ef1cefeee28c7c493a6346c4f15d667ab976d596c.svg)](https://classroom.github.com/a/bzPrOe11) + # CS3219 Project (PeerPrep) - AY2425S1 -## Group: Gxx -### Note: -- You can choose to develop individual microservices within separate folders within this repository **OR** use individual repositories (all public) for each microservice. -- In the latter scenario, you should enable sub-modules on this GitHub classroom repository to manage the development/deployment **AND** add your mentor to the individual repositories as a collaborator. -- The teaching team should be given access to the repositories as we may require viewing the history of the repository in case of any disputes or disagreements. +## Group: G24 + +### Note: + +- You can choose to develop individual microservices within separate folders within this repository **OR** use individual repositories (all public) for each microservice. +- In the latter scenario, you should enable sub-modules on this GitHub classroom repository to manage the development/deployment **AND** add your mentor to the individual repositories as a collaborator. +- The teaching team should be given access to the repositories as we may require viewing the history of the repository in case of any disputes or disagreements. diff --git a/apps/README.md b/apps/README.md new file mode 100644 index 0000000000..ae12a36fc1 --- /dev/null +++ b/apps/README.md @@ -0,0 +1,110 @@ +# PeerPrep Docker Compose Guide + +This project uses Docker Compose to manage multiple services such as a frontend, backend, and a database. The configuration is defined in the `docker-compose.yml` file, and environment variables can be stored in environment files for different environments (e.g., development, production). + +## Prerequisites + +Before you begin, ensure you have the following installed on your machine: + +- [Docker](https://www.docker.com/get-started) +- [Docker Compose](https://docs.docker.com/compose/install/) + +## Project Structure + +In the `./apps` directory: + +```plaintext +. +├── docker-compose.yml # Docker Compose configuration +├── README.md # Project documentation (for docker compose) +├── .env # Global environment variables (optional) +├── frontend +│ ├── Dockerfile # Dockerfile for frontend +│ └── ... (other frontend files) +├── matching-service +│ ├── Dockerfile # Dockerfile for matching-service +│ └── ... (other matching-service files) +├── question-service +│ ├── Dockerfile # Dockerfile for question-service +│ └── ... (other question-service files) +├── user-service +│ ├── Dockerfile # Dockerfile for user-service +│ └── ... (other user-service files) + +``` + +## Docker Compose Setup + +By using multiple Dockerfiles in Docker Compose, we can manage complex multi-container applications where each service has its own environment and build process. + +1. Build and Start the Application + +To build and run both the frontend and backend services, you can change your directory to the `./apps` directory and run: + +```bash +docker-compose up --build +``` + +This will: + +- Build the Docker images for all services using the specified Dockerfiles +- Start the containers and map the defined ports + +2. Access the Application + +Once running, you can access: + +- The **frontend** at http://localhost:3000 +- The **user service** at http://localhost:3001 +- The **question service** at http://localhost:8080 (REST) and http://localhost:50051 (gRPC) +- The **matching service** at http://localhost:8081 +- The **redis service** at http://localhost:6379 + +3. Stopping Services + +To stop the running services, run: + +```bash +docker-compose down +``` + +This command will stop and remove the containers, networks, and volumes created by docker-compose up. + +## Troubleshooting + +### Common Issues + +- **Port Conflicts**: If you encounter port conflicts, ensure the host ports specified in docker-compose.yml (e.g., 3000:3000) are not in use by other applications. +- **Environment Variables Not Loaded**: Ensure the `.env` files are in the correct directories as found in the `docker-compose.yml` file. + +### Known Issues + +- **Mongo DB Connection Failing**: The user service fails to connect to the Mongo DB server on NUS Wi-Fi. To resolve this we have to use another network. + +### Logs + +You can view the logs for each service using the following command: + +```bash +docker-compose logs +``` + +### Useful Commands + +Rebuild a specific service: + +```bash +docker-compose build +``` + +Start services in detached mode (run in the background): + +```bash +docker-compose up -d +``` + +Remove all containers, networks, and volumes created by Docker Compose: + +```bash +docker-compose down --volumes +``` diff --git a/apps/docker-compose.yml b/apps/docker-compose.yml new file mode 100644 index 0000000000..12d02b5661 --- /dev/null +++ b/apps/docker-compose.yml @@ -0,0 +1,138 @@ +services: + frontend: + build: + context: ./frontend + dockerfile: Dockerfile + ports: + - 3000:3000 + networks: + - apps_network + env_file: + - ./frontend/.env + volumes: + - ./frontend:/frontend + depends_on: + - signalling-service + + user-service: + build: + context: ./user-service + dockerfile: Dockerfile + ports: + - 3001:3001 + networks: + - apps_network + env_file: + - ./user-service/.env + volumes: + - ./user-service:/user-service + + question-service: + build: + context: ./question-service + dockerfile: Dockerfile + ports: + - 8080:8080 + - 50051:50051 + env_file: + - ./question-service/.env + networks: + - apps_network + volumes: + - ./question-service:/question-service + + matching-service: + build: + context: ./matching-service + dockerfile: Dockerfile + ports: + - 8081:8081 + env_file: + - ./matching-service/.env + networks: + - apps_network + volumes: + - ./matching-service:/matching-service + depends_on: + - redis + + history-service: + build: + context: ./history-service + dockerfile: Dockerfile + ports: + - 8082:8082 + env_file: + - ./history-service/.env + networks: + - apps_network + volumes: + - ./history-service:/history-service + depends_on: + - rabbitmq + + signalling-service: + build: + context: ./signalling-service + dockerfile: Dockerfile + ports: + - 4444:4444 + env_file: + - ./signalling-service/.env + networks: + - apps_network + volumes: + - ./signalling-service:/signalling-service + + execution-service: + build: + context: ./execution-service + dockerfile: Dockerfile + ports: + - 8083:8083 + env_file: + - ./execution-service/.env + networks: + - apps_network + volumes: + - ./execution-service:/execution-service + - /var/run/docker.sock:/var/run/docker.sock + depends_on: + - rabbitmq + + redis: + image: redis:latest + networks: + - apps_network + ports: + - 6379:6379 + container_name: redis-container + + rabbitmq: + image: rabbitmq:3-management + networks: + - apps_network + ports: + - 5672:5672 # Port for RabbitMQ message broker + - 15672:15672 # Port for RabbitMQ Management UI + environment: + RABBITMQ_DEFAULT_USER: guest + RABBITMQ_DEFAULT_PASS: guest + volumes: + - rabbitmq_data:/var/lib/rabbitmq + + python-sandbox: + build: + context: ./execution-service/execution/python + dockerfile: Dockerfile + networks: + - apps_network + container_name: python-sandbox + +networks: + apps_network: + +volumes: + # Mounts a volume for RabbitMQ data persistence. + # This ensures that data is not lost when the container is restarted or removed. + rabbitmq_data: diff --git a/apps/execution-service/.dockerignore b/apps/execution-service/.dockerignore new file mode 100644 index 0000000000..c6228e8d6c --- /dev/null +++ b/apps/execution-service/.dockerignore @@ -0,0 +1,9 @@ +.env.example + +.git +.gitignore + +.dockerignore +Dockerfile + +README.md diff --git a/apps/execution-service/.env.example b/apps/execution-service/.env.example new file mode 100644 index 0000000000..4122078fbd --- /dev/null +++ b/apps/execution-service/.env.example @@ -0,0 +1,10 @@ +FIREBASE_CREDENTIAL_PATH=cs3219-staging-codeexecution-firebase-adminsdk-ce48j-00ab09514c.json +PORT=8083 + +# If you are NOT USING docker, use the below variables +# HISTORY_SERVICE_URL=http://localhost:8082/ +# RABBITMQ_URL=amqp://guest:guest@localhost:5672/ + +# If you are USING docker, use the below variables +HISTORY_SERVICE_URL=http://history-service:8082/ +RABBITMQ_URL=amqp://guest:guest@rabbitmq:5672/ diff --git a/apps/execution-service/.gitignore b/apps/execution-service/.gitignore new file mode 100644 index 0000000000..ef986d267e --- /dev/null +++ b/apps/execution-service/.gitignore @@ -0,0 +1,2 @@ +.env +cs3219-staging-codeexecution-firebase-adminsdk-ce48j-00ab09514c.json diff --git a/apps/execution-service/Dockerfile b/apps/execution-service/Dockerfile new file mode 100644 index 0000000000..eda8bea8d0 --- /dev/null +++ b/apps/execution-service/Dockerfile @@ -0,0 +1,22 @@ +FROM golang:1.23 + +WORKDIR /usr/src/app + +# Install Docker CLI +RUN apt-get update && apt-get install -y \ + docker.io \ + && apt-get clean \ + && rm -rf /var/lib/apt/lists/* + +# pre-copy/cache go.mod for pre-downloading dependencies and only redownloading them in subsequent builds if they change +COPY go.mod go.sum ./ + +RUN go mod tidy && go mod download && go mod verify + +COPY . . + +RUN go build -v -o /usr/local/bin/app ./main.go + +EXPOSE 8083 + +CMD ["app"] diff --git a/apps/execution-service/README.md b/apps/execution-service/README.md new file mode 100644 index 0000000000..c53dc3ab9f --- /dev/null +++ b/apps/execution-service/README.md @@ -0,0 +1,242 @@ +# Execution Service + +### Installation + +1. Install dependencies: + +```bash +go mod tidy +``` + +2. Create the `.env` file from copying the `.env.example`, and copy the firebase JSON file into execution-service/ fill in the `FIREBASE_CREDENTIAL_PATH` with the path of the firebase credential JSON file. + +### Running the Application + +To start the server, run the following command: + +```bash +go run main.go +``` + +The server will be available at http://localhost:8083. + +### Setting up message queue with RabbitMQ + +A message queue is used to pass submission results asynchronously from the execution-service to the history-service. + +1. In order to do so, we can run the following command to set up a docker container for RabbitMQ: + +```bash +docker run -d --name rabbitmq -p 5672:5672 -p 15672:15672 rabbitmq:3-management +``` + +2. Then we can run the execution-service: + +```bash +go run main.go +``` + +3. We can run the history-service by changing our directory and running the same command: + +```bash +cd ../history-service +go run main.go +``` + +To view more details on the RabbitMQ queue, we can go to `localhost:15672`, and login using `guest` as the username and password. + +### Running the Application via Docker + +To run the application via Docker, run the following command: + +```bash +docker build -t execution-service . +``` + +```bash +docker run -p 8083:8083 --env-file .env -d execution-service +``` + +The server will be available at http://localhost:8083. + +## API Endpoints + +- `POST /tests/populate` +- `GET /tests/{questionDocRefId}/` +- `POST /tests/{questionDocRefId}/execute` +- `POST /tests/{questionDocRefId}/submit` + +## Managing Firebase + +To reset and repopulate the database, run the following command: + +```bash +go run main.go +``` + +## Repopulate test cases + +To repopulate test cases, you need to repopulate the questions in the question-service, which will automatically call the execution-service to populate the test cases. + +In question-service, run the following command: + +```bash +go run main.go -populate +``` + +## API Documentation + +`GET /tests/{questionDocRefId}/` + +To read visible test cases via a question ID, run the following command: + +```bash +curl -X GET http://localhost:8083/tests/{questioinDocRefId}/ \ +-H "Content-Type: application/json" +``` + +The following json format will be returned: + +```json +[ + { + "input": "hello", + "expected": "olleh" + } +] +``` + +`POST /tests/{questionDocRefId}/execute` + +To execute test cases via a question ID without custom test cases, run the following command, with custom code and language: + +```bash +curl -X POST http://localhost:8083/tests/{questioinDocRefId}/execute \ +-H "Content-Type: application/json" \ +-d '{ +"code": "name = input()\nprint(name[::-1])", +"language": "Python" +}' +``` + +The following json format will be returned: + +```json +{ + "visibleTestResults": [ + { + "input": "hello", + "expected": "olleh", + "actual": "olleh", + "passed": true, + "error": "" + } + ], + "customTestResults": null +} +``` + +To execute visible and custom test cases via a question ID with custom test cases, run the following command, with custom code, language and custom test cases: + +```bash +curl -X POST http://localhost:8083/tests/{questioinDocRefId}/execute \ +-H "Content-Type: application/json" \ +-d '{ +"code": "name = input()\nprint(name[::-1])", +"language": "Python", +"customTestCases": "2\nHannah\nhannaH\nabcdefg\ngfedcba\n" +}' +``` + +The following json format will be returned: + +```json +{ + "visibleTestResults": [ + { + "input": "hello", + "expected": "olleh", + "actual": "olleh", + "passed": true, + "error": "" + } + ], + "customTestResults": [ + { + "input": "Hannah", + "expected": "hannaH", + "actual": "hannaH", + "passed": true, + "error": "" + }, + { + "input": "abcdefg", + "expected": "gfedcba", + "actual": "gfedcba", + "passed": true, + "error": "" + } + ] +} +``` + +`POST /tests/{questionDocRefId}/submit` + +To submit a solution and execute visible and hidden test cases via a question ID, run the following command, with custom code and language: + +```bash +curl -X POST http://localhost:8083/tests/{questioinDocRefId}/submit \ +-H "Content-Type: application/json" \ +-d '{ +"title": "Example Title", +"code": "name = input()\nprint(name[::-1])", +"language": "Python", +"user": "user123", +"matchedUser": "user456", +"matchedTopics": ["topic1", "topic2"], +"questionDifficulty": "Medium", +"questionTopics": ["Loops", "Strings"] +}' +``` + +The following json format will be returned: + +```json +{ + "visibleTestResults": [ + { + "input": "hello", + "expected": "olleh", + "actual": "olleh", + "passed": true, + "error": "" + } + ], + "hiddenTestResults": { + "passed": 2, + "total": 2 + }, + "status": "Accepted" +} +``` + +If compilation error exists or any of the tests (visible and hidden) fails, status "Attempted" will be returned: + +```json +{ + "visibleTestResults": [ + { + "input": "hello", + "expected": "olleh", + "actual": "", + "passed": false, + "error": "Command execution failed: Traceback (most recent call last):\n File \"/tmp/4149249165.py\", line 2, in \u003cmodule\u003e\n prit(name[::-1])\n ^^^^\nNameError: name 'prit' is not defined. Did you mean: 'print'?\n: %!w(*exec.ExitError=\u0026{0x4000364678 []})" + } + ], + "hiddenTestResults": { + "passed": 0, + "total": 2 + }, + "status": "Attempted" +} +``` diff --git a/apps/execution-service/constants/constant.go b/apps/execution-service/constants/constant.go new file mode 100644 index 0000000000..46d3face08 --- /dev/null +++ b/apps/execution-service/constants/constant.go @@ -0,0 +1,22 @@ +package constants + +const ( + JAVA = "Java" + PYTHON = "Python" + GOLANG = "Golang" + JAVASCRIPT = "Javascript" + CPP = "C++" +) + +const ( + ACCEPTED = "Accepted" + ATTEMPTED = "Attempted" +) + +var IS_VALID_LANGUAGE = map[string]bool{ + PYTHON: true, + //JAVA: true, + //GOLANG: true, + //JAVASCRIPT: true, + //CPP: true, +} diff --git a/apps/execution-service/execution/python/Dockerfile b/apps/execution-service/execution/python/Dockerfile new file mode 100644 index 0000000000..54ff4e8d0e --- /dev/null +++ b/apps/execution-service/execution/python/Dockerfile @@ -0,0 +1,3 @@ +FROM python:3.10-slim + +WORKDIR /app diff --git a/apps/execution-service/execution/python/python.go b/apps/execution-service/execution/python/python.go new file mode 100644 index 0000000000..726bc29d8b --- /dev/null +++ b/apps/execution-service/execution/python/python.go @@ -0,0 +1,33 @@ +package python + +import ( + "bytes" + "fmt" + "os/exec" + "strings" +) + +func RunPythonCode(code string, input string) (string, string, error) { + cmd := exec.Command( + "docker", "run", "--rm", + "-i", // allows for standard input to be passed in + "apps-python-sandbox", + "python", "-c", code, + ) + + // Pass in any input data to the Python script + cmd.Stdin = bytes.NewBufferString(input) + + // Capture output and error + var output bytes.Buffer + var errorOutput bytes.Buffer + cmd.Stdout = &output + cmd.Stderr = &errorOutput + + // Run the command + if err := cmd.Run(); err != nil { + return "", fmt.Sprintf("Command execution failed: %s: %v", errorOutput.String(), err), nil + } + + return strings.TrimSuffix(output.String(), "\n"), strings.TrimSuffix(errorOutput.String(), "\n"), nil +} diff --git a/apps/execution-service/go.mod b/apps/execution-service/go.mod new file mode 100644 index 0000000000..aff484d2a7 --- /dev/null +++ b/apps/execution-service/go.mod @@ -0,0 +1,54 @@ +module execution-service + +go 1.23.1 + +require ( + cloud.google.com/go/firestore v1.17.0 + firebase.google.com/go/v4 v4.15.0 + github.com/go-chi/chi/v5 v5.1.0 + github.com/go-chi/cors v1.2.1 + github.com/joho/godotenv v1.5.1 + github.com/traefik/yaegi v0.16.1 + google.golang.org/api v0.203.0 +) + +require ( + cloud.google.com/go v0.116.0 // indirect + cloud.google.com/go/auth v0.9.9 // indirect + cloud.google.com/go/auth/oauth2adapt v0.2.4 // indirect + cloud.google.com/go/compute/metadata v0.5.2 // indirect + cloud.google.com/go/iam v1.2.1 // indirect + cloud.google.com/go/longrunning v0.6.1 // indirect + cloud.google.com/go/storage v1.43.0 // indirect + github.com/MicahParks/keyfunc v1.9.0 // indirect + github.com/felixge/httpsnoop v1.0.4 // indirect + github.com/go-logr/logr v1.4.2 // indirect + github.com/go-logr/stdr v1.2.2 // indirect + github.com/golang-jwt/jwt/v4 v4.5.0 // indirect + github.com/golang/groupcache v0.0.0-20210331224755-41bb18bfe9da // indirect + github.com/golang/protobuf v1.5.4 // indirect + github.com/google/s2a-go v0.1.8 // indirect + github.com/google/uuid v1.6.0 // indirect + github.com/googleapis/enterprise-certificate-proxy v0.3.4 // indirect + github.com/googleapis/gax-go/v2 v2.13.0 // indirect + github.com/rabbitmq/amqp091-go v1.10.0 // indirect + go.opencensus.io v0.24.0 // indirect + go.opentelemetry.io/contrib/instrumentation/google.golang.org/grpc/otelgrpc v0.54.0 // indirect + go.opentelemetry.io/contrib/instrumentation/net/http/otelhttp v0.54.0 // indirect + go.opentelemetry.io/otel v1.29.0 // indirect + go.opentelemetry.io/otel/metric v1.29.0 // indirect + go.opentelemetry.io/otel/trace v1.29.0 // indirect + golang.org/x/crypto v0.28.0 // indirect + golang.org/x/net v0.30.0 // indirect + golang.org/x/oauth2 v0.23.0 // indirect + golang.org/x/sync v0.8.0 // indirect + golang.org/x/sys v0.26.0 // indirect + golang.org/x/text v0.19.0 // indirect + golang.org/x/time v0.7.0 // indirect + google.golang.org/appengine/v2 v2.0.2 // indirect + google.golang.org/genproto v0.0.0-20241015192408-796eee8c2d53 // indirect + google.golang.org/genproto/googleapis/api v0.0.0-20241007155032-5fefd90f89a9 // indirect + google.golang.org/genproto/googleapis/rpc v0.0.0-20241015192408-796eee8c2d53 // indirect + google.golang.org/grpc v1.67.1 // indirect + google.golang.org/protobuf v1.35.1 // indirect +) diff --git a/apps/execution-service/go.sum b/apps/execution-service/go.sum new file mode 100644 index 0000000000..8a595690fa --- /dev/null +++ b/apps/execution-service/go.sum @@ -0,0 +1,199 @@ +cloud.google.com/go v0.26.0/go.mod h1:aQUYkXzVsufM+DwF1aE+0xfcU+56JwCaLick0ClmMTw= +cloud.google.com/go v0.116.0 h1:B3fRrSDkLRt5qSHWe40ERJvhvnQwdZiHu0bJOpldweE= +cloud.google.com/go v0.116.0/go.mod h1:cEPSRWPzZEswwdr9BxE6ChEn01dWlTaF05LiC2Xs70U= +cloud.google.com/go/auth v0.9.9 h1:BmtbpNQozo8ZwW2t7QJjnrQtdganSdmqeIBxHxNkEZQ= +cloud.google.com/go/auth v0.9.9/go.mod h1:xxA5AqpDrvS+Gkmo9RqrGGRh6WSNKKOXhY3zNOr38tI= +cloud.google.com/go/auth/oauth2adapt v0.2.4 h1:0GWE/FUsXhf6C+jAkWgYm7X9tK8cuEIfy19DBn6B6bY= +cloud.google.com/go/auth/oauth2adapt v0.2.4/go.mod h1:jC/jOpwFP6JBxhB3P5Rr0a9HLMC/Pe3eaL4NmdvqPtc= +cloud.google.com/go/compute/metadata v0.5.2 h1:UxK4uu/Tn+I3p2dYWTfiX4wva7aYlKixAHn3fyqngqo= +cloud.google.com/go/compute/metadata v0.5.2/go.mod h1:C66sj2AluDcIqakBq/M8lw8/ybHgOZqin2obFxa/E5k= +cloud.google.com/go/firestore v1.17.0 h1:iEd1LBbkDZTFsLw3sTH50eyg4qe8eoG6CjocmEXO9aQ= +cloud.google.com/go/firestore v1.17.0/go.mod h1:69uPx1papBsY8ZETooc71fOhoKkD70Q1DwMrtKuOT/Y= +cloud.google.com/go/iam v1.2.1 h1:QFct02HRb7H12J/3utj0qf5tobFh9V4vR6h9eX5EBRU= +cloud.google.com/go/iam v1.2.1/go.mod h1:3VUIJDPpwT6p/amXRC5GY8fCCh70lxPygguVtI0Z4/g= +cloud.google.com/go/longrunning v0.6.1 h1:lOLTFxYpr8hcRtcwWir5ITh1PAKUD/sG2lKrTSYjyMc= +cloud.google.com/go/longrunning v0.6.1/go.mod h1:nHISoOZpBcmlwbJmiVk5oDRz0qG/ZxPynEGs1iZ79s0= +cloud.google.com/go/storage v1.43.0 h1:CcxnSohZwizt4LCzQHWvBf1/kvtHUn7gk9QERXPyXFs= +cloud.google.com/go/storage v1.43.0/go.mod h1:ajvxEa7WmZS1PxvKRq4bq0tFT3vMd502JwstCcYv0Q0= +firebase.google.com/go/v4 v4.15.0 h1:k27M+cHbyN1YpBI2Cf4NSjeHnnYRB9ldXwpqA5KikN0= +firebase.google.com/go/v4 v4.15.0/go.mod h1:S/4MJqVZn1robtXkHhpRUbwOC4gdYtgsiMMJQ4x+xmQ= +github.com/BurntSushi/toml v0.3.1/go.mod h1:xHWCNGjB5oqiDr8zfno3MHue2Ht5sIBksp03qcyfWMU= +github.com/MicahParks/keyfunc v1.9.0 h1:lhKd5xrFHLNOWrDc4Tyb/Q1AJ4LCzQ48GVJyVIID3+o= +github.com/MicahParks/keyfunc v1.9.0/go.mod h1:IdnCilugA0O/99dW+/MkvlyrsX8+L8+x95xuVNtM5jw= +github.com/census-instrumentation/opencensus-proto v0.2.1/go.mod h1:f6KPmirojxKA12rnyqOA5BBL4O983OfeGPqjHWSTneU= +github.com/client9/misspell v0.3.4/go.mod h1:qj6jICC3Q7zFZvVWo7KLAzC3yx5G7kyvSDkc90ppPyw= +github.com/cncf/udpa/go v0.0.0-20191209042840-269d4d468f6f/go.mod h1:M8M6+tZqaGXZJjfX53e64911xZQV5JYwmTeXPW+k8Sc= +github.com/davecgh/go-spew v1.1.0/go.mod h1:J7Y8YcW2NihsgmVo/mv3lAwl/skON4iLHjSsI+c5H38= +github.com/davecgh/go-spew v1.1.1 h1:vj9j/u1bqnvCEfJOwUhtlOARqs3+rkHYY13jYWTU97c= +github.com/davecgh/go-spew v1.1.1/go.mod h1:J7Y8YcW2NihsgmVo/mv3lAwl/skON4iLHjSsI+c5H38= +github.com/envoyproxy/go-control-plane v0.9.0/go.mod h1:YTl/9mNaCwkRvm6d1a2C3ymFceY/DCBVvsKhRF0iEA4= +github.com/envoyproxy/go-control-plane v0.9.1-0.20191026205805-5f8ba28d4473/go.mod h1:YTl/9mNaCwkRvm6d1a2C3ymFceY/DCBVvsKhRF0iEA4= +github.com/envoyproxy/go-control-plane v0.9.4/go.mod h1:6rpuAdCZL397s3pYoYcLgu1mIlRU8Am5FuJP05cCM98= +github.com/envoyproxy/protoc-gen-validate v0.1.0/go.mod h1:iSmxcyjqTsJpI2R4NaDN7+kN2VEUnK/pcBlmesArF7c= +github.com/felixge/httpsnoop v1.0.4 h1:NFTV2Zj1bL4mc9sqWACXbQFVBBg2W3GPvqp8/ESS2Wg= +github.com/felixge/httpsnoop v1.0.4/go.mod h1:m8KPJKqk1gH5J9DgRY2ASl2lWCfGKXixSwevea8zH2U= +github.com/go-chi/chi/v5 v5.1.0 h1:acVI1TYaD+hhedDJ3r54HyA6sExp3HfXq7QWEEY/xMw= +github.com/go-chi/chi/v5 v5.1.0/go.mod h1:DslCQbL2OYiznFReuXYUmQ2hGd1aDpCnlMNITLSKoi8= +github.com/go-chi/cors v1.2.1 h1:xEC8UT3Rlp2QuWNEr4Fs/c2EAGVKBwy/1vHx3bppil4= +github.com/go-chi/cors v1.2.1/go.mod h1:sSbTewc+6wYHBBCW7ytsFSn836hqM7JxpglAy2Vzc58= +github.com/go-logr/logr v1.2.2/go.mod h1:jdQByPbusPIv2/zmleS9BjJVeZ6kBagPoEUsqbVz/1A= +github.com/go-logr/logr v1.4.2 h1:6pFjapn8bFcIbiKo3XT4j/BhANplGihG6tvd+8rYgrY= +github.com/go-logr/logr v1.4.2/go.mod h1:9T104GzyrTigFIr8wt5mBrctHMim0Nb2HLGrmQ40KvY= +github.com/go-logr/stdr v1.2.2 h1:hSWxHoqTgW2S2qGc0LTAI563KZ5YKYRhT3MFKZMbjag= +github.com/go-logr/stdr v1.2.2/go.mod h1:mMo/vtBO5dYbehREoey6XUKy/eSumjCCveDpRre4VKE= +github.com/golang-jwt/jwt/v4 v4.4.2/go.mod h1:m21LjoU+eqJr34lmDMbreY2eSTRJ1cv77w39/MY0Ch0= +github.com/golang-jwt/jwt/v4 v4.5.0 h1:7cYmW1XlMY7h7ii7UhUyChSgS5wUJEnm9uZVTGqOWzg= +github.com/golang-jwt/jwt/v4 v4.5.0/go.mod h1:m21LjoU+eqJr34lmDMbreY2eSTRJ1cv77w39/MY0Ch0= +github.com/golang/glog v0.0.0-20160126235308-23def4e6c14b/go.mod h1:SBH7ygxi8pfUlaOkMMuAQtPIUF8ecWP5IEl/CR7VP2Q= +github.com/golang/groupcache v0.0.0-20200121045136-8c9f03a8e57e/go.mod h1:cIg4eruTrX1D+g88fzRXU5OdNfaM+9IcxsU14FzY7Hc= +github.com/golang/groupcache v0.0.0-20210331224755-41bb18bfe9da h1:oI5xCqsCo564l8iNU+DwB5epxmsaqB+rhGL0m5jtYqE= +github.com/golang/groupcache v0.0.0-20210331224755-41bb18bfe9da/go.mod h1:cIg4eruTrX1D+g88fzRXU5OdNfaM+9IcxsU14FzY7Hc= +github.com/golang/mock v1.1.1/go.mod h1:oTYuIxOrZwtPieC+H1uAHpcLFnEyAGVDL/k47Jfbm0A= +github.com/golang/protobuf v1.2.0/go.mod h1:6lQm79b+lXiMfvg/cZm0SGofjICqVBUtrP5yJMmIC1U= +github.com/golang/protobuf v1.3.1/go.mod h1:6lQm79b+lXiMfvg/cZm0SGofjICqVBUtrP5yJMmIC1U= +github.com/golang/protobuf v1.3.2/go.mod h1:6lQm79b+lXiMfvg/cZm0SGofjICqVBUtrP5yJMmIC1U= +github.com/golang/protobuf v1.4.0-rc.1/go.mod h1:ceaxUfeHdC40wWswd/P6IGgMaK3YpKi5j83Wpe3EHw8= +github.com/golang/protobuf v1.4.0-rc.1.0.20200221234624-67d41d38c208/go.mod h1:xKAWHe0F5eneWXFV3EuXVDTCmh+JuBKY0li0aMyXATA= +github.com/golang/protobuf v1.4.0-rc.2/go.mod h1:LlEzMj4AhA7rCAGe4KMBDvJI+AwstrUpVNzEA03Pprs= +github.com/golang/protobuf v1.4.0-rc.4.0.20200313231945-b860323f09d0/go.mod h1:WU3c8KckQ9AFe+yFwt9sWVRKCVIyN9cPHBJSNnbL67w= +github.com/golang/protobuf v1.4.0/go.mod h1:jodUvKwWbYaEsadDk5Fwe5c77LiNKVO9IDvqG2KuDX0= +github.com/golang/protobuf v1.4.1/go.mod h1:U8fpvMrcmy5pZrNK1lt4xCsGvpyWQ/VVv6QDs8UjoX8= +github.com/golang/protobuf v1.4.3/go.mod h1:oDoupMAO8OvCJWAcko0GGGIgR6R6ocIYbsSw735rRwI= +github.com/golang/protobuf v1.5.4 h1:i7eJL8qZTpSEXOPTxNKhASYpMn+8e5Q6AdndVa1dWek= +github.com/golang/protobuf v1.5.4/go.mod h1:lnTiLA8Wa4RWRcIUkrtSVa5nRhsEGBg48fD6rSs7xps= +github.com/google/go-cmp v0.2.0/go.mod h1:oXzfMopK8JAjlY9xF4vHSVASa0yLyX7SntLO5aqRK0M= +github.com/google/go-cmp v0.3.0/go.mod h1:8QqcDgzrUqlUb/G2PQTWiueGozuR1884gddMywk6iLU= +github.com/google/go-cmp v0.3.1/go.mod h1:8QqcDgzrUqlUb/G2PQTWiueGozuR1884gddMywk6iLU= +github.com/google/go-cmp v0.4.0/go.mod h1:v8dTdLbMG2kIc/vJvl+f65V22dbkXbowE6jgT/gNBxE= +github.com/google/go-cmp v0.5.0/go.mod h1:v8dTdLbMG2kIc/vJvl+f65V22dbkXbowE6jgT/gNBxE= +github.com/google/go-cmp v0.5.3/go.mod h1:v8dTdLbMG2kIc/vJvl+f65V22dbkXbowE6jgT/gNBxE= +github.com/google/go-cmp v0.6.0 h1:ofyhxvXcZhMsU5ulbFiLKl/XBFqE1GSq7atu8tAmTRI= +github.com/google/go-cmp v0.6.0/go.mod h1:17dUlkBOakJ0+DkrSSNjCkIjxS6bF9zb3elmeNGIjoY= +github.com/google/martian/v3 v3.3.3 h1:DIhPTQrbPkgs2yJYdXU/eNACCG5DVQjySNRNlflZ9Fc= +github.com/google/martian/v3 v3.3.3/go.mod h1:iEPrYcgCF7jA9OtScMFQyAlZZ4YXTKEtJ1E6RWzmBA0= +github.com/google/s2a-go v0.1.8 h1:zZDs9gcbt9ZPLV0ndSyQk6Kacx2g/X+SKYovpnz3SMM= +github.com/google/s2a-go v0.1.8/go.mod h1:6iNWHTpQ+nfNRN5E00MSdfDwVesa8hhS32PhPO8deJA= +github.com/google/uuid v1.1.2/go.mod h1:TIyPZe4MgqvfeYDBFedMoGGpEw/LqOeaOT+nhxU+yHo= +github.com/google/uuid v1.6.0 h1:NIvaJDMOsjHA8n1jAhLSgzrAzy1Hgr+hNrb57e+94F0= +github.com/google/uuid v1.6.0/go.mod h1:TIyPZe4MgqvfeYDBFedMoGGpEw/LqOeaOT+nhxU+yHo= +github.com/googleapis/enterprise-certificate-proxy v0.3.4 h1:XYIDZApgAnrN1c855gTgghdIA6Stxb52D5RnLI1SLyw= +github.com/googleapis/enterprise-certificate-proxy v0.3.4/go.mod h1:YKe7cfqYXjKGpGvmSg28/fFvhNzinZQm8DGnaburhGA= +github.com/googleapis/gax-go/v2 v2.13.0 h1:yitjD5f7jQHhyDsnhKEBU52NdvvdSeGzlAnDPT0hH1s= +github.com/googleapis/gax-go/v2 v2.13.0/go.mod h1:Z/fvTZXF8/uw7Xu5GuslPw+bplx6SS338j1Is2S+B7A= +github.com/joho/godotenv v1.5.1 h1:7eLL/+HRGLY0ldzfGMeQkb7vMd0as4CfYvUVzLqw0N0= +github.com/joho/godotenv v1.5.1/go.mod h1:f4LDr5Voq0i2e/R5DDNOoa2zzDfwtkZa6DnEwAbqwq4= +github.com/pmezard/go-difflib v1.0.0 h1:4DBwDE0NGyQoBHbLQYPwSUPoCMWR5BEzIk/f1lZbAQM= +github.com/pmezard/go-difflib v1.0.0/go.mod h1:iKH77koFhYxTK1pcRnkKkqfTogsbg7gZNVY4sRDYZ/4= +github.com/prometheus/client_model v0.0.0-20190812154241-14fe0d1b01d4/go.mod h1:xMI15A0UPsDsEKsMN9yxemIoYk6Tm2C1GtYGdfGttqA= +github.com/rabbitmq/amqp091-go v1.10.0 h1:STpn5XsHlHGcecLmMFCtg7mqq0RnD+zFr4uzukfVhBw= +github.com/rabbitmq/amqp091-go v1.10.0/go.mod h1:Hy4jKW5kQART1u+JkDTF9YYOQUHXqMuhrgxOEeS7G4o= +github.com/stretchr/objx v0.1.0/go.mod h1:HFkY916IF+rwdDfMAkV7OtwuqBVzrE8GR6GFx+wExME= +github.com/stretchr/objx v0.4.0/go.mod h1:YvHI0jy2hoMjB+UWwv71VJQ9isScKT/TqJzVSSt89Yw= +github.com/stretchr/objx v0.5.0/go.mod h1:Yh+to48EsGEfYuaHDzXPcE3xhTkx73EhmCGUpEOglKo= +github.com/stretchr/testify v1.7.1/go.mod h1:6Fq8oRcR53rry900zMqJjRRixrwX3KX962/h/Wwjteg= +github.com/stretchr/testify v1.8.0/go.mod h1:yNjHg4UonilssWZ8iaSj1OCr/vHnekPRkoO+kdMU+MU= +github.com/stretchr/testify v1.8.1/go.mod h1:w2LPCIKwWwSfY2zedu0+kehJoqGctiVI29o6fzry7u4= +github.com/stretchr/testify v1.9.0 h1:HtqpIVDClZ4nwg75+f6Lvsy/wHu+3BoSGCbBAcpTsTg= +github.com/stretchr/testify v1.9.0/go.mod h1:r2ic/lqez/lEtzL7wO/rwa5dbSLXVDPFyf8C91i36aY= +github.com/traefik/yaegi v0.16.1 h1:f1De3DVJqIDKmnasUF6MwmWv1dSEEat0wcpXhD2On3E= +github.com/traefik/yaegi v0.16.1/go.mod h1:4eVhbPb3LnD2VigQjhYbEJ69vDRFdT2HQNrXx8eEwUY= +go.opencensus.io v0.24.0 h1:y73uSU6J157QMP2kn2r30vwW1A2W2WFwSCGnAVxeaD0= +go.opencensus.io v0.24.0/go.mod h1:vNK8G9p7aAivkbmorf4v+7Hgx+Zs0yY+0fOtgBfjQKo= +go.opentelemetry.io/contrib/instrumentation/google.golang.org/grpc/otelgrpc v0.54.0 h1:r6I7RJCN86bpD/FQwedZ0vSixDpwuWREjW9oRMsmqDc= +go.opentelemetry.io/contrib/instrumentation/google.golang.org/grpc/otelgrpc v0.54.0/go.mod h1:B9yO6b04uB80CzjedvewuqDhxJxi11s7/GtiGa8bAjI= +go.opentelemetry.io/contrib/instrumentation/net/http/otelhttp v0.54.0 h1:TT4fX+nBOA/+LUkobKGW1ydGcn+G3vRw9+g5HwCphpk= +go.opentelemetry.io/contrib/instrumentation/net/http/otelhttp v0.54.0/go.mod h1:L7UH0GbB0p47T4Rri3uHjbpCFYrVrwc1I25QhNPiGK8= +go.opentelemetry.io/otel v1.29.0 h1:PdomN/Al4q/lN6iBJEN3AwPvUiHPMlt93c8bqTG5Llw= +go.opentelemetry.io/otel v1.29.0/go.mod h1:N/WtXPs1CNCUEx+Agz5uouwCba+i+bJGFicT8SR4NP8= +go.opentelemetry.io/otel/metric v1.29.0 h1:vPf/HFWTNkPu1aYeIsc98l4ktOQaL6LeSoeV2g+8YLc= +go.opentelemetry.io/otel/metric v1.29.0/go.mod h1:auu/QWieFVWx+DmQOUMgj0F8LHWdgalxXqvp7BII/W8= +go.opentelemetry.io/otel/sdk v1.29.0 h1:vkqKjk7gwhS8VaWb0POZKmIEDimRCMsopNYnriHyryo= +go.opentelemetry.io/otel/sdk v1.29.0/go.mod h1:pM8Dx5WKnvxLCb+8lG1PRNIDxu9g9b9g59Qr7hfAAok= +go.opentelemetry.io/otel/trace v1.29.0 h1:J/8ZNK4XgR7a21DZUAsbF8pZ5Jcw1VhACmnYt39JTi4= +go.opentelemetry.io/otel/trace v1.29.0/go.mod h1:eHl3w0sp3paPkYstJOmAimxhiFXPg+MMTlEh3nsQgWQ= +golang.org/x/crypto v0.0.0-20190308221718-c2843e01d9a2/go.mod h1:djNgcEr1/C05ACkg1iLfiJU5Ep61QUkGW8qpdssI0+w= +golang.org/x/crypto v0.0.0-20200622213623-75b288015ac9/go.mod h1:LzIPMQfyMNhhGPhUkYOs5KpL4U8rLKemX1yGLhDgUto= +golang.org/x/crypto v0.28.0 h1:GBDwsMXVQi34v5CCYUm2jkJvu4cbtru2U4TN2PSyQnw= +golang.org/x/crypto v0.28.0/go.mod h1:rmgy+3RHxRZMyY0jjAJShp2zgEdOqj2AO7U0pYmeQ7U= +golang.org/x/exp v0.0.0-20190121172915-509febef88a4/go.mod h1:CJ0aWSM057203Lf6IL+f9T1iT9GByDxfZKAQTCR3kQA= +golang.org/x/lint v0.0.0-20181026193005-c67002cb31c3/go.mod h1:UVdnD1Gm6xHRNCYTkRU2/jEulfH38KcIWyp/GAMgvoE= +golang.org/x/lint v0.0.0-20190227174305-5b3e6a55c961/go.mod h1:wehouNa3lNwaWXcvxsM5YxQ5yQlVC4a0KAMCusXpPoU= +golang.org/x/lint v0.0.0-20190313153728-d0100b6bd8b3/go.mod h1:6SW0HCj/g11FgYtHlgUYUwCkIfeOF89ocIRzGO/8vkc= +golang.org/x/net v0.0.0-20180724234803-3673e40ba225/go.mod h1:mL1N/T3taQHkDXs73rZJwtUhF3w3ftmwwsq0BUmARs4= +golang.org/x/net v0.0.0-20180826012351-8a410e7b638d/go.mod h1:mL1N/T3taQHkDXs73rZJwtUhF3w3ftmwwsq0BUmARs4= +golang.org/x/net v0.0.0-20190213061140-3a22650c66bd/go.mod h1:mL1N/T3taQHkDXs73rZJwtUhF3w3ftmwwsq0BUmARs4= +golang.org/x/net v0.0.0-20190311183353-d8887717615a/go.mod h1:t9HGtf8HONx5eT2rtn7q6eTqICYqUVnKs3thJo3Qplg= +golang.org/x/net v0.0.0-20190404232315-eb5bcb51f2a3/go.mod h1:t9HGtf8HONx5eT2rtn7q6eTqICYqUVnKs3thJo3Qplg= +golang.org/x/net v0.0.0-20201110031124-69a78807bb2b/go.mod h1:sp8m0HH+o8qH0wwXwYZr8TS3Oi6o0r6Gce1SSxlDquU= +golang.org/x/net v0.0.0-20220708220712-1185a9018129/go.mod h1:XRhObCWvk6IyKnWLug+ECip1KBveYUHfp+8e9klMJ9c= +golang.org/x/net v0.30.0 h1:AcW1SDZMkb8IpzCdQUaIq2sP4sZ4zw+55h6ynffypl4= +golang.org/x/net v0.30.0/go.mod h1:2wGyMJ5iFasEhkwi13ChkO/t1ECNC4X4eBKkVFyYFlU= +golang.org/x/oauth2 v0.0.0-20180821212333-d2e6202438be/go.mod h1:N/0e6XlmueqKjAGxoOufVs8QHGRruUQn6yWY3a++T0U= +golang.org/x/oauth2 v0.23.0 h1:PbgcYx2W7i4LvjJWEbf0ngHV6qJYr86PkAV3bXdLEbs= +golang.org/x/oauth2 v0.23.0/go.mod h1:XYTD2NtWslqkgxebSiOHnXEap4TF09sJSc7H1sXbhtI= +golang.org/x/sync v0.0.0-20180314180146-1d60e4601c6f/go.mod h1:RxMgew5VJxzue5/jJTE5uejpjVlOe/izrB70Jof72aM= +golang.org/x/sync v0.0.0-20181108010431-42b317875d0f/go.mod h1:RxMgew5VJxzue5/jJTE5uejpjVlOe/izrB70Jof72aM= +golang.org/x/sync v0.0.0-20190423024810-112230192c58/go.mod h1:RxMgew5VJxzue5/jJTE5uejpjVlOe/izrB70Jof72aM= +golang.org/x/sync v0.8.0 h1:3NFvSEYkUoMifnESzZl15y791HH1qU2xm6eCJU5ZPXQ= +golang.org/x/sync v0.8.0/go.mod h1:Czt+wKu1gCyEFDUtn0jG5QVvpJ6rzVqr5aXyt9drQfk= +golang.org/x/sys v0.0.0-20180830151530-49385e6e1522/go.mod h1:STP8DvDyc/dI5b8T5hshtkjS+E42TnysNCUPdjciGhY= +golang.org/x/sys v0.0.0-20190215142949-d0b11bdaac8a/go.mod h1:STP8DvDyc/dI5b8T5hshtkjS+E42TnysNCUPdjciGhY= +golang.org/x/sys v0.0.0-20190412213103-97732733099d/go.mod h1:h1NjWce9XRLGQEsW7wpKNCjG9DtNlClVuFLEZdDNbEs= +golang.org/x/sys v0.0.0-20200930185726-fdedc70b468f/go.mod h1:h1NjWce9XRLGQEsW7wpKNCjG9DtNlClVuFLEZdDNbEs= +golang.org/x/sys v0.0.0-20210615035016-665e8c7367d1/go.mod h1:oPkhp1MJrh7nUepCBck5+mAzfO9JrbApNNgaTdGDITg= +golang.org/x/sys v0.0.0-20220520151302-bc2c85ada10a/go.mod h1:oPkhp1MJrh7nUepCBck5+mAzfO9JrbApNNgaTdGDITg= +golang.org/x/sys v0.26.0 h1:KHjCJyddX0LoSTb3J+vWpupP9p0oznkqVk/IfjymZbo= +golang.org/x/sys v0.26.0/go.mod h1:/VUhepiaJMQUp4+oa/7Zr1D23ma6VTLIYjOOTFZPUcA= +golang.org/x/term v0.0.0-20210927222741-03fcf44c2211/go.mod h1:jbD1KX2456YbFQfuXm/mYQcufACuNUgVhRMnK/tPxf8= +golang.org/x/text v0.3.0/go.mod h1:NqM8EUOU14njkJ3fqMW+pc6Ldnwhi/IjpwHt7yyuwOQ= +golang.org/x/text v0.3.3/go.mod h1:5Zoc/QRtKVWzQhOtBMvqHzDpF6irO9z98xDceosuGiQ= +golang.org/x/text v0.3.7/go.mod h1:u+2+/6zg+i71rQMx5EYifcz6MCKuco9NR6JIITiCfzQ= +golang.org/x/text v0.19.0 h1:kTxAhCbGbxhK0IwgSKiMO5awPoDQ0RpfiVYBfK860YM= +golang.org/x/text v0.19.0/go.mod h1:BuEKDfySbSR4drPmRPG/7iBdf8hvFMuRexcpahXilzY= +golang.org/x/time v0.7.0 h1:ntUhktv3OPE6TgYxXWv9vKvUSJyIFJlyohwbkEwPrKQ= +golang.org/x/time v0.7.0/go.mod h1:3BpzKBy/shNhVucY/MWOyx10tF3SFh9QdLuxbVysPQM= +golang.org/x/tools v0.0.0-20180917221912-90fa682c2a6e/go.mod h1:n7NCudcB/nEzxVGmLbDWY5pfWTLqBcC2KZ6jyYvM4mQ= +golang.org/x/tools v0.0.0-20190114222345-bf090417da8b/go.mod h1:n7NCudcB/nEzxVGmLbDWY5pfWTLqBcC2KZ6jyYvM4mQ= +golang.org/x/tools v0.0.0-20190226205152-f727befe758c/go.mod h1:9Yl7xja0Znq3iFh3HoIrodX9oNMXvdceNzlUR8zjMvY= +golang.org/x/tools v0.0.0-20190311212946-11955173bddd/go.mod h1:LCzVGOaR6xXOjkQ3onu1FJEFr0SW1gC7cKk1uF8kGRs= +golang.org/x/tools v0.0.0-20190524140312-2c0ae7006135/go.mod h1:RgjU9mgBXZiqYHBnxXauZ1Gv1EHHAz9KjViQ78xBX0Q= +golang.org/x/xerrors v0.0.0-20191204190536-9bdfabe68543/go.mod h1:I/5z698sn9Ka8TeJc9MKroUUfqBBauWjQqLJ2OPfmY0= +google.golang.org/api v0.203.0 h1:SrEeuwU3S11Wlscsn+LA1kb/Y5xT8uggJSkIhD08NAU= +google.golang.org/api v0.203.0/go.mod h1:BuOVyCSYEPwJb3npWvDnNmFI92f3GeRnHNkETneT3SI= +google.golang.org/appengine v1.1.0/go.mod h1:EbEs0AVv82hx2wNQdGPgUI5lhzA/G0D9YwlJXL52JkM= +google.golang.org/appengine v1.4.0/go.mod h1:xpcJRLb0r/rnEns0DIKYYv+WjYCduHsrkT7/EB5XEv4= +google.golang.org/appengine/v2 v2.0.2 h1:MSqyWy2shDLwG7chbwBJ5uMyw6SNqJzhJHNDwYB0Akk= +google.golang.org/appengine/v2 v2.0.2/go.mod h1:PkgRUWz4o1XOvbqtWTkBtCitEJ5Tp4HoVEdMMYQR/8E= +google.golang.org/genproto v0.0.0-20180817151627-c66870c02cf8/go.mod h1:JiN7NxoALGmiZfu7CAH4rXhgtRTLTxftemlI0sWmxmc= +google.golang.org/genproto v0.0.0-20190819201941-24fa4b261c55/go.mod h1:DMBHOl98Agz4BDEuKkezgsaosCRResVns1a3J2ZsMNc= +google.golang.org/genproto v0.0.0-20200526211855-cb27e3aa2013/go.mod h1:NbSheEEYHJ7i3ixzK3sjbqSGDJWnxyFXZblF3eUsNvo= +google.golang.org/genproto v0.0.0-20241015192408-796eee8c2d53 h1:Df6WuGvthPzc+JiQ/G+m+sNX24kc0aTBqoDN/0yyykE= +google.golang.org/genproto v0.0.0-20241015192408-796eee8c2d53/go.mod h1:fheguH3Am2dGp1LfXkrvwqC/KlFq8F0nLq3LryOMrrE= +google.golang.org/genproto/googleapis/api v0.0.0-20241007155032-5fefd90f89a9 h1:T6rh4haD3GVYsgEfWExoCZA2o2FmbNyKpTuAxbEFPTg= +google.golang.org/genproto/googleapis/api v0.0.0-20241007155032-5fefd90f89a9/go.mod h1:wp2WsuBYj6j8wUdo3ToZsdxxixbvQNAHqVJrTgi5E5M= +google.golang.org/genproto/googleapis/rpc v0.0.0-20241015192408-796eee8c2d53 h1:X58yt85/IXCx0Y3ZwN6sEIKZzQtDEYaBWrDvErdXrRE= +google.golang.org/genproto/googleapis/rpc v0.0.0-20241015192408-796eee8c2d53/go.mod h1:GX3210XPVPUjJbTUbvwI8f2IpZDMZuPJWDzDuebbviI= +google.golang.org/grpc v1.19.0/go.mod h1:mqu4LbDTu4XGKhr4mRzUsmM4RtVoemTSY81AxZiDr8c= +google.golang.org/grpc v1.23.0/go.mod h1:Y5yQAOtifL1yxbo5wqy6BxZv8vAUGQwXBOALyacEbxg= +google.golang.org/grpc v1.25.1/go.mod h1:c3i+UQWmh7LiEpx4sFZnkU36qjEYZ0imhYfXVyQciAY= +google.golang.org/grpc v1.27.0/go.mod h1:qbnxyOmOxrQa7FizSgH+ReBfzJrCY1pSN7KXBS8abTk= +google.golang.org/grpc v1.33.2/go.mod h1:JMHMWHQWaTccqQQlmk3MJZS+GWXOdAesneDmEnv2fbc= +google.golang.org/grpc v1.67.1 h1:zWnc1Vrcno+lHZCOofnIMvycFcc0QRGIzm9dhnDX68E= +google.golang.org/grpc v1.67.1/go.mod h1:1gLDyUQU7CTLJI90u3nXZ9ekeghjeM7pTDZlqFNg2AA= +google.golang.org/protobuf v0.0.0-20200109180630-ec00e32a8dfd/go.mod h1:DFci5gLYBciE7Vtevhsrf46CRTquxDuWsQurQQe4oz8= +google.golang.org/protobuf v0.0.0-20200221191635-4d8936d0db64/go.mod h1:kwYJMbMJ01Woi6D6+Kah6886xMZcty6N08ah7+eCXa0= +google.golang.org/protobuf v0.0.0-20200228230310-ab0ca4ff8a60/go.mod h1:cfTl7dwQJ+fmap5saPgwCLgHXTUD7jkjRqWcaiX5VyM= +google.golang.org/protobuf v1.20.1-0.20200309200217-e05f789c0967/go.mod h1:A+miEFZTKqfCUM6K7xSMQL9OKL/b6hQv+e19PK+JZNE= +google.golang.org/protobuf v1.21.0/go.mod h1:47Nbq4nVaFHyn7ilMalzfO3qCViNmqZ2kzikPIcrTAo= +google.golang.org/protobuf v1.22.0/go.mod h1:EGpADcykh3NcUnDUJcl1+ZksZNG86OlYog2l/sGQquU= +google.golang.org/protobuf v1.23.0/go.mod h1:EGpADcykh3NcUnDUJcl1+ZksZNG86OlYog2l/sGQquU= +google.golang.org/protobuf v1.23.1-0.20200526195155-81db48ad09cc/go.mod h1:EGpADcykh3NcUnDUJcl1+ZksZNG86OlYog2l/sGQquU= +google.golang.org/protobuf v1.25.0/go.mod h1:9JNX74DMeImyA3h4bdi1ymwjUzf21/xIlbajtzgsN7c= +google.golang.org/protobuf v1.35.1 h1:m3LfL6/Ca+fqnjnlqQXNpFPABW1UD7mjh8KO2mKFytA= +google.golang.org/protobuf v1.35.1/go.mod h1:9fA7Ob0pmnwhb644+1+CVWFRbNajQ6iRojtC/QF5bRE= +gopkg.in/check.v1 v0.0.0-20161208181325-20d25e280405/go.mod h1:Co6ibVJAznAaIkqp8huTwlJQCZ016jof/cbN4VW5Yz0= +gopkg.in/yaml.v3 v3.0.0-20200313102051-9f266ea9e77c/go.mod h1:K4uyk7z7BCEPqu6E+C64Yfv1cQ7kz7rIZviUmN+EgEM= +gopkg.in/yaml.v3 v3.0.1 h1:fxVm/GzAzEWqLHuvctI91KS9hhNmmWOoWu0XTYJS7CA= +gopkg.in/yaml.v3 v3.0.1/go.mod h1:K4uyk7z7BCEPqu6E+C64Yfv1cQ7kz7rIZviUmN+EgEM= +honnef.co/go/tools v0.0.0-20190102054323-c2f93a96b099/go.mod h1:rf3lG4BRIbNafJWhAfAdb/ePZxsR/4RtNHQocxwk9r4= +honnef.co/go/tools v0.0.0-20190523083050-ea95bdfd59fc/go.mod h1:rf3lG4BRIbNafJWhAfAdb/ePZxsR/4RtNHQocxwk9r4= diff --git a/apps/execution-service/handlers/execute.go b/apps/execution-service/handlers/execute.go new file mode 100644 index 0000000000..a98ac201ea --- /dev/null +++ b/apps/execution-service/handlers/execute.go @@ -0,0 +1,69 @@ +package handlers + +import ( + "encoding/json" + "execution-service/models" + "execution-service/utils" + "github.com/go-chi/chi/v5" + "google.golang.org/api/iterator" + "net/http" +) + +func (s *Service) ExecuteVisibleAndCustomTests(w http.ResponseWriter, r *http.Request) { + ctx := r.Context() + + questionDocRefId := chi.URLParam(r, "questionDocRefId") + if questionDocRefId == "" { + http.Error(w, "questionDocRefId is required", http.StatusBadRequest) + return + } + + var code models.Code + if err := utils.DecodeJSONBody(w, r, &code); err != nil { + http.Error(w, err.Error(), http.StatusBadRequest) + return + } + + iter := s.Client.Collection("tests").Where("questionDocRefId", "==", questionDocRefId).Limit(1).Documents(ctx) + doc, err := iter.Next() + if err != nil { + if err == iterator.Done { + http.Error(w, "Test not found", http.StatusNotFound) + return + } + http.Error(w, err.Error(), http.StatusInternalServerError) + return + } + defer iter.Stop() + + var test models.Test + if err := doc.DataTo(&test); err != nil { + http.Error(w, err.Error(), http.StatusInternalServerError) + return + } + + testResults, err := utils.ExecuteVisibleAndCustomTests(code, test) + if err != nil { + http.Error(w, err.Error(), http.StatusInternalServerError) + return + } + + w.Header().Set("Content-Type", "application/json") + w.WriteHeader(http.StatusOK) + json.NewEncoder(w).Encode(testResults) +} + +//curl -X POST http://localhost:8083/tests/Yt29JjnIDpRwIlYAX8OF/execute \ +//-H "Content-Type: application/json" \ +//-d '{ +//"code": "name = input()\nprint(name[::-1])", +//"language": "Python" +//}' + +//curl -X POST http://localhost:8083/tests/Yt29JjnIDpRwIlYAX8OF/execute \ +//-H "Content-Type: application/json" \ +//-d '{ +//"code": "name = input()\nprint(name[::-1])", +//"language": "Python", +//"customTestCases": "2\nHannah\nhannaH\nabcdefg\ngfedcba\n" +//}' diff --git a/apps/execution-service/handlers/populate.go b/apps/execution-service/handlers/populate.go new file mode 100644 index 0000000000..014b4fe760 --- /dev/null +++ b/apps/execution-service/handlers/populate.go @@ -0,0 +1,31 @@ +package handlers + +import ( + "execution-service/models" + "execution-service/utils" + "net/http" +) + +func (s *Service) PopulateTests(w http.ResponseWriter, r *http.Request) { + ctx := r.Context() + + var questions []models.Question + if err := utils.DecodeJSONBody(w, r, &questions); err != nil { + http.Error(w, err.Error(), http.StatusBadRequest) + return + } + + questionTitleToDocRefIdMap := make(map[string]string) + for _, question := range questions { + questionTitleToDocRefIdMap[question.Title] = question.QuestionDocRefId + } + + err := utils.RepopulateTests(ctx, s.Client, questionTitleToDocRefIdMap) + if err != nil { + http.Error(w, err.Error(), http.StatusInternalServerError) + return + } + + w.Header().Set("Content-Type", "application/json") + w.WriteHeader(http.StatusOK) +} diff --git a/apps/execution-service/handlers/read.go b/apps/execution-service/handlers/read.go new file mode 100644 index 0000000000..99e1a372c8 --- /dev/null +++ b/apps/execution-service/handlers/read.go @@ -0,0 +1,55 @@ +package handlers + +import ( + "encoding/json" + "execution-service/models" + "execution-service/utils" + "github.com/go-chi/chi/v5" + "google.golang.org/api/iterator" + "net/http" +) + +func (s *Service) ReadVisibleTests(w http.ResponseWriter, r *http.Request) { + ctx := r.Context() + + questionDocRefId := chi.URLParam(r, "questionDocRefId") + if questionDocRefId == "" { + http.Error(w, "questionDocRefId is required", http.StatusBadRequest) + return + } + + iter := s.Client.Collection("tests").Where("questionDocRefId", "==", questionDocRefId).Limit(1).Documents(ctx) + doc, err := iter.Next() + if err != nil { + if err == iterator.Done { + http.Error(w, "Test not found", http.StatusNotFound) + return + } + http.Error(w, err.Error(), http.StatusInternalServerError) + return + } + defer iter.Stop() + + var test models.Test + if err := doc.DataTo(&test); err != nil { + http.Error(w, err.Error(), http.StatusInternalServerError) + return + } + + _, visibleTestCases, err := utils.GetTestLengthAndUnexecutedCases(test.VisibleTestCases) + + var visibleTests []models.VisibleTest + for _, visibleTestCase := range visibleTestCases { + visibleTests = append(visibleTests, models.VisibleTest{ + Input: visibleTestCase.Input, + Expected: visibleTestCase.Expected, + }) + } + + w.Header().Set("Content-Type", "application/json") + w.WriteHeader(http.StatusOK) + json.NewEncoder(w).Encode(visibleTests) +} + +//curl -X GET http://localhost:8083/tests/bmzFyLMeSOoYU99pi4yZ/ \ +//-H "Content-Type: application/json" diff --git a/apps/execution-service/handlers/server.go b/apps/execution-service/handlers/server.go new file mode 100644 index 0000000000..2d237dc025 --- /dev/null +++ b/apps/execution-service/handlers/server.go @@ -0,0 +1,9 @@ +package handlers + +import ( + "cloud.google.com/go/firestore" +) + +type Service struct { + Client *firestore.Client +} diff --git a/apps/execution-service/handlers/submit.go b/apps/execution-service/handlers/submit.go new file mode 100644 index 0000000000..1411ffcea7 --- /dev/null +++ b/apps/execution-service/handlers/submit.go @@ -0,0 +1,133 @@ +package handlers + +import ( + "encoding/json" + "execution-service/constants" + "execution-service/messagequeue" + "execution-service/models" + "execution-service/utils" + "fmt" + "net/http" + + "github.com/go-chi/chi/v5" + "google.golang.org/api/iterator" +) + +func (s *Service) ExecuteVisibleAndHiddenTestsAndSubmit(w http.ResponseWriter, r *http.Request) { + ctx := r.Context() + + questionDocRefId := chi.URLParam(r, "questionDocRefId") + if questionDocRefId == "" { + http.Error(w, "questionDocRefId is required", http.StatusBadRequest) + return + } + + var submission models.Submission + if err := utils.DecodeJSONBody(w, r, &submission); err != nil { + http.Error(w, err.Error(), http.StatusBadRequest) + return + } + + if err := validateSubmissionFields(submission); err != nil { + http.Error(w, err.Error(), http.StatusBadRequest) + return + } + + iter := s.Client.Collection("tests").Where("questionDocRefId", "==", questionDocRefId).Limit(1).Documents(ctx) + doc, err := iter.Next() + if err != nil { + if err == iterator.Done { + http.Error(w, "Test not found", http.StatusNotFound) + return + } + http.Error(w, err.Error(), http.StatusInternalServerError) + return + } + defer iter.Stop() + + var test models.Test + if err := doc.DataTo(&test); err != nil { + http.Error(w, err.Error(), http.StatusInternalServerError) + return + } + + testResults, err := utils.ExecuteVisibleAndHiddenTests(models.Code{ + Code: submission.Code, + Language: submission.Language, + }, test) + if err != nil { + http.Error(w, err.Error(), http.StatusInternalServerError) + return + } + + // Save the collaboration history via the history-service + submissionReq := models.Submission{ + Code: submission.Code, + Language: submission.Language, + User: submission.User, + MatchedUser: submission.MatchedUser, + MatchedTopics: submission.MatchedTopics, + Title: submission.Title, + QuestionDifficulty: submission.QuestionDifficulty, + QuestionTopics: submission.QuestionTopics, + } + submissionHistoryReq := models.SubmissionHistory{ + Submission: submissionReq, + QuestionDocRefID: questionDocRefId, + Status: testResults.Status, + } + + jsonData, err := json.Marshal(submissionHistoryReq) + if err != nil { + http.Error(w, err.Error(), http.StatusInternalServerError) + return + } + + err = messagequeue.PublishSubmissionMessage(jsonData) + if err != nil { + http.Error(w, fmt.Sprintf("Failed to save submission history: %v", err), http.StatusInternalServerError) + return + } + + w.Header().Set("Content-Type", "application/json") + w.WriteHeader(http.StatusOK) + json.NewEncoder(w).Encode(testResults) +} + +func validateSubmissionFields(submission models.Submission) error { + if submission.Title == "" { + return fmt.Errorf("title is required") + } + + if !constants.IS_VALID_LANGUAGE[submission.Language] { + return fmt.Errorf("invalid language") + } + + if submission.User == "" { + return fmt.Errorf("user is required") + } + + if submission.MatchedUser == "" { + return fmt.Errorf("matchedUser is required") + } + + if submission.QuestionDifficulty == "" { + return fmt.Errorf("questionDifficulty is required") + } + + return nil +} + +//curl -X POST http://localhost:8083/tests/Yt29JjnIDpRwIlYAX8OF/submit \ +//-H "Content-Type: application/json" \ +//-d '{ +//"title": "Example Title", +//"code": "name = input()\nprint(name[::-1])", +//"language": "Python", +//"user": "user123", +//"matchedUser": "user456", +//"matchId": "match123", +//"matchedTopics": ["topic1", "topic2"], +//"questionDifficulty": "Medium", +//"questionTopics": ["Loops", "Strings"] +//}' diff --git a/apps/execution-service/main.go b/apps/execution-service/main.go new file mode 100644 index 0000000000..e2da2948be --- /dev/null +++ b/apps/execution-service/main.go @@ -0,0 +1,113 @@ +package main + +import ( + "context" + "execution-service/handlers" + "execution-service/messagequeue" + "execution-service/utils" + "fmt" + "log" + "net/http" + "os" + "time" + + "cloud.google.com/go/firestore" + firebase "firebase.google.com/go/v4" + "github.com/go-chi/chi/v5" + "github.com/go-chi/chi/v5/middleware" + "github.com/go-chi/cors" + "github.com/joho/godotenv" + "google.golang.org/api/option" +) + +func main() { + // Load .env file + err := godotenv.Load() + utils.FailOnError(err, "Error loading .env file") + + // Initialize Firestore client + ctx := context.Background() + client, err := initFirestore(ctx) + utils.FailOnError(err, "Failed to initialize Firestore client") + defer client.Close() + + service := &handlers.Service{Client: client} + + amqpConnection, amqpChannel := messagequeue.InitRabbitMQServer() + defer amqpConnection.Close() + defer amqpChannel.Close() + + r := initChiRouter(service) + initRestServer(r) +} + +// initFirestore initializes the Firestore client +func initFirestore(ctx context.Context) (*firestore.Client, error) { + credentialsPath := os.Getenv("FIREBASE_CREDENTIAL_PATH") + opt := option.WithCredentialsFile(credentialsPath) + app, err := firebase.NewApp(ctx, nil, opt) + if err != nil { + return nil, fmt.Errorf("failed to initialize Firebase App: %v", err) + } + + client, err := app.Firestore(ctx) + if err != nil { + return nil, fmt.Errorf("failed to get Firestore client: %v", err) + } + return client, nil +} + +func initChiRouter(service *handlers.Service) *chi.Mux { + r := chi.NewRouter() + r.Use(middleware.Logger) + r.Use(middleware.Timeout(60 * time.Second)) + + r.Use(cors.Handler(cors.Options{ + // AllowedOrigins: []string{"http://localhost:3000"}, // Use this to allow specific origin hosts + AllowedOrigins: []string{"https://*", "http://*"}, + // AllowOriginFunc: func(r *http.Request, origin string) bool { return true }, + AllowedMethods: []string{"GET", "POST", "PUT", "DELETE", "OPTIONS"}, + AllowedHeaders: []string{"Accept", "Authorization", "Content-Type", "X-CSRF-Token"}, + ExposedHeaders: []string{"Link"}, + AllowCredentials: false, + MaxAge: 300, // Maximum value not ignored by any of major browsers + })) + + registerRoutes(r, service) + + return r +} + +func registerRoutes(r *chi.Mux, service *handlers.Service) { + r.Route("/tests", func(r chi.Router) { + // Re: CreateTest + // Current: Unused, since testcases are populated via script + // Future extension: can be created by admin + //r.Post("/", service.CreateTest) + r.Post("/populate", service.PopulateTests) + + r.Route("/{questionDocRefId}", func(r chi.Router) { + // Re: UpdateTest, DeleteTest + // Current: Unused, since testcases are executed within service and not exposed + // Future extension: can be read by admin to view testcases + //r.Put("/", service.UpdateTest) + //r.Delete("/", service.DeleteTest) + r.Get("/", service.ReadVisibleTests) + r.Post("/execute", service.ExecuteVisibleAndCustomTests) + r.Post("/submit", service.ExecuteVisibleAndHiddenTestsAndSubmit) + }) + }) +} + +func initRestServer(r *chi.Mux) { + // Serve on port 8080 + port := os.Getenv("PORT") + if port == "" { + port = "8083" + } + + // Start the server + log.Printf("Starting REST server on http://localhost:%s", port) + err := http.ListenAndServe(fmt.Sprintf(":%s", port), r) + utils.FailOnError(err, "Failed to start REST server") +} diff --git a/apps/execution-service/messagequeue/rabbitmq.go b/apps/execution-service/messagequeue/rabbitmq.go new file mode 100644 index 0000000000..1a6aafcde7 --- /dev/null +++ b/apps/execution-service/messagequeue/rabbitmq.go @@ -0,0 +1,78 @@ +package messagequeue + +import ( + "execution-service/utils" + "fmt" + "log" + "os" + "time" + + amqp "github.com/rabbitmq/amqp091-go" +) + +const ( + CODE_SUBMISSION_QUEUE_KEY = "code-submission" + NUM_RETRIES = 10 +) + +var ( + codeSubmissionQueue amqp.Queue + rabbitMQChannel *amqp.Channel +) + +func InitRabbitMQServer() (*amqp.Connection, *amqp.Channel) { + conn := connectToRabbitMQ() + + // Create a channel + ch, err := conn.Channel() + utils.FailOnError(err, "Failed to open a channel") + rabbitMQChannel = ch + + // Declare a queue + q, err := ch.QueueDeclare( + CODE_SUBMISSION_QUEUE_KEY, // name + false, // durable + false, // delete when unused + false, // exclusive + false, // no-wait + nil, // arguments + ) + utils.FailOnError(err, "Failed to declare a queue") + codeSubmissionQueue = q + + return conn, ch +} + +func connectToRabbitMQ() *amqp.Connection { + var conn *amqp.Connection + var err error + rabbitMQURL := os.Getenv("RABBITMQ_URL") + for i := 0; i < NUM_RETRIES; i++ { // Retry up to 10 times + conn, err = amqp.Dial(rabbitMQURL) + if err == nil { + log.Println("Connected to RabbitMQ") + return conn + } + log.Printf("Failed to connect to RabbitMQ, retrying in 5 seconds... (Attempt %d/%d)", i+1, NUM_RETRIES) + time.Sleep(5 * time.Second) + } + utils.FailOnError(err, fmt.Sprintf("Failed to connect to RabbitMQ after %d attempts", NUM_RETRIES)) + return nil +} + +func PublishSubmissionMessage(submission []byte) error { + err := rabbitMQChannel.Publish( + "", // exchange + codeSubmissionQueue.Name, // routing key + false, // mandatory + false, // immediate + amqp.Publishing{ + ContentType: "application/json", + Body: submission, + }) + if err != nil { + return fmt.Errorf("Failed to publish a message: %v", err) + } + log.Printf("RabbitMQ: [x] Sent %s", submission) + return nil +} diff --git a/apps/execution-service/models/code.go b/apps/execution-service/models/code.go new file mode 100644 index 0000000000..bd8ab16f84 --- /dev/null +++ b/apps/execution-service/models/code.go @@ -0,0 +1,7 @@ +package models + +type Code struct { + Code string `json:"code"` + Language string `json:"language"` + CustomTestCases string `json:"customTestCases"` +} diff --git a/apps/execution-service/models/question.go b/apps/execution-service/models/question.go new file mode 100644 index 0000000000..1a470c1839 --- /dev/null +++ b/apps/execution-service/models/question.go @@ -0,0 +1,6 @@ +package models + +type Question struct { + QuestionDocRefId string `json:"docRefId"` + Title string `json:"title"` +} diff --git a/apps/execution-service/models/submission.go b/apps/execution-service/models/submission.go new file mode 100644 index 0000000000..99bcc60ba5 --- /dev/null +++ b/apps/execution-service/models/submission.go @@ -0,0 +1,17 @@ +package models + +type Submission struct { + // Submission related details + Code string `json:"code" firestore:"code"` + Language string `json:"language" firestore:"language"` + + // Match related details + User string `json:"user" firestore:"user"` + MatchedUser string `json:"matchedUser" firestore:"matchedUser"` + MatchedTopics []string `json:"matchedTopics" firestore:"matchedTopics"` + + // Question related details + Title string `json:"title" firestore:"title"` + QuestionDifficulty string `json:"questionDifficulty" firestore:"questionDifficulty"` + QuestionTopics []string `json:"questionTopics" firestore:"questionTopics"` +} diff --git a/apps/execution-service/models/submissionHistory.go b/apps/execution-service/models/submissionHistory.go new file mode 100644 index 0000000000..17fb1b015e --- /dev/null +++ b/apps/execution-service/models/submissionHistory.go @@ -0,0 +1,16 @@ +package models + +import "time" + +type SubmissionHistory struct { + Submission + + // Additional question related details + QuestionDocRefID string `json:"questionDocRefId"` + Status string `json:"status"` + + // Special DB fields + CreatedAt time.Time `json:"createdAt"` + UpdatedAt time.Time `json:"updatedAt"` + HistoryDocRefID string `json:"historyDocRefId"` +} diff --git a/apps/execution-service/models/test.go b/apps/execution-service/models/test.go new file mode 100644 index 0000000000..9b6c6d80ac --- /dev/null +++ b/apps/execution-service/models/test.go @@ -0,0 +1,18 @@ +package models + +import "time" + +type Test struct { + QuestionDocRefId string `json:"questionDocRefId" firestore:"questionDocRefId"` + VisibleTestCases string `json:"visibleTestCases" firestore:"visibleTestCases"` + HiddenTestCases string `json:"hiddenTestCases" firestore:"hiddenTestCases"` + InputValidation string `json:"inputValidation" firestore:"inputValidation"` + OutputValidation string `json:"outputValidation" firestore:"outputValidation"` + + // Special DB fields + CreatedAt time.Time `json:"createdAt" firestore:"createdAt"` + UpdatedAt time.Time `json:"updatedAt" firestore:"updatedAt"` + + // Not stored in DB but used by json decoder + QuestionTitle string `json:"questionTitle" firestore:"questionTitle"` +} diff --git a/apps/execution-service/models/testResult.go b/apps/execution-service/models/testResult.go new file mode 100644 index 0000000000..1e812220d2 --- /dev/null +++ b/apps/execution-service/models/testResult.go @@ -0,0 +1,25 @@ +package models + +type ExecutionResults struct { + VisibleTestResults []IndividualTestResult `json:"visibleTestResults"` + CustomTestResults []IndividualTestResult `json:"customTestResults"` +} + +type SubmissionResults struct { + VisibleTestResults []IndividualTestResult `json:"visibleTestResults"` + HiddenTestResults GeneralTestResults `json:"hiddenTestResults"` + Status string `json:"status"` +} + +type IndividualTestResult struct { + Input string `json:"input"` + Expected string `json:"expected"` + Actual string `json:"actual"` + Passed bool `json:"passed"` + Error string `json:"error"` +} + +type GeneralTestResults struct { + Passed int `json:"passed"` + Total int `json:"total"` +} diff --git a/apps/execution-service/models/visibleTest.go b/apps/execution-service/models/visibleTest.go new file mode 100644 index 0000000000..39c2bf48cb --- /dev/null +++ b/apps/execution-service/models/visibleTest.go @@ -0,0 +1,6 @@ +package models + +type VisibleTest struct { + Input string `json:"input"` + Expected string `json:"expected"` +} diff --git a/apps/execution-service/utils/decode.go b/apps/execution-service/utils/decode.go new file mode 100644 index 0000000000..981df9a617 --- /dev/null +++ b/apps/execution-service/utils/decode.go @@ -0,0 +1,20 @@ +package utils + +import ( + "encoding/json" + "fmt" + "net/http" +) + +// DecodeJSONBody decodes the request body into the given destination +func DecodeJSONBody(w http.ResponseWriter, r *http.Request, dst interface{}) error { + decoder := json.NewDecoder(r.Body) + decoder.DisallowUnknownFields() + + err := decoder.Decode(&dst) + if err != nil { + return fmt.Errorf("Invalid request payload: " + err.Error()) + } + + return nil +} diff --git a/apps/execution-service/utils/executeTest.go b/apps/execution-service/utils/executeTest.go new file mode 100644 index 0000000000..b411ba7298 --- /dev/null +++ b/apps/execution-service/utils/executeTest.go @@ -0,0 +1,152 @@ +package utils + +import ( + "execution-service/constants" + "execution-service/execution/python" + "execution-service/models" + "fmt" +) + +func ExecuteVisibleAndCustomTests(code models.Code, test models.Test) (models.ExecutionResults, error) { + var err error + var testResults models.ExecutionResults + + switch code.Language { + case constants.PYTHON: + testResults, err = getVisibleAndCustomTestResults(code, test, python.RunPythonCode) + break + default: + return models.ExecutionResults{}, fmt.Errorf("unsupported language: %s", code.Language) + } + if err != nil { + return models.ExecutionResults{}, err + } + + return testResults, nil +} + +func ExecuteVisibleAndHiddenTests(code models.Code, test models.Test) (models.SubmissionResults, error) { + var err error + var testResults models.SubmissionResults + + switch code.Language { + case constants.PYTHON: + testResults, err = getVisibleAndHiddenTestResults(code, test, python.RunPythonCode) + break + default: + return models.SubmissionResults{}, fmt.Errorf("unsupported language: %s", code.Language) + } + if err != nil { + return models.SubmissionResults{}, err + } + + return testResults, nil +} + +func getIndividualTestResultFromCodeExecutor(code string, unexecutedTestResult models.IndividualTestResult, + executor func(string, string) (string, string, error)) (models.IndividualTestResult, error) { + output, outputErr, err := executor(code, unexecutedTestResult.Input) + if err != nil { + return models.IndividualTestResult{}, err + } + return models.IndividualTestResult{ + Input: unexecutedTestResult.Input, + Expected: unexecutedTestResult.Expected, + Actual: output, + Passed: output == unexecutedTestResult.Expected, + Error: outputErr, + }, nil +} + +func getAllTestResultsFromFormattedTestCase(code string, testCase string, + executor func(string, string) (string, string, error)) ([]models.IndividualTestResult, error) { + _, testResults, err := GetTestLengthAndUnexecutedCases(testCase) + if err != nil { + return nil, err + } + + for i := range testResults { + currTestResult, err := getIndividualTestResultFromCodeExecutor(code, testResults[i], executor) + if err != nil { + return nil, err + } + testResults[i].Actual = currTestResult.Actual + testResults[i].Passed = currTestResult.Passed + testResults[i].Error = currTestResult.Error + } + + return testResults, nil +} + +func getGenericTestResultsFromFormattedTestCase(code string, testCase string, + executor func(string, string) (string, string, error)) (models.GeneralTestResults, error) { + testResults, err := getAllTestResultsFromFormattedTestCase(code, testCase, executor) + if err != nil { + return models.GeneralTestResults{}, err + } + + var passed int + for _, testResult := range testResults { + if testResult.Passed { + passed++ + } + } + + return models.GeneralTestResults{ + Passed: passed, + Total: len(testResults), + }, nil +} + +func getVisibleAndCustomTestResults(code models.Code, test models.Test, + executor func(string, string) (string, string, error)) (models.ExecutionResults, error) { + visibleTestResults, err := getAllTestResultsFromFormattedTestCase(code.Code, test.VisibleTestCases, executor) + if err != nil { + return models.ExecutionResults{}, err + } + + var customTestResults []models.IndividualTestResult + if code.CustomTestCases != "" { + customTestResults, err = getAllTestResultsFromFormattedTestCase(code.Code, code.CustomTestCases, executor) + if err != nil { + return models.ExecutionResults{}, err + } + } + + return models.ExecutionResults{ + VisibleTestResults: visibleTestResults, + CustomTestResults: customTestResults, + }, nil +} + +func getVisibleAndHiddenTestResults(code models.Code, test models.Test, + executor func(string, string) (string, string, error)) (models.SubmissionResults, error) { + visibleTestResults, err := getAllTestResultsFromFormattedTestCase(code.Code, test.VisibleTestCases, executor) + if err != nil { + return models.SubmissionResults{}, err + } + + hiddenTestResults, err := getGenericTestResultsFromFormattedTestCase(code.Code, test.HiddenTestCases, executor) + if err != nil { + return models.SubmissionResults{}, err + } + + status := constants.ACCEPTED + if hiddenTestResults.Passed != hiddenTestResults.Total { + status = constants.ATTEMPTED + } + if status == constants.ACCEPTED { + for _, testResult := range visibleTestResults { + if !testResult.Passed { + status = constants.ATTEMPTED + break + } + } + } + + return models.SubmissionResults{ + VisibleTestResults: visibleTestResults, + HiddenTestResults: hiddenTestResults, + Status: status, + }, nil +} diff --git a/apps/execution-service/utils/log.go b/apps/execution-service/utils/log.go new file mode 100644 index 0000000000..a77b2c29ca --- /dev/null +++ b/apps/execution-service/utils/log.go @@ -0,0 +1,9 @@ +package utils + +import "log" + +func FailOnError(err error, msg string) { + if err != nil { + log.Fatalf("%s: %s", msg, err) + } +} diff --git a/apps/execution-service/utils/populate.go b/apps/execution-service/utils/populate.go new file mode 100644 index 0000000000..fc23098712 --- /dev/null +++ b/apps/execution-service/utils/populate.go @@ -0,0 +1,675 @@ +package utils + +import ( + "cloud.google.com/go/firestore" + "context" + "execution-service/models" + "fmt" + "google.golang.org/api/iterator" + "log" + "strings" +) + +// RepopulateTests Populate deletes all testcases and repopulates testcases +func RepopulateTests(ctx context.Context, client *firestore.Client, + questionTitleToDocRefIdMap map[string]string) error { + + // delete all existing document in the collection + iter := client.Collection("tests").Documents(ctx) + for { + doc, err := iter.Next() + if err == iterator.Done { + break + } + if err != nil { + return fmt.Errorf("failed to iterate over tests: %v", err) + } + + if _, err := doc.Ref.Delete(ctx); err != nil { + return fmt.Errorf("failed to delete test: %v", err) + } + } + defer iter.Stop() + + var tests = []models.Test{ + { + QuestionTitle: "Reverse a String", + VisibleTestCases: ` +2 +hello +olleh +Hannah +hannaH +`, + HiddenTestCases: ` +2 +Hannah +hannaH +abcdefg +gfedcba +`, + InputValidation: getPackagesAndFunction([]string{}, ` +return len(inputOrOutput) > 0 +`), + OutputValidation: getPackagesAndFunction([]string{}, ` +return len(inputOrOutput) > 0 +`), + }, + { + QuestionTitle: "Linked List Cycle Detection", + VisibleTestCases: ` +2 +[3,2,0,-4] -> pos = 1 +true +[1] +false +`, + HiddenTestCases: ` +2 +[1,2] -> pos = 0 +true +[1] +false +`, + InputValidation: getPackagesAndFunction([]string{"strconv", "strings"}, ` +hasCycle := false + +// Step 1: Split by " -> pos = " +parts := strings.Split(inputOrOutput, " -> pos = ") +if len(parts) == 2 { + hasCycle = true +} else if len(parts) != 1 { + return false +} + +listPart := strings.TrimSpace(parts[0]) // Get the list part + +//Validate the list format +if len(listPart) < 2 || listPart[0] != '[' || listPart[len(listPart)-1] != ']' { + return false +} + +listContent := listPart[1 : len(listPart)-1] // Remove brackets +if listContent == "" { // Check for empty list + return false +} + +// Split the list by commas and validate each element +elements := strings.Split(listContent, ",") +for _, elem := range elements { + elem = strings.TrimSpace(elem) // Trim whitespace + if _, err := strconv.Atoi(elem); err != nil { // Check if it's an integer + return false + } +} + +if !hasCycle { + return true +} + +posPart := strings.TrimSpace(parts[1]) // Get the position part + +//Validate the position +posValue, err := strconv.Atoi(posPart) +if err != nil || posValue < 0 || posValue >= len(elements) { + return false +} + +return true +`), + OutputValidation: getPackagesAndFunction([]string{}, ` +return inputOrOutput == "true" || inputOrOutput == "false" +`), + }, + { + QuestionTitle: "Roman to Integer", + VisibleTestCases: ` +2 +III +3 +IV +4 +`, + HiddenTestCases: ` +2 +IV +4 +MCMXCIV +1994 +`, + InputValidation: getPackagesAndFunction([]string{"strings"}, ` +valid := "IVXLCDM" +for _, char := range inputOrOutput { + if !strings.ContainsRune(valid, char) { + return false + } +} +return true +`), + OutputValidation: getPackagesAndFunction([]string{"strconv"}, ` +_, err := strconv.Atoi(inputOrOutput) +return err == nil +`), + }, + { + QuestionTitle: "Add Binary", + VisibleTestCases: ` +2 +"11", "1" +"100" +"1010", "1011" +"10101" +`, + HiddenTestCases: ` +2 +"1010", "1011" +"10101" +"111", "111" +"1110" +`, + InputValidation: getPackagesAndFunction([]string{"regexp"}, ` +binaryRegex := regexp.MustCompile("^\"([01]+)\",\\s*\"([01]+)\"$") +return binaryRegex.MatchString(inputOrOutput) +`), + OutputValidation: getPackagesAndFunction([]string{"regexp"}, ` +binaryRegex := regexp.MustCompile("^\"([01]+)\"$") +return binaryRegex.MatchString(inputOrOutput) +`), + }, + { + QuestionTitle: "Fibonacci Number", + VisibleTestCases: ` +2 +0 +0 +10 +55 +`, + HiddenTestCases: ` +2 +1 +1 +10 +55 +`, + InputValidation: getPackagesAndFunction([]string{"strconv"}, ` +num, err := strconv.Atoi(inputOrOutput) +return err == nil && num >= 0 +`), + OutputValidation: getPackagesAndFunction([]string{"strconv"}, ` +num, err := strconv.Atoi(inputOrOutput) +return err == nil && num >= 0 +`), + }, + { + QuestionTitle: "Implement Stack using Queues", + VisibleTestCases: ` +2 +push(1), push(2), top() +2 +push(1), empty() +false +`, + HiddenTestCases: ` +2 +push(1), push(2), pop(), top() +1 +push(1), empty() +false +`, + InputValidation: getPackagesAndFunction([]string{"strconv", "strings"}, ` +// Split the line by commas to handle multiple operations +operations := strings.Split(inputOrOutput, ",") +for _, op := range operations { + op = strings.TrimSpace(op) // Trim whitespace + // Check if the operation is valid + if strings.HasPrefix(op, "push(") && strings.HasSuffix(op, ")") { + // Check if it's a push operation with a valid integer + numStr := op[5 : len(op)-1] // Extract the number string + if _, err := strconv.Atoi(numStr); err != nil { + return false + } + } else if op != "pop()" && op != "top()" && op != "empty()" { + // If the operation is not one of the valid ones + return false + } +} +return true +`), + OutputValidation: getPackagesAndFunction([]string{"strconv"}, ` +if inputOrOutput == "true" || inputOrOutput == "false" || inputOrOutput == "null" { + return true +} +_, err := strconv.Atoi(inputOrOutput) +return err == nil +`), + }, { + QuestionTitle: "Combine Two Tables", + VisibleTestCases: ` +2 +Person: [(1, "Smith", "John"), (2, "Doe", "Jane")], Address: [(1, 1, "NYC", "NY"), (2, 3, "LA", "CA")] +[("John", "Smith", "NYC", "NY"), ("Jane", "Doe", null, null)] +Person: [(1, "White", "Mary")], Address: [] +[("Mary", "White", null, null)] +`, + HiddenTestCases: ` +2 +Person: [(1, "Black", "Jim")], Address: [(1, 1, "Miami", "FL")] +[("Jim", "Black", "Miami", "FL")] +Person: [(1, "White", "Mary")], Address: [] +[("Mary", "White", null, null)] +`, + InputValidation: getPackagesAndFunction([]string{}, ` +return len(inputOrOutput) > 0 +`), + OutputValidation: getPackagesAndFunction([]string{}, ` +return len(inputOrOutput) > 0 +`), + }, + { + QuestionTitle: "Repeated DNA Sequences", + VisibleTestCases: ` +2 +AAAAACCCCCAAAAACCCCCCAAAAAGGGTTT +["AAAAACCCCC", "CCCCCAAAAA"] +ACGTACGTACGT +[] +`, + HiddenTestCases: ` +2 +AAAAAAAAAAAAA +["AAAAAAAAAA"] +ACGTACGTACGT +[] +`, + InputValidation: getPackagesAndFunction([]string{}, ` +input := inputOrOutput + +// Check that input length is at least 10 +if len(input) < 10 { + return false +} + +// Check that input contains only 'A', 'C', 'G', and 'T' +for _, ch := range input { + if ch != 'A' && ch != 'C' && ch != 'G' && ch != 'T' { + return false + } +} +return true +`), + OutputValidation: getPackagesAndFunction([]string{"strings"}, ` +output := inputOrOutput + +if output == "[]" { + return true +} + +// Check that the output is enclosed in square brackets +if len(output) < 2 || output[0] != '[' || output[len(output)-1] != ']' { + return false +} + +// Extract the content between square brackets +content := output[1 : len(output)-1] + +// Split by commas without trimming spaces +sequences := strings.Split(content, ", ") +for _, seq := range sequences { + // Check if each sequence is properly enclosed in double quotes and is exactly 10 characters + if len(seq) != 12 || seq[0] != '"' || seq[11] != '"' { + return false + } + + // Check that the sequence only contains valid DNA characters between the quotes + for i := 1; i < 11; i++ { + ch := seq[i] + if ch != 'A' && ch != 'C' && ch != 'G' && ch != 'T' { + return false + } + } +} +return true +`), + }, + { + QuestionTitle: "Course Schedule", + VisibleTestCases: ` +2 +2, [[1,0]] +true +2, [[1,0],[0,1]] +false +`, + HiddenTestCases: ` +2 +2, [[1,0],[0,1]] +false +4, [[1,0],[2,0],[3,1],[3,2]] +true +`, + InputValidation: getPackagesAndFunction([]string{}, ` +return len(inputOrOutput) > 0 +`), + OutputValidation: getPackagesAndFunction([]string{}, ` +return len(inputOrOutput) > 0 +`), + }, + { + QuestionTitle: "LRU Cache Design", + VisibleTestCases: ` +2 +put(1, 1), put(2, 2), get(1) +1 +put(1, 1), put(2, 2), put(3, 3), get(2) +-1 +`, + HiddenTestCases: ` +2 +put(1, 1), put(2, 2), put(3, 3), get(2) +-1 +put(1, 1), put(2, 2), put(1, 10), get(1) +10 +`, + InputValidation: getPackagesAndFunction([]string{}, ` +return len(inputOrOutput) > 0 +`), + OutputValidation: getPackagesAndFunction([]string{}, ` +return len(inputOrOutput) > 0 +`), + }, + { + QuestionTitle: "Longest Common Subsequence", + VisibleTestCases: ` +2 +"abcde", "ace" +3 +"abc", "def" +0 +`, + HiddenTestCases: ` +2 +"abc", "abc" +3 +"abc", "def" +0 +`, + InputValidation: getPackagesAndFunction([]string{}, ` +return len(inputOrOutput) > 0 +`), + OutputValidation: getPackagesAndFunction([]string{}, ` +return len(inputOrOutput) > 0 +`), + }, + { + QuestionTitle: "Rotate Image", + VisibleTestCases: ` +2 +[[1,2,3],[4,5,6],[7,8,9]] +[[7,4,1],[8,5,2],[9,6,3]] +[[1]] +[[1]] +`, + HiddenTestCases: ` +2 +[[5,1,9,11],[2,4,8,10],[13,3,6,7],[15,14,12,16]] +[[15,13,2,5],[14,3,4,1],[12,6,8,9],[16,7,10,11]] +[[1]] +[[1]] +`, + InputValidation: getPackagesAndFunction([]string{}, ` +return len(inputOrOutput) > 0 +`), + OutputValidation: getPackagesAndFunction([]string{}, ` +return len(inputOrOutput) > 0 +`), + }, + { + QuestionTitle: "Airplane Seat Assignment Probability", + VisibleTestCases: ` +2 +1 +1.00000 +3 +0.50000 +`, + HiddenTestCases: ` +2 +2 +0.50000 +3 +0.50000 +`, + InputValidation: getPackagesAndFunction([]string{}, ` +return len(inputOrOutput) > 0 +`), + OutputValidation: getPackagesAndFunction([]string{}, ` +return len(inputOrOutput) > 0 +`), + }, + { + QuestionTitle: "Validate Binary Search Tree", + VisibleTestCases: ` +2 +[2,1,3] +true +[5,1,4,null,null,3,6] +false +`, + HiddenTestCases: ` +2 +[5,1,4,null,null,3,6] +false +[1] +true +`, + InputValidation: getPackagesAndFunction([]string{}, ` +return len(inputOrOutput) > 0 +`), + OutputValidation: getPackagesAndFunction([]string{}, ` +return len(inputOrOutput) > 0 +`), + }, + { + QuestionTitle: "Sliding Window Maximum", + VisibleTestCases: ` +2 +[1,3,-1,-3,5,3,6,7], k=3 +[3,3,5,5,6,7] +[9, 11], k=2 +[11] +`, + HiddenTestCases: ` +2 +[1, -1], k=1 +[1, -1] +[9, 11], k=2 +[11] +`, + InputValidation: getPackagesAndFunction([]string{}, ` +return len(inputOrOutput) > 0 +`), + OutputValidation: getPackagesAndFunction([]string{}, ` +return len(inputOrOutput) > 0 +`), + }, + { + QuestionTitle: "N-Queen Problem", + VisibleTestCases: ` +2 +4 +[[".Q..","...Q","Q...","..Q."],["..Q.","Q...","...Q",".Q.."]] +2 +[] +`, + HiddenTestCases: ` +2 +1 +[["Q"]] +2 +[] +`, + InputValidation: getPackagesAndFunction([]string{}, ` +return len(inputOrOutput) > 0 +`), + OutputValidation: getPackagesAndFunction([]string{}, ` +return len(inputOrOutput) > 0 +`), + }, + { + QuestionTitle: "Serialize and Deserialize a Binary Tree", + VisibleTestCases: ` +2 +[1,2,3,null,null,4,5] +"1 2 null null 3 4 null null 5 null null" +[] +"null" +`, + HiddenTestCases: ` +2 +[] +"null" +[1] +"1 null null" +`, + InputValidation: getPackagesAndFunction([]string{}, ` +return len(inputOrOutput) > 0 +`), + OutputValidation: getPackagesAndFunction([]string{}, ` +return len(inputOrOutput) > 0 +`), + }, + { + QuestionTitle: "Wildcard Matching", + VisibleTestCases: ` +2 +"aa", "a" +false +"aa", "*" +true +`, + HiddenTestCases: ` +2 +"aa", "*" +true +"cb", "?a" +false +`, + InputValidation: getPackagesAndFunction([]string{}, ` +return len(inputOrOutput) > 0 +`), + OutputValidation: getPackagesAndFunction([]string{}, ` +return len(inputOrOutput) > 0 +`), + }, + { + QuestionTitle: "Chalkboard XOR Game", + VisibleTestCases: ` +2 +[1,1,2] +false +[1,2,3] +true +`, + HiddenTestCases: ` +2 +[1,2,3] +true +[0,0,0] +true +`, + InputValidation: getPackagesAndFunction([]string{}, ` +return len(inputOrOutput) > 0 +`), + OutputValidation: getPackagesAndFunction([]string{}, ` +return len(inputOrOutput) > 0 +`), + }, + { + QuestionTitle: "Trips and Users", + VisibleTestCases: ` +2 +Trips: [(1, 1, 10, 'NYC', 'completed', '2013-10-01'), (2, 2, 11, 'NYC', 'cancelled_by_driver', '2013-10-01')],Users: [(10, 'No', 'client'), (11, 'No', 'driver')] +0.50 +Trips: [(1, 1, 10, 'NYC', 'completed', '2013-10-03'), (2, 2, 11, 'NYC', 'cancelled_by_client', '2013-10-03')],Users: [(10, 'No', 'client'), (11, 'Yes', 'driver')] +0.00 +`, + HiddenTestCases: ` +2 +Trips: [(1, 1, 10, 'NYC', 'completed', '2013-10-02')],Users: [(10, 'No', 'client'), (11, 'No', 'driver')] +0.00 +Trips: [(1, 1, 10, 'NYC', 'completed', '2013-10-03'), (2, 2, 11, 'NYC', 'cancelled_by_client', '2013-10-03')],Users: [(10, 'No', 'client'), (11, 'Yes', 'driver')] +0.00 +`, + InputValidation: getPackagesAndFunction([]string{}, ` +return len(inputOrOutput) > 0 +`), + OutputValidation: getPackagesAndFunction([]string{}, ` +return len(inputOrOutput) > 0 +`), + }, + } + + for _, test := range tests { + if _, exists := questionTitleToDocRefIdMap[test.QuestionTitle]; !exists { + return fmt.Errorf("testcase's question title %s not found in questionTitleToDocRefIdMap", + test.QuestionTitle) + } + } + + for _, test := range tests { + _, err := ValidateTestCaseFormat(test.VisibleTestCases, test.InputValidation, test.OutputValidation) + if err != nil { + return fmt.Errorf("failed to validate visible test case format: %v", err) + } + _, err = ValidateTestCaseFormat(test.HiddenTestCases, test.InputValidation, test.OutputValidation) + if err != nil { + return fmt.Errorf("failed to validate hidden test case format: %v", err) + } + } + + for _, test := range tests { + _, _, err := client.Collection("tests").Add(ctx, map[string]interface{}{ + "questionDocRefId": questionTitleToDocRefIdMap[test.QuestionTitle], + "visibleTestCases": test.VisibleTestCases, + "hiddenTestCases": test.HiddenTestCases, + "createdAt": firestore.ServerTimestamp, + "updatedAt": firestore.ServerTimestamp, + }) + if err != nil { + return fmt.Errorf("failed to add test: %v", err) + } + } + + log.Println("Cleaned tests collection and repopulated tests.") + return nil +} + +func getPackagesAndFunction(imports []string, functionBody string) string { + // Use a string builder for efficient string concatenation + var importCode strings.Builder + + if len(imports) > 0 { + // Start the import block + importCode.WriteString("import (\n") + + // Iterate over the imports and add them to the builder + for _, imp := range imports { + importCode.WriteString(fmt.Sprintf("\t%q\n", imp)) + } + + // Close the import block + importCode.WriteString(")") + } + + // add tab before every line in functionBody including first line + functionBody = strings.ReplaceAll(functionBody, "\n", "\n\t") + + return fmt.Sprintf(` +%s + +func validateInputOrOutput(inputOrOutput string) bool { +%s +} +`, importCode.String(), functionBody) +} diff --git a/apps/execution-service/utils/testCase.go b/apps/execution-service/utils/testCase.go new file mode 100644 index 0000000000..c353f98220 --- /dev/null +++ b/apps/execution-service/utils/testCase.go @@ -0,0 +1,45 @@ +package utils + +import ( + "execution-service/models" + "fmt" + "strconv" + "strings" +) + +func GetTestLength(testCase string) (int, error) { + lines := strings.Split(strings.TrimSpace(testCase), "\n") + if len(lines) < 1 { + return 0, fmt.Errorf("test case format is incorrect, no lines found") + } + numCases, err := strconv.Atoi(lines[0]) + if err != nil { + return 0, fmt.Errorf("test case format is incorrect, first line must be an integer") + } + return numCases, nil +} + +func GetTestLengthAndUnexecutedCases(testCase string) (int, []models.IndividualTestResult, error) { + lines := strings.Split(strings.TrimSpace(testCase), "\n") + if len(lines) < 1 { + return 0, nil, fmt.Errorf("test case format is incorrect, no lines found") + } + + numCases, err := strconv.Atoi(lines[0]) + if err != nil { + return 0, nil, fmt.Errorf("test case format is incorrect, first line must be an integer") + } + + if len(lines) != 1+2*numCases { + return 0, nil, fmt.Errorf("test case format is incorrect, expected %d lines but got %d", 1+2*numCases, len(lines)) + } + + var testResults []models.IndividualTestResult + for i := 1; i < len(lines); i += 2 { + testResults = append(testResults, models.IndividualTestResult{ + Input: lines[i], + Expected: lines[i+1], + }) + } + return numCases, testResults, nil +} diff --git a/apps/execution-service/utils/validateTestCaseFormat.go b/apps/execution-service/utils/validateTestCaseFormat.go new file mode 100644 index 0000000000..e38e0881b4 --- /dev/null +++ b/apps/execution-service/utils/validateTestCaseFormat.go @@ -0,0 +1,79 @@ +package utils + +import ( + "fmt" + "strconv" + "strings" + + "github.com/traefik/yaegi/interp" + "github.com/traefik/yaegi/stdlib" +) + +func ValidateTestCaseFormat(testCase string, validateInputCode string, validateOutputCode string) (bool, error) { + lines := strings.Split(strings.TrimSpace(testCase), "\n") + + // Check if there is at least one line (the number of test cases line) + if len(lines) < 1 { + return false, fmt.Errorf("test case format is incorrect, no lines found") + } + + // Parse the first line to get the expected number of test cases + numCases, err := strconv.Atoi(lines[0]) + if err != nil { + return false, fmt.Errorf("test case format is incorrect, first line must be an integer") + } + + // Calculate the required number of lines: 1 for count + 2 lines per test case + expectedLines := 1 + 2*numCases + if len(lines) != expectedLines { + return false, fmt.Errorf("test case format is incorrect, expected %d lines but got %d", expectedLines, + len(lines)) + } + + for i := 1; i < len(lines); i += 2 { + ok, err := validateInputOrOutputFormat(validateInputCode, lines[i]) + if err != nil { + return false, fmt.Errorf("error validating input: %v", err) + } + if !ok { + return false, fmt.Errorf("test case format is incorrect, input format is invalid") + } + ok, err = validateInputOrOutputFormat(validateOutputCode, lines[i+1]) + if err != nil { + return false, fmt.Errorf("error validating output: %v", err) + } + if !ok { + return false, fmt.Errorf("test case format is incorrect, output format is invalid") + } + } + + return true, nil +} + +func validateInputOrOutputFormat(validateInputOrOutputCode string, inputOrOutput string) (bool, error) { + // Initialize the yaegi interpreter + i := interp.New(interp.Options{}) + i.Use(stdlib.Symbols) + + // Create a Go function as a string and include the provided validation code + fullCode := fmt.Sprintf(` +package main +%s +`, validateInputOrOutputCode) + + // Evaluate the function code + _, err := i.Eval(fullCode) + if err != nil { + return false, fmt.Errorf("error evaluating code: %v", err) + } + + // Retrieve the validateInput function from the interpreter + validateFunc, err := i.Eval("main.validateInputOrOutput") + if err != nil { + return false, fmt.Errorf("validateInputOrOutput function not found") + } + + // Call the function with the provided input + result := validateFunc.Interface().(func(string) bool)(inputOrOutput) + return result, nil +} diff --git a/apps/frontend/.dockerignore b/apps/frontend/.dockerignore new file mode 100644 index 0000000000..ba5a96259c --- /dev/null +++ b/apps/frontend/.dockerignore @@ -0,0 +1,7 @@ +node_modules +.dockerignore +.git +.gitignore +.next +out +README.md \ No newline at end of file diff --git a/apps/frontend/.env.example b/apps/frontend/.env.example new file mode 100644 index 0000000000..150a4cd1f6 --- /dev/null +++ b/apps/frontend/.env.example @@ -0,0 +1,7 @@ +# URL endpoints of the services +NEXT_PUBLIC_QUESTION_SERVICE_URL="http://localhost:8080/" +NEXT_PUBLIC_USER_SERVICE_URL="http://localhost:3001/" +NEXT_PUBLIC_MATCHING_SERVICE_URL="ws://localhost:8081/match" +NEXT_PUBLIC_SIGNALLING_SERVICE_URL="ws://localhost:4444/" +NEXT_PUBLIC_HISTORY_SERVICE_URL="http://localhost:8082/" +NEXT_PUBLIC_EXECUTION_SERVICE_URL="http://localhost:8083/" \ No newline at end of file diff --git a/apps/frontend/.eslintrc.json b/apps/frontend/.eslintrc.json new file mode 100644 index 0000000000..3722418549 --- /dev/null +++ b/apps/frontend/.eslintrc.json @@ -0,0 +1,3 @@ +{ + "extends": ["next/core-web-vitals", "next/typescript"] +} diff --git a/apps/frontend/.gitignore b/apps/frontend/.gitignore new file mode 100644 index 0000000000..00bba9bb29 --- /dev/null +++ b/apps/frontend/.gitignore @@ -0,0 +1,37 @@ +# See https://help.github.com/articles/ignoring-files/ for more about ignoring files. + +# dependencies +/node_modules +/.pnp +.pnp.js +.yarn/install-state.gz + +# testing +/coverage + +# next.js +/.next/ +/out/ + +# production +/build + +# misc +.DS_Store +*.pem + +# debug +npm-debug.log* +yarn-debug.log* +yarn-error.log* + +# local env files +.env*.local +.env + +# vercel +.vercel + +# typescript +*.tsbuildinfo +next-env.d.ts diff --git a/apps/frontend/Dockerfile b/apps/frontend/Dockerfile new file mode 100644 index 0000000000..376ceab3e6 --- /dev/null +++ b/apps/frontend/Dockerfile @@ -0,0 +1,64 @@ +FROM node:18-alpine AS base + +# Install dependencies only when needed +FROM base AS deps +# Check https://github.com/nodejs/docker-node/tree/b4117f9333da4138b03a546ec926ef50a31506c3#nodealpine to understand why libc6-compat might be needed. +RUN apk add --no-cache libc6-compat +WORKDIR /app + +# Install dependencies based on the preferred package manager +COPY package.json yarn.lock* package-lock.json* pnpm-lock.yaml* ./ +RUN \ + if [ -f pnpm-lock.yaml ]; then corepack enable pnpm && pnpm i --frozen-lockfile; \ + else echo "Lockfile not found." && exit 1; \ + fi + +# Rebuild the source code only when needed +FROM base AS builder +WORKDIR /app +COPY --from=deps /app/node_modules ./node_modules +COPY . . + +# Next.js collects completely anonymous telemetry data about general usage. +# Learn more here: https://nextjs.org/telemetry +# Uncomment the following line in case you want to disable telemetry during the build. +# ENV NEXT_TELEMETRY_DISABLED=1 + +RUN \ + if [ -f pnpm-lock.yaml ]; then corepack enable pnpm && pnpm run build; \ + else echo "Lockfile not found." && exit 1; \ + fi + +# Production image, copy all the files and run next +FROM base AS runner +WORKDIR /app + +ENV NODE_ENV=production +# Uncomment the following line in case you want to disable telemetry during runtime. +# ENV NEXT_TELEMETRY_DISABLED=1 + +RUN addgroup --system --gid 1001 nodejs +RUN adduser --system --uid 1001 nextjs + +# Include this when we want to include images in the future +COPY --from=builder /app/public ./public + +# Set the correct permission for prerender cache +RUN mkdir .next +RUN chown nextjs:nodejs .next + +# Automatically leverage output traces to reduce image size +# https://nextjs.org/docs/advanced-features/output-file-tracing +COPY --from=builder --chown=nextjs:nodejs /app/.next/standalone ./ +COPY --from=builder --chown=nextjs:nodejs /app/.next/static ./.next/static + +USER nextjs + +EXPOSE 3000 + +ENV PORT=3000 + +# server.js is created by next build from the standalone output +# https://nextjs.org/docs/pages/api-reference/next-config-js/output +ENV HOSTNAME="0.0.0.0" +CMD ["node", "server.js"] \ No newline at end of file diff --git a/apps/frontend/README.md b/apps/frontend/README.md new file mode 100644 index 0000000000..2572193fb1 --- /dev/null +++ b/apps/frontend/README.md @@ -0,0 +1,64 @@ +This is the frontend for the question service. + +## Tech Stack + +- Next.js +- TypeScript +- Ant Design +- SCSS + +## Getting Started + +First, install the dependencies: + +```bash +npm install -g pnpm + +pnpm install --frozen-lockfile + +# if pnpm install --frozen-lockfile fails, try running +pnpm install +``` + +Then, follow the `.env.example` file and create a `.env` file in the current directory. Replace the necessary values within. + +```bash +NEXT_PUBLIC_QUESTION_SERVICE_URL="http://localhost:8080" +NEXT_PUBLIC_USER_SERVICE_URL="http://localhost:3001/" +NEXT_PUBLIC_MATCHING_SERVICE_URL="ws://localhost:8081" +``` + +First, run the development server: + +```bash +pnpm dev +``` + +Open [http://localhost:3000](http://localhost:3000) with your browser to see the result. + +You can start editing the page by modifying `app/page.tsx`. The page auto-updates as you edit the file. + +## Build Dockerfile + +```sh +# Navigate to the frontend app directory +cd apps/frontend + +# Build dockerfile (Ensure that your docker daemon is running beforehand) +docker build -t frontend -f Dockerfile . +``` + +Run the backend server locally and visit http://localhost:3000/ to see the frontend application working + +## Running Docker Image + +```sh +# Run the docker image, the -d tag is to run it detached +docker run -p 3000:3000 --env-file .env -d frontend + +# To see the running container +docker ps + +# To stop the container, copy the container id from the previous command +docker stop +``` diff --git a/apps/frontend/__tests__/browser-tests/browser.test.ts b/apps/frontend/__tests__/browser-tests/browser.test.ts new file mode 100644 index 0000000000..145c036b81 --- /dev/null +++ b/apps/frontend/__tests__/browser-tests/browser.test.ts @@ -0,0 +1,82 @@ +import { Actions, Browser, Builder, By, Capabilities, Key, until, WebDriver } from "selenium-webdriver" + +import {Options as ChromeOptions} from "selenium-webdriver/chrome" +import {Options as EdgeOptions} from "selenium-webdriver/edge" +import {Options as FirefoxOptions} from "selenium-webdriver/firefox" + +const URL = 'http://localhost:3000/'; +const ETERNAL_JWT = "eyJhbGciOiJIUzI1NiIsInR5cCI6IkpXVCJ9.eyJzdWIiOiIxMjM0NTY3ODkwIiwibmFtZSI6IkpvaG4gRG9lIiwiaWF0IjoxNTE2MjM5MDIyLCJleHAiOjk5OTk5OTk5OTk5fQ.Z4_FVGQ5lIcouP3m4YLMr6pGMF17IJFfo2yOTiN58DY" + +const CHROME_OPTIONS = new ChromeOptions() + .addArguments("--headless=new") as ChromeOptions; // uncomment locally to see the steps in action +const EDGE_OPTIONS = new EdgeOptions() + .setBinaryPath("/opt/hostedtoolcache/msedge/stable/x64/msedge") // need to point to the correct path + .addArguments("--headless=new") as EdgeOptions; + +const FIREFOX_OPTIONS = new FirefoxOptions() + .addArguments("--headless") as FirefoxOptions; + +const builder = new Builder() + .setChromeOptions(CHROME_OPTIONS) + .setEdgeOptions(EDGE_OPTIONS) + .setFirefoxOptions(FIREFOX_OPTIONS) + +describe.each([Browser.CHROME, Browser.EDGE, Browser.FIREFOX])("%s driver test", (browser) => { + let driver: WebDriver; + beforeAll(() => { + const cap = new Capabilities().setBrowserName(browser) + builder.withCapabilities(cap); + }) + + beforeEach(async () => { + console.log(browser + ": building..."); + driver = await builder.build(); + console.log(browser + ": built"); + }, 20000) + + afterEach(async () => { + if (driver) { + await driver.quit(); + } + }) + + describe("webdriver installed correctly", () => { + it("does google search", async () => { + await driver.get('http://www.google.com'); + await driver.findElement(By.name('q')).sendKeys('webdriver', Key.RETURN); + await driver.wait(until.titleIs('webdriver - Google Search'), 1000); + }, 10000); + + it.skip("does another google search", async () => { + await driver.get('http://www.google.com'); + await driver.findElement(By.name('q')).sendKeys('webdriver', Key.RETURN); + await driver.wait(until.titleIs('webdriver - Google Search'), 1000); + }, 10000); + }); + + describe("browser-test", () => { + it("accesses and login to peerprep", async () => { + await driver.get(URL); + await driver.wait(until.urlIs(`${URL}login`)); + + const [email, password] = await driver.findElements(By.css("input")) + const submit = await driver.findElement(By.css("button[type=\"submit\"]")) + + await email.sendKeys("admin@gmail.com"); + await password.sendKeys("admin"); + + await submit.click(); + await driver.wait(until.urlIs(`${URL}`)); + + const slogan1 = await driver.findElement(By.xpath("/html/body/div[1]/main/div/div[1]/div[2]/span[1]")).then(ele => ele.getText()) + const slogan2 = await driver.findElement(By.xpath("/html/body/div[1]/main/div/div[1]/div[2]/span[2]")).then(ele => ele.getText()) + + expect(slogan1).toBe("A better way to prepare for coding interviews with"); + expect(slogan2).toBe("peers"); + }, 10000); + }) +}, 60000) + + + + diff --git a/apps/frontend/__tests__/unit-tests/Datetime.test.ts b/apps/frontend/__tests__/unit-tests/Datetime.test.ts new file mode 100644 index 0000000000..8737f9ebe3 --- /dev/null +++ b/apps/frontend/__tests__/unit-tests/Datetime.test.ts @@ -0,0 +1,9 @@ +import { formatTime } from "@/utils/DateTime" + +describe("datetime module", () => { + it("formats a time correctly", () => { + expect(formatTime(10)).toBe("00:10") + }); +}) + + diff --git a/apps/frontend/__tests__/unit-tests/dependencymocking.test.ts b/apps/frontend/__tests__/unit-tests/dependencymocking.test.ts new file mode 100644 index 0000000000..0f21af7f43 --- /dev/null +++ b/apps/frontend/__tests__/unit-tests/dependencymocking.test.ts @@ -0,0 +1,34 @@ +import { GetQuestions } from "@/app/services/question" +import { getToken } from "@/app/services/login-store"; + +const TOKEN = 'mocktoken'; + +jest.mock("@/app/services/login-store", () => { + return { + __esModule: true, + getToken: jest.fn(() => TOKEN) + }; +}) + +beforeEach(() => { + global.fetch = jest.fn().mockResolvedValue({ + async json() { + return {} + } + }); +}) + +describe("mock", () => { + + it("mocks correctly", async () => { + await GetQuestions() + expect(jest.mocked(getToken).mock.calls).toEqual([[]]) + expect(jest.mocked(fetch).mock.calls[0][1]).toEqual({ + "headers": { + "Authorization": `Bearer ${TOKEN}`, + }, + "method": "GET", + }) + }); + +}) \ No newline at end of file diff --git a/apps/frontend/__tests__/unit-tests/question.test.ts b/apps/frontend/__tests__/unit-tests/question.test.ts new file mode 100644 index 0000000000..66e22635e3 --- /dev/null +++ b/apps/frontend/__tests__/unit-tests/question.test.ts @@ -0,0 +1,310 @@ +import { CreateQuestion, DeleteQuestion, GetQuestions, GetSingleQuestion, Question } from "@/app/services/question" + +const NEXT_PUBLIC_QUESTION_SERVICE_URL = process.env.NEXT_PUBLIC_QUESTION_SERVICE_URL + +const QUESTIONS = [ + { + "id": 12345, + "docRefId": "asdfDocRef", + "title": "Asdf", + "description": "Asdf description", + "categories": ["Arrays", "Algorithms"], + "complexity": "hard" + }, + { + "id": 12346, + "docRefId": "qwerDocRef", + "title": "Qwer", + "description": "Qwer description", + "categories": ["Strings", "Data Structures"], + "complexity": "medium" + }, + { + "id": 12347, + "docRefId": "zxcvDocRef", + "title": "Zxcv", + "description": "Zxcv description", + "categories": ["Graphs", "Algorithms"], + "complexity": "easy" + }, + { + "id": 12348, + "docRefId": "tyuiDocRef", + "title": "Tyui", + "description": "Tyui description", + "categories": ["Trees", "Recursion"], + "complexity": "hard" + }, + { + "id": 12349, + "docRefId": "ghjkDocRef", + "title": "Ghjk", + "description": "Ghjk description", + "categories": ["Dynamic Programming", "Math"], + "complexity": "medium" + }, + { + "id": 12350, + "docRefId": "bnmlDocRef", + "title": "Bnml", + "description": "Bnml description", + "categories": ["Sorting", "Searching"], + "complexity": "easy" + }, + { + "id": 12351, + "docRefId": "poiuDocRef", + "title": "Poiu", + "description": "Poiu description", + "categories": ["Bit Manipulation", "Algorithms"], + "complexity": "hard" + }, + { + "id": 12352, + "docRefId": "lkjhDocRef", + "title": "Lkjh", + "description": "Lkjh description", + "categories": ["Greedy", "Data Structures"], + "complexity": "medium" + }, + { + "id": 12353, + "docRefId": "mnbvDocRef", + "title": "Mnbv", + "description": "Mnbv description", + "categories": ["Backtracking", "Recursion"], + "complexity": "easy" + }, + { + "id": 12354, + "docRefId": "vcxzDocRef", + "title": "Vcxz", + "description": "Vcxz description", + "categories": ["Graphs", "Dynamic Programming"], + "complexity": "hard" + } +] + +jest.mock("@/app/services/login-store", () => { + return { + __esModule: true, + getToken: jest.fn(() => TOKEN) + }; +}) + +function createMockResponse(obj: any): Response { + // @ts-ignore don't need the whole response + return { + json: () => Promise.resolve(obj), + ok: true, + status: 200 + } +} + +const TOKEN = "mockjwttoken" + +describe("GetQuestions", () => { + beforeEach(() => { + global.fetch = jest.fn().mockResolvedValue({ + async json() { + return QUESTIONS + } + }); + }) + + it("gets all questions on the first page with () call", async () => { + + const res = await GetQuestions() + + expect(jest.mocked(fetch).mock.calls).toStrictEqual([[`${NEXT_PUBLIC_QUESTION_SERVICE_URL}questions`, { + headers: { + "Authorization": `Bearer ${TOKEN}`, + }, + method: "GET", + }]]) + expect(res).toStrictEqual(QUESTIONS) + + }); + + it("formats (page=2) params correctly", async () => { + + const res = await GetQuestions(2) + + expect(jest.mocked(fetch).mock.calls).toStrictEqual([[`${NEXT_PUBLIC_QUESTION_SERVICE_URL}questions?offset=10`, { + headers: { + "Authorization": `Bearer ${TOKEN}`, + }, + method: "GET", + }]]) + }); + + it("formats (limit=3) params correctly", async () => { + + await GetQuestions(undefined, 3) + + expect(jest.mocked(fetch).mock.calls).toStrictEqual([[`${NEXT_PUBLIC_QUESTION_SERVICE_URL}questions?limit=3`, { + headers: { + "Authorization": `Bearer ${TOKEN}`, + }, + method: "GET", + }]]) + }); + + it("formats (difficulty asc) params correctly", async () => { + + await GetQuestions(undefined, undefined, "difficulty asc") + + expect(jest.mocked(fetch).mock.calls).toStrictEqual([[`${NEXT_PUBLIC_QUESTION_SERVICE_URL}questions?sortField=difficulty&sortValue=asc`, { + headers: { + "Authorization": `Bearer ${TOKEN}`, + }, + method: "GET", + }]]) + }); + + it("formats ([\"easy\", \"hard\"]) params correctly", async () => { + + await GetQuestions(undefined, undefined, undefined, ["easy", "hard"]) + + expect(jest.mocked(fetch).mock.calls).toStrictEqual([[`${NEXT_PUBLIC_QUESTION_SERVICE_URL}questions?complexity=easy,hard`, { + headers: { + "Authorization": `Bearer ${TOKEN}`, + }, + method: "GET", + }]]) + }); + + it("formats cat params correctly", async () => { + + await GetQuestions(undefined, undefined, undefined, undefined, ["CatA", "CatB"]) + + expect(jest.mocked(fetch).mock.calls).toStrictEqual([[ + `${NEXT_PUBLIC_QUESTION_SERVICE_URL}questions?categories=CatA,CatB`, + { + headers: { + "Authorization": `Bearer ${TOKEN}`, + }, + method: "GET", + } + ]]) + }); + + it("formats title params correctly", async () => { + + await GetQuestions(undefined, undefined, undefined, undefined, undefined, "The Title Name") + + expect(jest.mocked(fetch).mock.calls).toStrictEqual([[ + `${NEXT_PUBLIC_QUESTION_SERVICE_URL}questions?title=The%20Title%20Name`, + { + headers: { + "Authorization": `Bearer ${TOKEN}`, + }, + method: "GET", + } + ]]) + }); +}) + + +describe("GetSingleQuestion", () => { + const DOCREF = "mockdocref"; + beforeEach(() => { + global.fetch = jest.fn().mockResolvedValue({ + async json() { + return QUESTIONS[0] + } + }); + }); + + it("gets a question by docref", async () => { + const res = await GetSingleQuestion(DOCREF); + + expect(jest.mocked(fetch).mock.calls).toStrictEqual([[`${NEXT_PUBLIC_QUESTION_SERVICE_URL}questions/${DOCREF}`, { + headers: { + "Authorization": `Bearer ${TOKEN}`, + }, + method: "GET", + }]]) + expect(res).toStrictEqual(QUESTIONS[0]); + }) +}) + +describe("CreateQuestion", () => { + it("uploads a question", async () => { + // grabs a subset of QUESTIONS[0] + const newQuestion = (({title, description, categories, complexity}) => ({title, description, categories, complexity}))(QUESTIONS[0]) + const createdQuestion = QUESTIONS[0]; + + global.fetch = jest.fn().mockResolvedValue({ + status: 200, + statusText: "OK", + async json() { + return createdQuestion + } + }); + + const res = await CreateQuestion(newQuestion); + + expect(jest.mocked(fetch).mock.calls).toStrictEqual([[`${NEXT_PUBLIC_QUESTION_SERVICE_URL}questions`, { + headers: { + "Content-Type": "application/json", + "Authorization": `Bearer ${TOKEN}`, + }, + method: "POST", + body: JSON.stringify(newQuestion) + }]]) + expect(res).toStrictEqual(createdQuestion); + }) + + it("fails uploading question", async () => { + // grabs a subset of QUESTIONS[0] + const newQuestion = (({title, description, categories, complexity}) => ({title, description, categories, complexity}))(QUESTIONS[0]) + + global.fetch = jest.fn().mockResolvedValue({ + status: 400, + statusText: "Not Found", + data: "Question title already exists" + }) + + const res = CreateQuestion(newQuestion); + + expect(jest.mocked(fetch).mock.calls).toStrictEqual([[`${NEXT_PUBLIC_QUESTION_SERVICE_URL}questions`, { + headers: { + "Content-Type": "application/json", + "Authorization": `Bearer ${TOKEN}`, + }, + method: "POST", + body: JSON.stringify(newQuestion) + }]]) + await expect(res).rejects.toThrow("Error creating question: 400 Not Found") + }) + + +}) + + +describe("DeleteQuestion", () => { + const DOCREF = "mockdocref"; + beforeEach(() => { + global.fetch = jest.fn().mockResolvedValue({ + status: 200, + statusText: "OK", + data: `Question with ID ${DOCREF} deleted successfully` + }); + }); + + it("deletes successfully", async () => { + const shouldbeNothing = await DeleteQuestion(DOCREF); + + expect(jest.mocked(fetch).mock.calls).toStrictEqual([[ + `${NEXT_PUBLIC_QUESTION_SERVICE_URL}questions/${DOCREF}`, + { + headers: { + "Authorization": `Bearer ${TOKEN}`, + }, + method: "DELETE", + } + ]]) + expect(shouldbeNothing).toBeUndefined(); + }) +}) diff --git a/apps/frontend/jest.config.ts b/apps/frontend/jest.config.ts new file mode 100644 index 0000000000..689403a2dc --- /dev/null +++ b/apps/frontend/jest.config.ts @@ -0,0 +1,208 @@ +/** + * For a detailed explanation regarding each configuration property, visit: + * https://jestjs.io/docs/configuration + */ + +import type { Config } from 'jest'; +import nextJest from "next/jest" + +const createJestConfig = nextJest({ + // Provide the path to your Next.js app to load next.config.js and .env files in your test environment + dir: './', +}) + +const config: Config = { + // All imported modules in your tests should be mocked automatically + // automock: false, + + // Stop running tests after `n` failures + // bail: 0, + + // The directory where Jest should store its cached dependency information + // cacheDirectory: "C:\\Users\\user\\AppData\\Local\\Temp\\jest", + + // Automatically clear mock calls, instances, contexts and results before every test + clearMocks: true, + + // Indicates whether the coverage information should be collected while executing the test + // collectCoverage: false, + + // An array of glob patterns indicating a set of files for which coverage information should be collected + // collectCoverageFrom: undefined, + + // The directory where Jest should output its coverage files + // coverageDirectory: undefined, + + // An array of regexp pattern strings used to skip coverage collection + // coveragePathIgnorePatterns: [ + // "\\\\node_modules\\\\" + // ], + + // Indicates which provider should be used to instrument code for coverage + coverageProvider: "v8", + + // A list of reporter names that Jest uses when writing coverage reports + // coverageReporters: [ + // "json", + // "text", + // "lcov", + // "clover" + // ], + + // An object that configures minimum threshold enforcement for coverage results + // coverageThreshold: undefined, + + // A path to a custom dependency extractor + // dependencyExtractor: undefined, + + // Make calling deprecated APIs throw helpful error messages + // errorOnDeprecated: false, + + // The default configuration for fake timers + // fakeTimers: { + // "enableGlobally": false + // }, + + // Force coverage collection from ignored files using an array of glob patterns + // forceCoverageMatch: [], + + // A path to a module which exports an async function that is triggered once before all test suites + // globalSetup: undefined, + + // A path to a module which exports an async function that is triggered once after all test suites + // globalTeardown: undefined, + + // A set of global variables that need to be available in all test environments + // globals: {}, + + // The maximum amount of workers used to run your tests. Can be specified as % or a number. E.g. maxWorkers: 10% will use 10% of your CPU amount + 1 as the maximum worker number. maxWorkers: 2 will use a maximum of 2 workers. + // maxWorkers: "50%", + + // An array of directory names to be searched recursively up from the requiring module's location + // moduleDirectories: [ + // "node_modules" + // ], + + // An array of file extensions your modules use + // moduleFileExtensions: [ + // "js", + // "mjs", + // "cjs", + // "jsx", + // "ts", + // "tsx", + // "json", + // "node" + // ], + + // A map from regular expressions to module names or to arrays of module names that allow to stub out resources with a single module + moduleNameMapper: { + '^@/(.*)$': '/src/$1', + }, + + // An array of regexp pattern strings, matched against all module paths before considered 'visible' to the module loader + // modulePathIgnorePatterns: [], + + // Activates notifications for test results + // notify: false, + + // An enum that specifies notification mode. Requires { notify: true } + // notifyMode: "failure-change", + + // A preset that is used as a base for Jest's configuration + // preset: undefined, + + // Run tests from one or more projects + // projects: undefined, + + // Use this configuration option to add custom reporters to Jest + // reporters: undefined, + + // Automatically reset mock state before every test + // resetMocks: false, + + // Reset the module registry before running each individual test + // resetModules: false, + + // A path to a custom resolver + // resolver: undefined, + + // Automatically restore mock state and implementation before every test + // restoreMocks: false, + + // The root directory that Jest should scan for tests and modules within + // rootDir: undefined, + + // A list of paths to directories that Jest should use to search for files in + // roots: [ + // "" + // ], + + // Allows you to use a custom runner instead of Jest's default test runner + // runner: "jest-runner", + + // The paths to modules that run some code to configure or set up the testing environment before each test + // setupFiles: [], + + // A list of paths to modules that run some code to configure or set up the testing framework before each test + // setupFilesAfterEnv: [], + + // The number of seconds after which a test is considered as slow and reported as such in the results. + // slowTestThreshold: 5, + + // A list of paths to snapshot serializer modules Jest should use for snapshot testing + // snapshotSerializers: [], + + // The test environment that will be used for testing + testEnvironment: "jsdom", + + // Options that will be passed to the testEnvironment + // testEnvironmentOptions: {}, + + // Adds a location field to test results + // testLocationInResults: false, + + // The glob patterns Jest uses to detect test files + // testMatch: [ + // "**/__tests__/**/*.[jt]s?(x)", + // "**/?(*.)+(spec|test).[tj]s?(x)" + // ], + + // An array of regexp pattern strings that are matched against all test paths, matched tests are skipped + // testPathIgnorePatterns: [ + // "\\\\node_modules\\\\" + // ], + + // The regexp pattern or array of patterns that Jest uses to detect test files + // testRegex: [], + + // This option allows the use of a custom results processor + // testResultsProcessor: undefined, + + // This option allows use of a custom test runner + // testRunner: "jest-circus/runner", + + // A map from regular expressions to paths to transformers + // transform: undefined, + + // An array of regexp pattern strings that are matched against all source file paths, matched files will skip transformation + // transformIgnorePatterns: [ + // "\\\\node_modules\\\\", + // "\\.pnp\\.[^\\\\]+$" + // ], + + // An array of regexp pattern strings that are matched against all modules before the module loader will automatically return a mock for them + // unmockedModulePathPatterns: undefined, + + // Indicates whether each individual test should be reported during the run + // verbose: undefined, + + // An array of regexp patterns that are matched against all source file paths before re-running tests in watch mode + // watchPathIgnorePatterns: [], + + // Whether to use watchman for file crawling + // watchman: true, +}; + +export default createJestConfig(config); + diff --git a/apps/frontend/next.config.mjs b/apps/frontend/next.config.mjs new file mode 100644 index 0000000000..8c8bab67b5 --- /dev/null +++ b/apps/frontend/next.config.mjs @@ -0,0 +1,6 @@ +/** @type {import('next').NextConfig} */ +const nextConfig = { + output: "standalone", +}; + +export default nextConfig; diff --git a/apps/frontend/package.json b/apps/frontend/package.json new file mode 100644 index 0000000000..72690ce9c6 --- /dev/null +++ b/apps/frontend/package.json @@ -0,0 +1,62 @@ +{ + "name": "web", + "version": "0.1.0", + "private": true, + "scripts": { + "dev": "next dev", + "build": "next build", + "start": "next start", + "lint": "next lint", + "test": "jest", + "unit-test": "jest --verbose __tests__/unit-tests", + "browser-test": "jest --verbose __tests__/browser-tests" + }, + "dependencies": { + "@ant-design/icons": "^5.5.1", + "@ant-design/nextjs-registry": "^1.0.1", + "@codemirror/commands": "^6.7.1", + "@codemirror/lang-cpp": "^6.0.2", + "@codemirror/lang-go": "^6.0.1", + "@codemirror/lang-java": "^6.0.1", + "@codemirror/lang-javascript": "^6.2.2", + "@codemirror/lang-python": "^6.1.6", + "@codemirror/language": "^6.10.3", + "@codemirror/state": "^6.4.1", + "@codemirror/view": "^6.34.1", + "antd": "^5.20.6", + "codemirror": "^6.0.1", + "jwt-decode": "^4.0.0", + "next": "14.2.13", + "peerjs": "^1.5.4", + "react": "^18.2.0", + "react-dom": "^18.2.0", + "react-timer-hook": "^3.0.7", + "react-use-websocket": "^4.9.0", + "sass": "^1.79.2", + "typeface-montserrat": "^1.1.13", + "y-codemirror.next": "^0.3.5", + "y-webrtc": "^10.3.0", + "yjs": "^13.6.20" + }, + "devDependencies": { + "@testing-library/dom": "^10.4.0", + "@testing-library/jest-dom": "^6.6.3", + "@testing-library/react": "^16.0.1", + "@types/chromedriver": "^81.0.5", + "@types/codemirror": "^5.60.15", + "@types/jest": "^29.5.14", + "@types/node": "^20", + "@types/peerjs": "^1.1.0", + "@types/react": "^18.3.8", + "@types/react-dom": "^18.3.0", + "@types/selenium-webdriver": "^4.1.27", + "eslint": "^8", + "eslint-config-next": "14.2.13", + "jest": "^29.7.0", + "jest-environment-jsdom": "^29.7.0", + "selenium-webdriver": "^4.26.0", + "ts-node": "^10.9.2", + "typescript": "^5" + }, + "packageManager": "pnpm@9.1.4+sha512.9df9cf27c91715646c7d675d1c9c8e41f6fce88246f1318c1aa6a1ed1aeb3c4f032fcdf4ba63cc69c4fe6d634279176b5358727d8f2cc1e65b65f43ce2f8bfb0" +} diff --git a/apps/frontend/pnpm-lock.yaml b/apps/frontend/pnpm-lock.yaml new file mode 100644 index 0000000000..5b99c479b6 --- /dev/null +++ b/apps/frontend/pnpm-lock.yaml @@ -0,0 +1,7252 @@ +lockfileVersion: '9.0' + +settings: + autoInstallPeers: true + excludeLinksFromLockfile: false + +importers: + + .: + dependencies: + '@ant-design/icons': + specifier: ^5.5.1 + version: 5.5.1(react-dom@18.2.0(react@18.2.0))(react@18.2.0) + '@ant-design/nextjs-registry': + specifier: ^1.0.1 + version: 1.0.1(@ant-design/cssinjs@1.21.1(react-dom@18.2.0(react@18.2.0))(react@18.2.0))(antd@5.20.6(react-dom@18.2.0(react@18.2.0))(react@18.2.0))(next@14.2.13(@babel/core@7.26.0)(react-dom@18.2.0(react@18.2.0))(react@18.2.0)(sass@1.79.2))(react-dom@18.2.0(react@18.2.0))(react@18.2.0) + '@codemirror/commands': + specifier: ^6.7.1 + version: 6.7.1 + '@codemirror/lang-cpp': + specifier: ^6.0.2 + version: 6.0.2 + '@codemirror/lang-go': + specifier: ^6.0.1 + version: 6.0.1(@codemirror/view@6.34.1) + '@codemirror/lang-java': + specifier: ^6.0.1 + version: 6.0.1 + '@codemirror/lang-javascript': + specifier: ^6.2.2 + version: 6.2.2 + '@codemirror/lang-python': + specifier: ^6.1.6 + version: 6.1.6(@codemirror/view@6.34.1) + '@codemirror/language': + specifier: ^6.10.3 + version: 6.10.3 + '@codemirror/state': + specifier: ^6.4.1 + version: 6.4.1 + '@codemirror/view': + specifier: ^6.34.1 + version: 6.34.1 + antd: + specifier: ^5.20.6 + version: 5.20.6(react-dom@18.2.0(react@18.2.0))(react@18.2.0) + codemirror: + specifier: ^6.0.1 + version: 6.0.1(@lezer/common@1.2.3) + jwt-decode: + specifier: ^4.0.0 + version: 4.0.0 + next: + specifier: 14.2.13 + version: 14.2.13(@babel/core@7.26.0)(react-dom@18.2.0(react@18.2.0))(react@18.2.0)(sass@1.79.2) + peerjs: + specifier: ^1.5.4 + version: 1.5.4 + react: + specifier: ^18.2.0 + version: 18.2.0 + react-dom: + specifier: ^18.2.0 + version: 18.2.0(react@18.2.0) + react-timer-hook: + specifier: ^3.0.7 + version: 3.0.7(react@18.2.0) + react-use-websocket: + specifier: ^4.9.0 + version: 4.9.0 + sass: + specifier: ^1.79.2 + version: 1.79.2 + typeface-montserrat: + specifier: ^1.1.13 + version: 1.1.13 + y-codemirror.next: + specifier: ^0.3.5 + version: 0.3.5(@codemirror/state@6.4.1)(@codemirror/view@6.34.1)(yjs@13.6.20) + y-webrtc: + specifier: ^10.3.0 + version: 10.3.0(yjs@13.6.20) + yjs: + specifier: ^13.6.20 + version: 13.6.20 + devDependencies: + '@testing-library/dom': + specifier: ^10.4.0 + version: 10.4.0 + '@testing-library/jest-dom': + specifier: ^6.6.3 + version: 6.6.3 + '@testing-library/react': + specifier: ^16.0.1 + version: 16.0.1(@testing-library/dom@10.4.0)(@types/react-dom@18.3.0)(@types/react@18.3.8)(react-dom@18.2.0(react@18.2.0))(react@18.2.0) + '@types/chromedriver': + specifier: ^81.0.5 + version: 81.0.5 + '@types/codemirror': + specifier: ^5.60.15 + version: 5.60.15 + '@types/jest': + specifier: ^29.5.14 + version: 29.5.14 + '@types/node': + specifier: ^20 + version: 20.0.0 + '@types/peerjs': + specifier: ^1.1.0 + version: 1.1.0 + '@types/react': + specifier: ^18.3.8 + version: 18.3.8 + '@types/react-dom': + specifier: ^18.3.0 + version: 18.3.0 + '@types/selenium-webdriver': + specifier: ^4.1.27 + version: 4.1.27 + eslint: + specifier: ^8 + version: 8.0.0 + eslint-config-next: + specifier: 14.2.13 + version: 14.2.13(eslint@8.0.0)(typescript@5.0.2) + jest: + specifier: ^29.7.0 + version: 29.7.0(@types/node@20.0.0)(ts-node@10.9.2(@types/node@20.0.0)(typescript@5.0.2)) + jest-environment-jsdom: + specifier: ^29.7.0 + version: 29.7.0 + selenium-webdriver: + specifier: ^4.26.0 + version: 4.26.0 + ts-node: + specifier: ^10.9.2 + version: 10.9.2(@types/node@20.0.0)(typescript@5.0.2) + typescript: + specifier: ^5 + version: 5.0.2 + +packages: + + '@adobe/css-tools@4.4.0': + resolution: {integrity: sha512-Ff9+ksdQQB3rMncgqDK78uLznstjyfIf2Arnh22pW8kBpLs6rpKDwgnZT46hin5Hl1WzazzK64DOrhSwYpS7bQ==} + + '@ampproject/remapping@2.3.0': + resolution: {integrity: sha512-30iZtAPgz+LTIYoeivqYo853f02jBYSd5uGnGpkFV0M3xOt9aN73erkgYAmZU43x4VfqcnLxW9Kpg3R5LC4YYw==} + engines: {node: '>=6.0.0'} + + '@ant-design/colors@7.1.0': + resolution: {integrity: sha512-MMoDGWn1y9LdQJQSHiCC20x3uZ3CwQnv9QMz6pCmJOrqdgM9YxsoVVY0wtrdXbmfSgnV0KNk6zi09NAhMR2jvg==} + + '@ant-design/cssinjs-utils@1.1.0': + resolution: {integrity: sha512-E9nOWObXx7Dy7hdyuYlOFaer/LtPO7oyZVxZphh0CYEslr5EmhJPM3WI0Q2RBHRtYg6dSNqeSK73kvZjPN3IMQ==} + peerDependencies: + react: '>=16.9.0' + react-dom: '>=16.9.0' + + '@ant-design/cssinjs@1.21.1': + resolution: {integrity: sha512-tyWnlK+XH7Bumd0byfbCiZNK43HEubMoCcu9VxwsAwiHdHTgWa+tMN0/yvxa+e8EzuFP1WdUNNPclRpVtD33lg==} + peerDependencies: + react: '>=16.0.0' + react-dom: '>=16.0.0' + + '@ant-design/fast-color@2.0.6': + resolution: {integrity: sha512-y2217gk4NqL35giHl72o6Zzqji9O7vHh9YmhUVkPtAOpoTCH4uWxo/pr4VE8t0+ChEPs0qo4eJRC5Q1eXWo3vA==} + engines: {node: '>=8.x'} + + '@ant-design/icons-svg@4.4.2': + resolution: {integrity: sha512-vHbT+zJEVzllwP+CM+ul7reTEfBR0vgxFe7+lREAsAA7YGsYpboiq2sQNeQeRvh09GfQgs/GyFEvZpJ9cLXpXA==} + + '@ant-design/icons@5.5.1': + resolution: {integrity: sha512-0UrM02MA2iDIgvLatWrj6YTCYe0F/cwXvVE0E2SqGrL7PZireQwgEKTKBisWpZyal5eXZLvuM98kju6YtYne8w==} + engines: {node: '>=8'} + peerDependencies: + react: '>=16.0.0' + react-dom: '>=16.0.0' + + '@ant-design/nextjs-registry@1.0.1': + resolution: {integrity: sha512-DaMJ1nClR1a4UfG7vXkDj89z1eARhSDgqvHoxfM0Yco1MZEbaqRj4o+bQToHb3gMb6gbFlrZ51nOBGh5xSJ7EQ==} + peerDependencies: + '@ant-design/cssinjs': ^1.18.2 + antd: ^5.0.0 + next: ^14.0.0 + react: '>=16.0.0' + react-dom: '>=16.0.0' + + '@ant-design/react-slick@1.1.2': + resolution: {integrity: sha512-EzlvzE6xQUBrZuuhSAFTdsr4P2bBBHGZwKFemEfq8gIGyIQCxalYfZW/T2ORbtQx5rU69o+WycP3exY/7T1hGA==} + peerDependencies: + react: '>=16.9.0' + + '@babel/code-frame@7.26.2': + resolution: {integrity: sha512-RJlIHRueQgwWitWgF8OdFYGZX328Ax5BCemNGlqHfplnRT9ESi8JkFlvaVYbS+UubVY6dpv87Fs2u5M29iNFVQ==} + engines: {node: '>=6.9.0'} + + '@babel/compat-data@7.26.2': + resolution: {integrity: sha512-Z0WgzSEa+aUcdiJuCIqgujCshpMWgUpgOxXotrYPSA53hA3qopNaqcJpyr0hVb1FeWdnqFA35/fUtXgBK8srQg==} + engines: {node: '>=6.9.0'} + + '@babel/core@7.26.0': + resolution: {integrity: sha512-i1SLeK+DzNnQ3LL/CswPCa/E5u4lh1k6IAEphON8F+cXt0t9euTshDru0q7/IqMa1PMPz5RnHuHscF8/ZJsStg==} + engines: {node: '>=6.9.0'} + + '@babel/generator@7.26.2': + resolution: {integrity: sha512-zevQbhbau95nkoxSq3f/DC/SC+EEOUZd3DYqfSkMhY2/wfSeaHV1Ew4vk8e+x8lja31IbyuUa2uQ3JONqKbysw==} + engines: {node: '>=6.9.0'} + + '@babel/helper-compilation-targets@7.25.9': + resolution: {integrity: sha512-j9Db8Suy6yV/VHa4qzrj9yZfZxhLWQdVnRlXxmKLYlhWUVB1sB2G5sxuWYXk/whHD9iW76PmNzxZ4UCnTQTVEQ==} + engines: {node: '>=6.9.0'} + + '@babel/helper-module-imports@7.25.9': + resolution: {integrity: sha512-tnUA4RsrmflIM6W6RFTLFSXITtl0wKjgpnLgXyowocVPrbYrLUXSBXDgTs8BlbmIzIdlBySRQjINYs2BAkiLtw==} + engines: {node: '>=6.9.0'} + + '@babel/helper-module-transforms@7.26.0': + resolution: {integrity: sha512-xO+xu6B5K2czEnQye6BHA7DolFFmS3LB7stHZFaOLb1pAwO1HWLS8fXA+eh0A2yIvltPVmx3eNNDBJA2SLHXFw==} + engines: {node: '>=6.9.0'} + peerDependencies: + '@babel/core': ^7.0.0 + + '@babel/helper-plugin-utils@7.25.9': + resolution: {integrity: sha512-kSMlyUVdWe25rEsRGviIgOWnoT/nfABVWlqt9N19/dIPWViAOW2s9wznP5tURbs/IDuNk4gPy3YdYRgH3uxhBw==} + engines: {node: '>=6.9.0'} + + '@babel/helper-string-parser@7.25.9': + resolution: {integrity: sha512-4A/SCr/2KLd5jrtOMFzaKjVtAei3+2r/NChoBNoZ3EyP/+GlhoaEGoWOZUmFmoITP7zOJyHIMm+DYRd8o3PvHA==} + engines: {node: '>=6.9.0'} + + '@babel/helper-validator-identifier@7.25.9': + resolution: {integrity: sha512-Ed61U6XJc3CVRfkERJWDz4dJwKe7iLmmJsbOGu9wSloNSFttHV0I8g6UAgb7qnK5ly5bGLPd4oXZlxCdANBOWQ==} + engines: {node: '>=6.9.0'} + + '@babel/helper-validator-option@7.25.9': + resolution: {integrity: sha512-e/zv1co8pp55dNdEcCynfj9X7nyUKUXoUEwfXqaZt0omVOmDe9oOTdKStH4GmAw6zxMFs50ZayuMfHDKlO7Tfw==} + engines: {node: '>=6.9.0'} + + '@babel/helpers@7.26.0': + resolution: {integrity: sha512-tbhNuIxNcVb21pInl3ZSjksLCvgdZy9KwJ8brv993QtIVKJBBkYXz4q4ZbAv31GdnC+R90np23L5FbEBlthAEw==} + engines: {node: '>=6.9.0'} + + '@babel/parser@7.26.2': + resolution: {integrity: sha512-DWMCZH9WA4Maitz2q21SRKHo9QXZxkDsbNZoVD62gusNtNBBqDg9i7uOhASfTfIGNzW+O+r7+jAlM8dwphcJKQ==} + engines: {node: '>=6.0.0'} + hasBin: true + + '@babel/plugin-syntax-async-generators@7.8.4': + resolution: {integrity: sha512-tycmZxkGfZaxhMRbXlPXuVFpdWlXpir2W4AMhSJgRKzk/eDlIXOhb2LHWoLpDF7TEHylV5zNhykX6KAgHJmTNw==} + peerDependencies: + '@babel/core': ^7.0.0-0 + + '@babel/plugin-syntax-bigint@7.8.3': + resolution: {integrity: sha512-wnTnFlG+YxQm3vDxpGE57Pj0srRU4sHE/mDkt1qv2YJJSeUAec2ma4WLUnUPeKjyrfntVwe/N6dCXpU+zL3Npg==} + peerDependencies: + '@babel/core': ^7.0.0-0 + + '@babel/plugin-syntax-class-properties@7.12.13': + resolution: {integrity: sha512-fm4idjKla0YahUNgFNLCB0qySdsoPiZP3iQE3rky0mBUtMZ23yDJ9SJdg6dXTSDnulOVqiF3Hgr9nbXvXTQZYA==} + peerDependencies: + '@babel/core': ^7.0.0-0 + + '@babel/plugin-syntax-class-static-block@7.14.5': + resolution: {integrity: sha512-b+YyPmr6ldyNnM6sqYeMWE+bgJcJpO6yS4QD7ymxgH34GBPNDM/THBh8iunyvKIZztiwLH4CJZ0RxTk9emgpjw==} + engines: {node: '>=6.9.0'} + peerDependencies: + '@babel/core': ^7.0.0-0 + + '@babel/plugin-syntax-import-attributes@7.26.0': + resolution: {integrity: sha512-e2dttdsJ1ZTpi3B9UYGLw41hifAubg19AtCu/2I/F1QNVclOBr1dYpTdmdyZ84Xiz43BS/tCUkMAZNLv12Pi+A==} + engines: {node: '>=6.9.0'} + peerDependencies: + '@babel/core': ^7.0.0-0 + + '@babel/plugin-syntax-import-meta@7.10.4': + resolution: {integrity: sha512-Yqfm+XDx0+Prh3VSeEQCPU81yC+JWZ2pDPFSS4ZdpfZhp4MkFMaDC1UqseovEKwSUpnIL7+vK+Clp7bfh0iD7g==} + peerDependencies: + '@babel/core': ^7.0.0-0 + + '@babel/plugin-syntax-json-strings@7.8.3': + resolution: {integrity: sha512-lY6kdGpWHvjoe2vk4WrAapEuBR69EMxZl+RoGRhrFGNYVK8mOPAW8VfbT/ZgrFbXlDNiiaxQnAtgVCZ6jv30EA==} + peerDependencies: + '@babel/core': ^7.0.0-0 + + '@babel/plugin-syntax-jsx@7.25.9': + resolution: {integrity: sha512-ld6oezHQMZsZfp6pWtbjaNDF2tiiCYYDqQszHt5VV437lewP9aSi2Of99CK0D0XB21k7FLgnLcmQKyKzynfeAA==} + engines: {node: '>=6.9.0'} + peerDependencies: + '@babel/core': ^7.0.0-0 + + '@babel/plugin-syntax-logical-assignment-operators@7.10.4': + resolution: {integrity: sha512-d8waShlpFDinQ5MtvGU9xDAOzKH47+FFoney2baFIoMr952hKOLp1HR7VszoZvOsV/4+RRszNY7D17ba0te0ig==} + peerDependencies: + '@babel/core': ^7.0.0-0 + + '@babel/plugin-syntax-nullish-coalescing-operator@7.8.3': + resolution: {integrity: sha512-aSff4zPII1u2QD7y+F8oDsz19ew4IGEJg9SVW+bqwpwtfFleiQDMdzA/R+UlWDzfnHFCxxleFT0PMIrR36XLNQ==} + peerDependencies: + '@babel/core': ^7.0.0-0 + + '@babel/plugin-syntax-numeric-separator@7.10.4': + resolution: {integrity: sha512-9H6YdfkcK/uOnY/K7/aA2xpzaAgkQn37yzWUMRK7OaPOqOpGS1+n0H5hxT9AUw9EsSjPW8SVyMJwYRtWs3X3ug==} + peerDependencies: + '@babel/core': ^7.0.0-0 + + '@babel/plugin-syntax-object-rest-spread@7.8.3': + resolution: {integrity: sha512-XoqMijGZb9y3y2XskN+P1wUGiVwWZ5JmoDRwx5+3GmEplNyVM2s2Dg8ILFQm8rWM48orGy5YpI5Bl8U1y7ydlA==} + peerDependencies: + '@babel/core': ^7.0.0-0 + + '@babel/plugin-syntax-optional-catch-binding@7.8.3': + resolution: {integrity: sha512-6VPD0Pc1lpTqw0aKoeRTMiB+kWhAoT24PA+ksWSBrFtl5SIRVpZlwN3NNPQjehA2E/91FV3RjLWoVTglWcSV3Q==} + peerDependencies: + '@babel/core': ^7.0.0-0 + + '@babel/plugin-syntax-optional-chaining@7.8.3': + resolution: {integrity: sha512-KoK9ErH1MBlCPxV0VANkXW2/dw4vlbGDrFgz8bmUsBGYkFRcbRwMh6cIJubdPrkxRwuGdtCk0v/wPTKbQgBjkg==} + peerDependencies: + '@babel/core': ^7.0.0-0 + + '@babel/plugin-syntax-private-property-in-object@7.14.5': + resolution: {integrity: sha512-0wVnp9dxJ72ZUJDV27ZfbSj6iHLoytYZmh3rFcxNnvsJF3ktkzLDZPy/mA17HGsaQT3/DQsWYX1f1QGWkCoVUg==} + engines: {node: '>=6.9.0'} + peerDependencies: + '@babel/core': ^7.0.0-0 + + '@babel/plugin-syntax-top-level-await@7.14.5': + resolution: {integrity: sha512-hx++upLv5U1rgYfwe1xBQUhRmU41NEvpUvrp8jkrSCdvGSnM5/qdRMtylJ6PG5OFkBaHkbTAKTnd3/YyESRHFw==} + engines: {node: '>=6.9.0'} + peerDependencies: + '@babel/core': ^7.0.0-0 + + '@babel/plugin-syntax-typescript@7.25.9': + resolution: {integrity: sha512-hjMgRy5hb8uJJjUcdWunWVcoi9bGpJp8p5Ol1229PoN6aytsLwNMgmdftO23wnCLMfVmTwZDWMPNq/D1SY60JQ==} + engines: {node: '>=6.9.0'} + peerDependencies: + '@babel/core': ^7.0.0-0 + + '@babel/runtime@7.25.7': + resolution: {integrity: sha512-FjoyLe754PMiYsFaN5C94ttGiOmBNYTf6pLr4xXHAT5uctHb092PBszndLDR5XA/jghQvn4n7JMHl7dmTgbm9w==} + engines: {node: '>=6.9.0'} + + '@babel/template@7.25.9': + resolution: {integrity: sha512-9DGttpmPvIxBb/2uwpVo3dqJ+O6RooAFOS+lB+xDqoE2PVCE8nfoHMdZLpfCQRLwvohzXISPZcgxt80xLfsuwg==} + engines: {node: '>=6.9.0'} + + '@babel/traverse@7.25.9': + resolution: {integrity: sha512-ZCuvfwOwlz/bawvAuvcj8rrithP2/N55Tzz342AkTvq4qaWbGfmCk/tKhNaV2cthijKrPAA8SRJV5WWe7IBMJw==} + engines: {node: '>=6.9.0'} + + '@babel/types@7.26.0': + resolution: {integrity: sha512-Z/yiTPj+lDVnF7lWeKCIJzaIkI0vYO87dMpZ4bg4TDrFe4XXLFWL1TbXU27gBP3QccxV9mZICCrnjnYlJjXHOA==} + engines: {node: '>=6.9.0'} + + '@bazel/runfiles@6.3.1': + resolution: {integrity: sha512-1uLNT5NZsUVIGS4syuHwTzZ8HycMPyr6POA3FCE4GbMtc4rhoJk8aZKtNIRthJYfL+iioppi+rTfH3olMPr9nA==} + + '@bcoe/v8-coverage@0.2.3': + resolution: {integrity: sha512-0hYQ8SB4Db5zvZB4axdMHGwEaQjkZzFjQiN9LVYvIFB2nSUHW9tYpxWriPrWDASIxiaXax83REcLxuSdnGPZtw==} + + '@codemirror/autocomplete@6.18.1': + resolution: {integrity: sha512-iWHdj/B1ethnHRTwZj+C1obmmuCzquH29EbcKr0qIjA9NfDeBDJ7vs+WOHsFeLeflE4o+dHfYndJloMKHUkWUA==} + peerDependencies: + '@codemirror/language': ^6.0.0 + '@codemirror/state': ^6.0.0 + '@codemirror/view': ^6.0.0 + '@lezer/common': ^1.0.0 + + '@codemirror/commands@6.7.1': + resolution: {integrity: sha512-llTrboQYw5H4THfhN4U3qCnSZ1SOJ60ohhz+SzU0ADGtwlc533DtklQP0vSFaQuCPDn3BPpOd1GbbnUtwNjsrw==} + + '@codemirror/lang-cpp@6.0.2': + resolution: {integrity: sha512-6oYEYUKHvrnacXxWxYa6t4puTlbN3dgV662BDfSH8+MfjQjVmP697/KYTDOqpxgerkvoNm7q5wlFMBeX8ZMocg==} + + '@codemirror/lang-go@6.0.1': + resolution: {integrity: sha512-7fNvbyNylvqCphW9HD6WFnRpcDjr+KXX/FgqXy5H5ZS0eC5edDljukm/yNgYkwTsgp2busdod50AOTIy6Jikfg==} + + '@codemirror/lang-java@6.0.1': + resolution: {integrity: sha512-OOnmhH67h97jHzCuFaIEspbmsT98fNdhVhmA3zCxW0cn7l8rChDhZtwiwJ/JOKXgfm4J+ELxQihxaI7bj7mJRg==} + + '@codemirror/lang-javascript@6.2.2': + resolution: {integrity: sha512-VGQfY+FCc285AhWuwjYxQyUQcYurWlxdKYT4bqwr3Twnd5wP5WSeu52t4tvvuWmljT4EmgEgZCqSieokhtY8hg==} + + '@codemirror/lang-python@6.1.6': + resolution: {integrity: sha512-ai+01WfZhWqM92UqjnvorkxosZ2aq2u28kHvr+N3gu012XqY2CThD67JPMHnGceRfXPDBmn1HnyqowdpF57bNg==} + + '@codemirror/language@6.10.3': + resolution: {integrity: sha512-kDqEU5sCP55Oabl6E7m5N+vZRoc0iWqgDVhEKifcHzPzjqCegcO4amfrYVL9PmPZpl4G0yjkpTpUO/Ui8CzO8A==} + + '@codemirror/lint@6.8.2': + resolution: {integrity: sha512-PDFG5DjHxSEjOXk9TQYYVjZDqlZTFaDBfhQixHnQOEVDDNHUbEh/hstAjcQJaA6FQdZTD1hquXTK0rVBLADR1g==} + + '@codemirror/search@6.5.6': + resolution: {integrity: sha512-rpMgcsh7o0GuCDUXKPvww+muLA1pDJaFrpq/CCHtpQJYz8xopu4D1hPcKRoDD0YlF8gZaqTNIRa4VRBWyhyy7Q==} + + '@codemirror/state@6.4.1': + resolution: {integrity: sha512-QkEyUiLhsJoZkbumGZlswmAhA7CBU02Wrz7zvH4SrcifbsqwlXShVXg65f3v/ts57W3dqyamEriMhij1Z3Zz4A==} + + '@codemirror/view@6.34.1': + resolution: {integrity: sha512-t1zK/l9UiRqwUNPm+pdIT0qzJlzuVckbTEMVNFhfWkGiBQClstzg+78vedCvLSX0xJEZ6lwZbPpnljL7L6iwMQ==} + + '@cspotcode/source-map-support@0.8.1': + resolution: {integrity: sha512-IchNf6dN4tHoMFIn/7OE8LWZ19Y6q/67Bmf6vnGREv8RSbBVb9LPJxEcnwrcwX6ixSvaiGoomAUvu4YSxXrVgw==} + engines: {node: '>=12'} + + '@ctrl/tinycolor@3.6.1': + resolution: {integrity: sha512-SITSV6aIXsuVNV3f3O0f2n/cgyEDWoSqtZMYiAmcsYHydcKrOz3gUxB/iXd/Qf08+IZX4KpgNbvUdMBmWz+kcA==} + engines: {node: '>=10'} + + '@emotion/hash@0.8.0': + resolution: {integrity: sha512-kBJtf7PH6aWwZ6fka3zQ0p6SBYzx4fl1LoZXE2RrnYST9Xljm7WfKJrU4g/Xr3Beg72MLrp1AWNUmuYJTL7Cow==} + + '@emotion/unitless@0.7.5': + resolution: {integrity: sha512-OWORNpfjMsSSUBVrRBVGECkhWcULOAJz9ZW8uK9qgxD+87M7jHRcvh/A96XXNhXTLmKcoYSQtBEX7lHMO7YRwg==} + + '@eslint-community/eslint-utils@4.4.0': + resolution: {integrity: sha512-1/sA4dwrzBAyeUoQ6oxahHKmrZvsnLCg4RfxW3ZFGGmQkSNQPFNLV9CUEFQP1x9EYXHTo5p6xdhZM1Ne9p/AfA==} + engines: {node: ^12.22.0 || ^14.17.0 || >=16.0.0} + peerDependencies: + eslint: ^6.0.0 || ^7.0.0 || >=8.0.0 + + '@eslint-community/regexpp@4.11.1': + resolution: {integrity: sha512-m4DVN9ZqskZoLU5GlWZadwDnYo3vAEydiUayB9widCl9ffWx2IvPnp6n3on5rJmziJSw9Bv+Z3ChDVdMwXCY8Q==} + engines: {node: ^12.0.0 || ^14.0.0 || >=16.0.0} + + '@eslint/eslintrc@1.4.1': + resolution: {integrity: sha512-XXrH9Uarn0stsyldqDYq8r++mROmWRI1xKMXa640Bb//SY1+ECYX6VzT6Lcx5frD0V30XieqJ0oX9I2Xj5aoMA==} + engines: {node: ^12.22.0 || ^14.17.0 || >=16.0.0} + + '@humanwhocodes/config-array@0.6.0': + resolution: {integrity: sha512-JQlEKbcgEUjBFhLIF4iqM7u/9lwgHRBcpHrmUNCALK0Q3amXN6lxdoXLnF0sm11E9VqTmBALR87IlUg1bZ8A9A==} + engines: {node: '>=10.10.0'} + deprecated: Use @eslint/config-array instead + + '@humanwhocodes/object-schema@1.2.1': + resolution: {integrity: sha512-ZnQMnLV4e7hDlUvw8H+U8ASL02SS2Gn6+9Ac3wGGLIe7+je2AeAOxPY+izIPJDfFDb7eDjev0Us8MO1iFRN8hA==} + deprecated: Use @eslint/object-schema instead + + '@isaacs/cliui@8.0.2': + resolution: {integrity: sha512-O8jcjabXaleOG9DQ0+ARXWZBTfnP4WNAqzuiJK7ll44AmxGKv/J2M4TPjxjY3znBCfvBXFzucm1twdyFybFqEA==} + engines: {node: '>=12'} + + '@istanbuljs/load-nyc-config@1.1.0': + resolution: {integrity: sha512-VjeHSlIzpv/NyD3N0YuHfXOPDIixcA1q2ZV98wsMqcYlPmv2n3Yb2lYP9XMElnaFVXg5A7YLTeLu6V84uQDjmQ==} + engines: {node: '>=8'} + + '@istanbuljs/schema@0.1.3': + resolution: {integrity: sha512-ZXRY4jNvVgSVQ8DL3LTcakaAtXwTVUxE81hslsyD2AtoXW/wVob10HkOJ1X/pAlcI7D+2YoZKg5do8G/w6RYgA==} + engines: {node: '>=8'} + + '@jest/console@29.7.0': + resolution: {integrity: sha512-5Ni4CU7XHQi32IJ398EEP4RrB8eV09sXP2ROqD4bksHrnTree52PsxvX8tpL8LvTZ3pFzXyPbNQReSN41CAhOg==} + engines: {node: ^14.15.0 || ^16.10.0 || >=18.0.0} + + '@jest/core@29.7.0': + resolution: {integrity: sha512-n7aeXWKMnGtDA48y8TLWJPJmLmmZ642Ceo78cYWEpiD7FzDgmNDV/GCVRorPABdXLJZ/9wzzgZAlHjXjxDHGsg==} + engines: {node: ^14.15.0 || ^16.10.0 || >=18.0.0} + peerDependencies: + node-notifier: ^8.0.1 || ^9.0.0 || ^10.0.0 + peerDependenciesMeta: + node-notifier: + optional: true + + '@jest/environment@29.7.0': + resolution: {integrity: sha512-aQIfHDq33ExsN4jP1NWGXhxgQ/wixs60gDiKO+XVMd8Mn0NWPWgc34ZQDTb2jKaUWQ7MuwoitXAsN2XVXNMpAw==} + engines: {node: ^14.15.0 || ^16.10.0 || >=18.0.0} + + '@jest/expect-utils@29.7.0': + resolution: {integrity: sha512-GlsNBWiFQFCVi9QVSx7f5AgMeLxe9YCCs5PuP2O2LdjDAA8Jh9eX7lA1Jq/xdXw3Wb3hyvlFNfZIfcRetSzYcA==} + engines: {node: ^14.15.0 || ^16.10.0 || >=18.0.0} + + '@jest/expect@29.7.0': + resolution: {integrity: sha512-8uMeAMycttpva3P1lBHB8VciS9V0XAr3GymPpipdyQXbBcuhkLQOSe8E/p92RyAdToS6ZD1tFkX+CkhoECE0dQ==} + engines: {node: ^14.15.0 || ^16.10.0 || >=18.0.0} + + '@jest/fake-timers@29.7.0': + resolution: {integrity: sha512-q4DH1Ha4TTFPdxLsqDXK1d3+ioSL7yL5oCMJZgDYm6i+6CygW5E5xVr/D1HdsGxjt1ZWSfUAs9OxSB/BNelWrQ==} + engines: {node: ^14.15.0 || ^16.10.0 || >=18.0.0} + + '@jest/globals@29.7.0': + resolution: {integrity: sha512-mpiz3dutLbkW2MNFubUGUEVLkTGiqW6yLVTA+JbP6fI6J5iL9Y0Nlg8k95pcF8ctKwCS7WVxteBs29hhfAotzQ==} + engines: {node: ^14.15.0 || ^16.10.0 || >=18.0.0} + + '@jest/reporters@29.7.0': + resolution: {integrity: sha512-DApq0KJbJOEzAFYjHADNNxAE3KbhxQB1y5Kplb5Waqw6zVbuWatSnMjE5gs8FUgEPmNsnZA3NCWl9NG0ia04Pg==} + engines: {node: ^14.15.0 || ^16.10.0 || >=18.0.0} + peerDependencies: + node-notifier: ^8.0.1 || ^9.0.0 || ^10.0.0 + peerDependenciesMeta: + node-notifier: + optional: true + + '@jest/schemas@29.6.3': + resolution: {integrity: sha512-mo5j5X+jIZmJQveBKeS/clAueipV7KgiX1vMgCxam1RNYiqE1w62n0/tJJnHtjW8ZHcQco5gY85jA3mi0L+nSA==} + engines: {node: ^14.15.0 || ^16.10.0 || >=18.0.0} + + '@jest/source-map@29.6.3': + resolution: {integrity: sha512-MHjT95QuipcPrpLM+8JMSzFx6eHp5Bm+4XeFDJlwsvVBjmKNiIAvasGK2fxz2WbGRlnvqehFbh07MMa7n3YJnw==} + engines: {node: ^14.15.0 || ^16.10.0 || >=18.0.0} + + '@jest/test-result@29.7.0': + resolution: {integrity: sha512-Fdx+tv6x1zlkJPcWXmMDAG2HBnaR9XPSd5aDWQVsfrZmLVT3lU1cwyxLgRmXR9yrq4NBoEm9BMsfgFzTQAbJYA==} + engines: {node: ^14.15.0 || ^16.10.0 || >=18.0.0} + + '@jest/test-sequencer@29.7.0': + resolution: {integrity: sha512-GQwJ5WZVrKnOJuiYiAF52UNUJXgTZx1NHjFSEB0qEMmSZKAkdMoIzw/Cj6x6NF4AvV23AUqDpFzQkN/eYCYTxw==} + engines: {node: ^14.15.0 || ^16.10.0 || >=18.0.0} + + '@jest/transform@29.7.0': + resolution: {integrity: sha512-ok/BTPFzFKVMwO5eOHRrvnBVHdRy9IrsrW1GpMaQ9MCnilNLXQKmAX8s1YXDFaai9xJpac2ySzV0YeRRECr2Vw==} + engines: {node: ^14.15.0 || ^16.10.0 || >=18.0.0} + + '@jest/types@29.6.3': + resolution: {integrity: sha512-u3UPsIilWKOM3F9CXtrG8LEJmNxwoCQC/XVj4IKYXvvpx7QIi/Kg1LI5uDmDpKlac62NUtX7eLjRh+jVZcLOzw==} + engines: {node: ^14.15.0 || ^16.10.0 || >=18.0.0} + + '@jridgewell/gen-mapping@0.3.5': + resolution: {integrity: sha512-IzL8ZoEDIBRWEzlCcRhOaCupYyN5gdIK+Q6fbFdPDg6HqX6jpkItn7DFIpW9LQzXG6Df9sA7+OKnq0qlz/GaQg==} + engines: {node: '>=6.0.0'} + + '@jridgewell/resolve-uri@3.1.2': + resolution: {integrity: sha512-bRISgCIjP20/tbWSPWMEi54QVPRZExkuD9lJL+UIxUKtwVJA8wW1Trb1jMs1RFXo1CBTNZ/5hpC9QvmKWdopKw==} + engines: {node: '>=6.0.0'} + + '@jridgewell/set-array@1.2.1': + resolution: {integrity: sha512-R8gLRTZeyp03ymzP/6Lil/28tGeGEzhx1q2k703KGWRAI1VdvPIXdG70VJc2pAMw3NA6JKL5hhFu1sJX0Mnn/A==} + engines: {node: '>=6.0.0'} + + '@jridgewell/sourcemap-codec@1.5.0': + resolution: {integrity: sha512-gv3ZRaISU3fjPAgNsriBRqGWQL6quFx04YMPW/zD8XMLsU32mhCCbfbO6KZFLjvYpCZ8zyDEgqsgf+PwPaM7GQ==} + + '@jridgewell/trace-mapping@0.3.25': + resolution: {integrity: sha512-vNk6aEwybGtawWmy/PzwnGDOjCkLWSD2wqvjGGAgOAwCGWySYXfYoxt00IJkTF+8Lb57DwOb3Aa0o9CApepiYQ==} + + '@jridgewell/trace-mapping@0.3.9': + resolution: {integrity: sha512-3Belt6tdc8bPgAtbcmdtNJlirVoTmEb5e2gC94PnkwEW9jI6CAHUeoG85tjWP5WquqfavoMtMwiG4P926ZKKuQ==} + + '@lezer/common@1.2.3': + resolution: {integrity: sha512-w7ojc8ejBqr2REPsWxJjrMFsA/ysDCFICn8zEOR9mrqzOu2amhITYuLD8ag6XZf0CFXDrhKqw7+tW8cX66NaDA==} + + '@lezer/cpp@1.1.2': + resolution: {integrity: sha512-macwKtyeUO0EW86r3xWQCzOV9/CF8imJLpJlPv3sDY57cPGeUZ8gXWOWNlJr52TVByMV3PayFQCA5SHEERDmVQ==} + + '@lezer/go@1.0.0': + resolution: {integrity: sha512-co9JfT3QqX1YkrMmourYw2Z8meGC50Ko4d54QEcQbEYpvdUvN4yb0NBZdn/9ertgvjsySxHsKzH3lbm3vqJ4Jw==} + + '@lezer/highlight@1.2.1': + resolution: {integrity: sha512-Z5duk4RN/3zuVO7Jq0pGLJ3qynpxUVsh7IbUbGj88+uV2ApSAn6kWg2au3iJb+0Zi7kKtqffIESgNcRXWZWmSA==} + + '@lezer/java@1.1.3': + resolution: {integrity: sha512-yHquUfujwg6Yu4Fd1GNHCvidIvJwi/1Xu2DaKl/pfWIA2c1oXkVvawH3NyXhCaFx4OdlYBVX5wvz2f7Aoa/4Xw==} + + '@lezer/javascript@1.4.19': + resolution: {integrity: sha512-j44kbR1QL26l6dMunZ1uhKBFteVGLVCBGNUD2sUaMnic+rbTviVuoK0CD1l9FTW31EueWvFFswCKMH7Z+M3JRA==} + + '@lezer/lr@1.4.2': + resolution: {integrity: sha512-pu0K1jCIdnQ12aWNaAVU5bzi7Bd1w54J3ECgANPmYLtQKP0HBj2cE/5coBD66MT10xbtIuUr7tg0Shbsvk0mDA==} + + '@lezer/python@1.1.14': + resolution: {integrity: sha512-ykDOb2Ti24n76PJsSa4ZoDF0zH12BSw1LGfQXCYJhJyOGiFTfGaX0Du66Ze72R+u/P35U+O6I9m8TFXov1JzsA==} + + '@msgpack/msgpack@2.8.0': + resolution: {integrity: sha512-h9u4u/jiIRKbq25PM+zymTyW6bhTzELvOoUd+AvYriWOAKpLGnIamaET3pnHYoI5iYphAHBI4ayx0MehR+VVPQ==} + engines: {node: '>= 10'} + + '@next/env@14.2.13': + resolution: {integrity: sha512-s3lh6K8cbW1h5Nga7NNeXrbe0+2jIIYK9YaA9T7IufDWnZpozdFUp6Hf0d5rNWUKu4fEuSX2rCKlGjCrtylfDw==} + + '@next/eslint-plugin-next@14.2.13': + resolution: {integrity: sha512-z8Mk0VljxhIzsSiZUSdt3wp+t2lKd+jk5a9Jsvh3zDGkItgDMfjv/ZbET6HsxEl/fSihVoHGsXV6VLyDH0lfTQ==} + + '@next/swc-darwin-arm64@14.2.13': + resolution: {integrity: sha512-IkAmQEa2Htq+wHACBxOsslt+jMoV3msvxCn0WFSfJSkv/scy+i/EukBKNad36grRxywaXUYJc9mxEGkeIs8Bzg==} + engines: {node: '>= 10'} + cpu: [arm64] + os: [darwin] + + '@next/swc-darwin-x64@14.2.13': + resolution: {integrity: sha512-Dv1RBGs2TTjkwEnFMVL5XIfJEavnLqqwYSD6LXgTPdEy/u6FlSrLBSSfe1pcfqhFEXRAgVL3Wpjibe5wXJzWog==} + engines: {node: '>= 10'} + cpu: [x64] + os: [darwin] + + '@next/swc-linux-arm64-gnu@14.2.13': + resolution: {integrity: sha512-yB1tYEFFqo4ZNWkwrJultbsw7NPAAxlPXURXioRl9SdW6aIefOLS+0TEsKrWBtbJ9moTDgU3HRILL6QBQnMevg==} + engines: {node: '>= 10'} + cpu: [arm64] + os: [linux] + + '@next/swc-linux-arm64-musl@14.2.13': + resolution: {integrity: sha512-v5jZ/FV/eHGoWhMKYrsAweQ7CWb8xsWGM/8m1mwwZQ/sutJjoFaXchwK4pX8NqwImILEvQmZWyb8pPTcP7htWg==} + engines: {node: '>= 10'} + cpu: [arm64] + os: [linux] + + '@next/swc-linux-x64-gnu@14.2.13': + resolution: {integrity: sha512-aVc7m4YL7ViiRv7SOXK3RplXzOEe/qQzRA5R2vpXboHABs3w8vtFslGTz+5tKiQzWUmTmBNVW0UQdhkKRORmGA==} + engines: {node: '>= 10'} + cpu: [x64] + os: [linux] + + '@next/swc-linux-x64-musl@14.2.13': + resolution: {integrity: sha512-4wWY7/OsSaJOOKvMsu1Teylku7vKyTuocvDLTZQq0TYv9OjiYYWt63PiE1nTuZnqQ4RPvME7Xai+9enoiN0Wrg==} + engines: {node: '>= 10'} + cpu: [x64] + os: [linux] + + '@next/swc-win32-arm64-msvc@14.2.13': + resolution: {integrity: sha512-uP1XkqCqV2NVH9+g2sC7qIw+w2tRbcMiXFEbMihkQ8B1+V6m28sshBwAB0SDmOe0u44ne1vFU66+gx/28RsBVQ==} + engines: {node: '>= 10'} + cpu: [arm64] + os: [win32] + + '@next/swc-win32-ia32-msvc@14.2.13': + resolution: {integrity: sha512-V26ezyjPqQpDBV4lcWIh8B/QICQ4v+M5Bo9ykLN+sqeKKBxJVDpEc6biDVyluTXTC40f5IqCU0ttth7Es2ZuMw==} + engines: {node: '>= 10'} + cpu: [ia32] + os: [win32] + + '@next/swc-win32-x64-msvc@14.2.13': + resolution: {integrity: sha512-WwzOEAFBGhlDHE5Z73mNU8CO8mqMNLqaG+AO9ETmzdCQlJhVtWZnOl2+rqgVQS+YHunjOWptdFmNfbpwcUuEsw==} + engines: {node: '>= 10'} + cpu: [x64] + os: [win32] + + '@nodelib/fs.scandir@2.1.5': + resolution: {integrity: sha512-vq24Bq3ym5HEQm2NKCr3yXDwjc7vTsEThRDnkp2DK9p1uqLR+DHurm/NOTo0KG7HYHU7eppKZj3MyqYuMBf62g==} + engines: {node: '>= 8'} + + '@nodelib/fs.stat@2.0.5': + resolution: {integrity: sha512-RkhPPp2zrqDAQA/2jNhnztcPAlv64XdhIp7a7454A5ovI7Bukxgt7MX7udwAu3zg1DcpPU0rz3VV1SeaqvY4+A==} + engines: {node: '>= 8'} + + '@nodelib/fs.walk@1.2.8': + resolution: {integrity: sha512-oGB+UxlgWcgQkgwo8GcEGwemoTFt3FIO9ababBmaGwXIoBKZ+GTy0pP185beGg7Llih/NSHSV2XAs1lnznocSg==} + engines: {node: '>= 8'} + + '@nolyfill/is-core-module@1.0.39': + resolution: {integrity: sha512-nn5ozdjYQpUCZlWGuxcJY/KpxkWQs4DcbMCmKojjyrYDEAGy4Ce19NN4v5MduafTwJlbKc99UA8YhSVqq9yPZA==} + engines: {node: '>=12.4.0'} + + '@pkgjs/parseargs@0.11.0': + resolution: {integrity: sha512-+1VkjdD0QBLPodGrJUeqarH8VAIvQODIbwh9XpP5Syisf7YoQgsJKPNFoqqLQlu+VQ/tVSshMR6loPMn8U+dPg==} + engines: {node: '>=14'} + + '@rc-component/async-validator@5.0.4': + resolution: {integrity: sha512-qgGdcVIF604M9EqjNF0hbUTz42bz/RDtxWdWuU5EQe3hi7M8ob54B6B35rOsvX5eSvIHIzT9iH1R3n+hk3CGfg==} + engines: {node: '>=14.x'} + + '@rc-component/color-picker@2.0.1': + resolution: {integrity: sha512-WcZYwAThV/b2GISQ8F+7650r5ZZJ043E57aVBFkQ+kSY4C6wdofXgB0hBx+GPGpIU0Z81eETNoDUJMr7oy/P8Q==} + peerDependencies: + react: '>=16.9.0' + react-dom: '>=16.9.0' + + '@rc-component/context@1.4.0': + resolution: {integrity: sha512-kFcNxg9oLRMoL3qki0OMxK+7g5mypjgaaJp/pkOis/6rVxma9nJBF/8kCIuTYHUQNr0ii7MxqE33wirPZLJQ2w==} + peerDependencies: + react: '>=16.9.0' + react-dom: '>=16.9.0' + + '@rc-component/mini-decimal@1.1.0': + resolution: {integrity: sha512-jS4E7T9Li2GuYwI6PyiVXmxTiM6b07rlD9Ge8uGZSCz3WlzcG5ZK7g5bbuKNeZ9pgUuPK/5guV781ujdVpm4HQ==} + engines: {node: '>=8.x'} + + '@rc-component/mutate-observer@1.1.0': + resolution: {integrity: sha512-QjrOsDXQusNwGZPf4/qRQasg7UFEj06XiCJ8iuiq/Io7CrHrgVi6Uuetw60WAMG1799v+aM8kyc+1L/GBbHSlw==} + engines: {node: '>=8.x'} + peerDependencies: + react: '>=16.9.0' + react-dom: '>=16.9.0' + + '@rc-component/portal@1.1.2': + resolution: {integrity: sha512-6f813C0IsasTZms08kfA8kPAGxbbkYToa8ALaiDIGGECU4i9hj8Plgbx0sNJDrey3EtHO30hmdaxtT0138xZcg==} + engines: {node: '>=8.x'} + peerDependencies: + react: '>=16.9.0' + react-dom: '>=16.9.0' + + '@rc-component/qrcode@1.0.0': + resolution: {integrity: sha512-L+rZ4HXP2sJ1gHMGHjsg9jlYBX/SLN2D6OxP9Zn3qgtpMWtO2vUfxVFwiogHpAIqs54FnALxraUy/BCO1yRIgg==} + engines: {node: '>=8.x'} + peerDependencies: + react: '>=16.9.0' + react-dom: '>=16.9.0' + + '@rc-component/tour@1.15.1': + resolution: {integrity: sha512-Tr2t7J1DKZUpfJuDZWHxyxWpfmj8EZrqSgyMZ+BCdvKZ6r1UDsfU46M/iWAAFBy961Ssfom2kv5f3UcjIL2CmQ==} + engines: {node: '>=8.x'} + peerDependencies: + react: '>=16.9.0' + react-dom: '>=16.9.0' + + '@rc-component/trigger@2.2.3': + resolution: {integrity: sha512-X1oFIpKoXAMXNDYCviOmTfuNuYxE4h5laBsyCqVAVMjNHxoF3/uiyA7XdegK1XbCvBbCZ6P6byWrEoDRpKL8+A==} + engines: {node: '>=8.x'} + peerDependencies: + react: '>=16.9.0' + react-dom: '>=16.9.0' + + '@rtsao/scc@1.1.0': + resolution: {integrity: sha512-zt6OdqaDoOnJ1ZYsCYGt9YmWzDXl4vQdKTyJev62gFhRGKdx7mcT54V9KIjg+d2wi9EXsPvAPKe7i7WjfVWB8g==} + + '@rushstack/eslint-patch@1.10.4': + resolution: {integrity: sha512-WJgX9nzTqknM393q1QJDJmoW28kUfEnybeTfVNcNAPnIx210RXm2DiXiHzfNPJNIUUb1tJnz/l4QGtJ30PgWmA==} + + '@sinclair/typebox@0.27.8': + resolution: {integrity: sha512-+Fj43pSMwJs4KRrH/938Uf+uAELIgVBmQzg/q1YG10djyfA3TnrU8N8XzqCh/okZdszqBQTZf96idMfE5lnwTA==} + + '@sinonjs/commons@3.0.1': + resolution: {integrity: sha512-K3mCHKQ9sVh8o1C9cxkwxaOmXoAMlDxC1mYyHrjqOWEcBjYr76t96zL2zlj5dUGZ3HSw240X1qgH3Mjf1yJWpQ==} + + '@sinonjs/fake-timers@10.3.0': + resolution: {integrity: sha512-V4BG07kuYSUkTCSBHG8G8TNhM+F19jXFWnQtzj+we8DrkpSBCee9Z3Ms8yiGer/dlmhe35/Xdgyo3/0rQKg7YA==} + + '@swc/counter@0.1.3': + resolution: {integrity: sha512-e2BR4lsJkkRlKZ/qCHPw9ZaSxc0MVUd7gtbtaB7aMvHeJVYe8sOB8DBZkP2DtISHGSku9sCK6T6cnY0CtXrOCQ==} + + '@swc/helpers@0.5.5': + resolution: {integrity: sha512-KGYxvIOXcceOAbEk4bi/dVLEK9z8sZ0uBB3Il5b1rhfClSpcX0yfRO0KmTkqR2cnQDymwLB+25ZyMzICg/cm/A==} + + '@testing-library/dom@10.4.0': + resolution: {integrity: sha512-pemlzrSESWbdAloYml3bAJMEfNh1Z7EduzqPKprCH5S341frlpYnUEW0H72dLxa6IsYr+mPno20GiSm+h9dEdQ==} + engines: {node: '>=18'} + + '@testing-library/jest-dom@6.6.3': + resolution: {integrity: sha512-IteBhl4XqYNkM54f4ejhLRJiZNqcSCoXUOG2CPK7qbD322KjQozM4kHQOfkG2oln9b9HTYqs+Sae8vBATubxxA==} + engines: {node: '>=14', npm: '>=6', yarn: '>=1'} + + '@testing-library/react@16.0.1': + resolution: {integrity: sha512-dSmwJVtJXmku+iocRhWOUFbrERC76TX2Mnf0ATODz8brzAZrMBbzLwQixlBSanZxR6LddK3eiwpSFZgDET1URg==} + engines: {node: '>=18'} + peerDependencies: + '@testing-library/dom': ^10.0.0 + '@types/react': ^18.0.0 + '@types/react-dom': ^18.0.0 + react: ^18.0.0 + react-dom: ^18.0.0 + peerDependenciesMeta: + '@types/react': + optional: true + '@types/react-dom': + optional: true + + '@tootallnate/once@2.0.0': + resolution: {integrity: sha512-XCuKFP5PS55gnMVu3dty8KPatLqUoy/ZYzDzAGCQ8JNFCkLXzmI7vNHCR+XpbZaMWQK/vQubr7PkYq8g470J/A==} + engines: {node: '>= 10'} + + '@tsconfig/node10@1.0.11': + resolution: {integrity: sha512-DcRjDCujK/kCk/cUe8Xz8ZSpm8mS3mNNpta+jGCA6USEDfktlNvm1+IuZ9eTcDbNk41BHwpHHeW+N1lKCz4zOw==} + + '@tsconfig/node12@1.0.11': + resolution: {integrity: sha512-cqefuRsh12pWyGsIoBKJA9luFu3mRxCA+ORZvA4ktLSzIuCUtWVxGIuXigEwO5/ywWFMZ2QEGKWvkZG1zDMTag==} + + '@tsconfig/node14@1.0.3': + resolution: {integrity: sha512-ysT8mhdixWK6Hw3i1V2AeRqZ5WfXg1G43mqoYlM2nc6388Fq5jcXyr5mRsqViLx/GJYdoL0bfXD8nmF+Zn/Iow==} + + '@tsconfig/node16@1.0.4': + resolution: {integrity: sha512-vxhUy4J8lyeyinH7Azl1pdd43GJhZH/tP2weN8TntQblOY+A0XbT8DJk1/oCPuOOyg/Ja757rG0CgHcWC8OfMA==} + + '@types/aria-query@5.0.4': + resolution: {integrity: sha512-rfT93uj5s0PRL7EzccGMs3brplhcrghnDoV26NqKhCAS1hVo+WdNsPvE/yb6ilfr5hi2MEk6d5EWJTKdxg8jVw==} + + '@types/babel__core@7.20.5': + resolution: {integrity: sha512-qoQprZvz5wQFJwMDqeseRXWv3rqMvhgpbXFfVyWhbx9X47POIA6i/+dXefEmZKoAgOaTdaIgNSMqMIU61yRyzA==} + + '@types/babel__generator@7.6.8': + resolution: {integrity: sha512-ASsj+tpEDsEiFr1arWrlN6V3mdfjRMZt6LtK/Vp/kreFLnr5QH5+DhvD5nINYZXzwJvXeGq+05iUXcAzVrqWtw==} + + '@types/babel__template@7.4.4': + resolution: {integrity: sha512-h/NUaSyG5EyxBIp8YRxo4RMe2/qQgvyowRwVMzhYhBCONbW8PUsg4lkFMrhgZhUe5z3L3MiLDuvyJ/CaPa2A8A==} + + '@types/babel__traverse@7.20.6': + resolution: {integrity: sha512-r1bzfrm0tomOI8g1SzvCaQHo6Lcv6zu0EA+W2kHrt8dyrHQxGzBBL4kdkzIS+jBMV+EYcMAEAqXqYaLJq5rOZg==} + + '@types/chromedriver@81.0.5': + resolution: {integrity: sha512-VwV+WTTFHYZotBn57QQ8gd4TE7CGJ15KPM+xJJrKbiQQSccTY7zVXuConSBlyWrO+AFpVxuzmluK3xvzxGmkCw==} + + '@types/codemirror@5.60.15': + resolution: {integrity: sha512-dTOvwEQ+ouKJ/rE9LT1Ue2hmP6H1mZv5+CCnNWu2qtiOe2LQa9lCprEY20HxiDmV/Bxh+dXjywmy5aKvoGjULA==} + + '@types/estree@1.0.6': + resolution: {integrity: sha512-AYnb1nQyY49te+VRAVgmzfcgjYS91mY5P0TKUDCLEM+gNnA+3T6rWITXRLYCpahpqSQbN5cE+gHpnPyXjHWxcw==} + + '@types/graceful-fs@4.1.9': + resolution: {integrity: sha512-olP3sd1qOEe5dXTSaFvQG+02VdRXcdytWLAZsAq1PecU8uqQAhkrnbli7DagjtXKW/Bl7YJbUsa8MPcuc8LHEQ==} + + '@types/istanbul-lib-coverage@2.0.6': + resolution: {integrity: sha512-2QF/t/auWm0lsy8XtKVPG19v3sSOQlJe/YHZgfjb/KBBHOGSV+J2q/S671rcq9uTBrLAXmZpqJiaQbMT+zNU1w==} + + '@types/istanbul-lib-report@3.0.3': + resolution: {integrity: sha512-NQn7AHQnk/RSLOxrBbGyJM/aVQ+pjj5HCgasFxc0K/KhoATfQ/47AyUl15I2yBUpihjmas+a+VJBOqecrFH+uA==} + + '@types/istanbul-reports@3.0.4': + resolution: {integrity: sha512-pk2B1NWalF9toCRu6gjBzR69syFjP4Od8WRAX+0mmf9lAjCRicLOWc+ZrxZHx/0XRjotgkF9t6iaMJ+aXcOdZQ==} + + '@types/jest@29.5.14': + resolution: {integrity: sha512-ZN+4sdnLUbo8EVvVc2ao0GFW6oVrQRPn4K2lglySj7APvSrgzxHiNNK99us4WDMi57xxA2yggblIAMNhXOotLQ==} + + '@types/jsdom@20.0.1': + resolution: {integrity: sha512-d0r18sZPmMQr1eG35u12FZfhIXNrnsPU/g5wvRKCUf/tOGilKKwYMYGqh33BNR6ba+2gkHw1EUiHoN3mn7E5IQ==} + + '@types/json5@0.0.29': + resolution: {integrity: sha512-dRLjCWHYg4oaA77cxO64oO+7JwCwnIzkZPdrrC71jQmQtlhM556pwKo5bUzqvZndkVbeFLIIi+9TC40JNF5hNQ==} + + '@types/node@20.0.0': + resolution: {integrity: sha512-cD2uPTDnQQCVpmRefonO98/PPijuOnnEy5oytWJFPY1N9aJCz2wJ5kSGWO+zJoed2cY2JxQh6yBuUq4vIn61hw==} + + '@types/peerjs@1.1.0': + resolution: {integrity: sha512-dVocsfYFg5QQuUB9OAxfrSvz4br4pyX+7M61ZJSRiYtE3NdayShk1p1Y8b9TmCj724TwHskVraeF7wyPl0rYcg==} + deprecated: This is a stub types definition. peerjs provides its own type definitions, so you do not need this installed. + + '@types/prop-types@15.7.13': + resolution: {integrity: sha512-hCZTSvwbzWGvhqxp/RqVqwU999pBf2vp7hzIjiYOsl8wqOmUxkQ6ddw1cV3l8811+kdUFus/q4d1Y3E3SyEifA==} + + '@types/react-dom@18.3.0': + resolution: {integrity: sha512-EhwApuTmMBmXuFOikhQLIBUn6uFg81SwLMOAUgodJF14SOBOCMdU04gDoYi0WOJJHD144TL32z4yDqCW3dnkQg==} + + '@types/react@18.3.8': + resolution: {integrity: sha512-syBUrW3/XpnW4WJ41Pft+I+aPoDVbrBVQGEnbD7NijDGlVC+8gV/XKRY+7vMDlfPpbwYt0l1vd/Sj8bJGMbs9Q==} + + '@types/selenium-webdriver@4.1.27': + resolution: {integrity: sha512-ALqsj8D7Swb6MnBQuAQ58J3KC3yh6fLGtAmpBmnZX8j+0kmP7NaLt56CuzBw2W2bXPrvHFTgn8iekOQFUKXEQA==} + + '@types/stack-utils@2.0.3': + resolution: {integrity: sha512-9aEbYZ3TbYMznPdcdr3SmIrLXwC/AKZXQeCf9Pgao5CKb8CyHuEX5jzWPTkvregvhRJHcpRO6BFoGW9ycaOkYw==} + + '@types/tern@0.23.9': + resolution: {integrity: sha512-ypzHFE/wBzh+BlH6rrBgS5I/Z7RD21pGhZ2rltb/+ZrVM1awdZwjx7hE5XfuYgHWk9uvV5HLZN3SloevCAp3Bw==} + + '@types/tough-cookie@4.0.5': + resolution: {integrity: sha512-/Ad8+nIOV7Rl++6f1BdKxFSMgmoqEoYbHRpPcx3JEfv8VRsQe9Z4mCXeJBzxs7mbHY/XOZZuXlRNfhpVPbs6ZA==} + + '@types/ws@8.5.13': + resolution: {integrity: sha512-osM/gWBTPKgHV8XkTunnegTRIsvF6owmf5w+JtAfOw472dptdm0dlGv4xCt6GwQRcC2XVOvvRE/0bAoQcL2QkA==} + + '@types/yargs-parser@21.0.3': + resolution: {integrity: sha512-I4q9QU9MQv4oEOz4tAHJtNz1cwuLxn2F3xcc2iV5WdqLPpUnj30aUuxt1mAxYTG+oe8CZMV/+6rU4S4gRDzqtQ==} + + '@types/yargs@17.0.33': + resolution: {integrity: sha512-WpxBCKWPLr4xSsHgz511rFJAM+wS28w2zEO1QDNY5zM/S8ok70NNfztH0xwhqKyaK0OHCbN98LDAZuy1ctxDkA==} + + '@typescript-eslint/eslint-plugin@8.8.0': + resolution: {integrity: sha512-wORFWjU30B2WJ/aXBfOm1LX9v9nyt9D3jsSOxC3cCaTQGCW5k4jNpmjFv3U7p/7s4yvdjHzwtv2Sd2dOyhjS0A==} + engines: {node: ^18.18.0 || ^20.9.0 || >=21.1.0} + peerDependencies: + '@typescript-eslint/parser': ^8.0.0 || ^8.0.0-alpha.0 + eslint: ^8.57.0 || ^9.0.0 + typescript: '*' + peerDependenciesMeta: + typescript: + optional: true + + '@typescript-eslint/parser@8.8.0': + resolution: {integrity: sha512-uEFUsgR+tl8GmzmLjRqz+VrDv4eoaMqMXW7ruXfgThaAShO9JTciKpEsB+TvnfFfbg5IpujgMXVV36gOJRLtZg==} + engines: {node: ^18.18.0 || ^20.9.0 || >=21.1.0} + peerDependencies: + eslint: ^8.57.0 || ^9.0.0 + typescript: '*' + peerDependenciesMeta: + typescript: + optional: true + + '@typescript-eslint/scope-manager@8.8.0': + resolution: {integrity: sha512-EL8eaGC6gx3jDd8GwEFEV091210U97J0jeEHrAYvIYosmEGet4wJ+g0SYmLu+oRiAwbSA5AVrt6DxLHfdd+bUg==} + engines: {node: ^18.18.0 || ^20.9.0 || >=21.1.0} + + '@typescript-eslint/type-utils@8.8.0': + resolution: {integrity: sha512-IKwJSS7bCqyCeG4NVGxnOP6lLT9Okc3Zj8hLO96bpMkJab+10HIfJbMouLrlpyOr3yrQ1cA413YPFiGd1mW9/Q==} + engines: {node: ^18.18.0 || ^20.9.0 || >=21.1.0} + peerDependencies: + typescript: '*' + peerDependenciesMeta: + typescript: + optional: true + + '@typescript-eslint/types@8.8.0': + resolution: {integrity: sha512-QJwc50hRCgBd/k12sTykOJbESe1RrzmX6COk8Y525C9l7oweZ+1lw9JiU56im7Amm8swlz00DRIlxMYLizr2Vw==} + engines: {node: ^18.18.0 || ^20.9.0 || >=21.1.0} + + '@typescript-eslint/typescript-estree@8.8.0': + resolution: {integrity: sha512-ZaMJwc/0ckLz5DaAZ+pNLmHv8AMVGtfWxZe/x2JVEkD5LnmhWiQMMcYT7IY7gkdJuzJ9P14fRy28lUrlDSWYdw==} + engines: {node: ^18.18.0 || ^20.9.0 || >=21.1.0} + peerDependencies: + typescript: '*' + peerDependenciesMeta: + typescript: + optional: true + + '@typescript-eslint/utils@8.8.0': + resolution: {integrity: sha512-QE2MgfOTem00qrlPgyByaCHay9yb1+9BjnMFnSFkUKQfu7adBXDTnCAivURnuPPAG/qiB+kzKkZKmKfaMT0zVg==} + engines: {node: ^18.18.0 || ^20.9.0 || >=21.1.0} + peerDependencies: + eslint: ^8.57.0 || ^9.0.0 + + '@typescript-eslint/visitor-keys@8.8.0': + resolution: {integrity: sha512-8mq51Lx6Hpmd7HnA2fcHQo3YgfX1qbccxQOgZcb4tvasu//zXRaA1j5ZRFeCw/VRAdFi4mRM9DnZw0Nu0Q2d1g==} + engines: {node: ^18.18.0 || ^20.9.0 || >=21.1.0} + + abab@2.0.6: + resolution: {integrity: sha512-j2afSsaIENvHZN2B8GOpF566vZ5WVk5opAiMTvWgaQT8DkbOqsTfvNAvHoRGU2zzP8cPoqys+xHTRDWW8L+/BA==} + deprecated: Use your platform's native atob() and btoa() methods instead + + acorn-globals@7.0.1: + resolution: {integrity: sha512-umOSDSDrfHbTNPuNpC2NSnnA3LUrqpevPb4T9jRx4MagXNS0rs+gwiTcAvqCRmsD6utzsrzNt+ebm00SNWiC3Q==} + + acorn-jsx@5.3.2: + resolution: {integrity: sha512-rq9s+JNhf0IChjtDXxllJ7g41oZk5SlXtp0LHwyA5cejwn7vKmKp4pPri6YEePv2PU65sAsegbXtIinmDFDXgQ==} + peerDependencies: + acorn: ^6.0.0 || ^7.0.0 || ^8.0.0 + + acorn-walk@8.3.4: + resolution: {integrity: sha512-ueEepnujpqee2o5aIYnvHU6C0A42MNdsIDeqy5BydrkuC5R1ZuUFnm27EeFJGoEHJQgn3uleRvmTXaJgfXbt4g==} + engines: {node: '>=0.4.0'} + + acorn@8.12.1: + resolution: {integrity: sha512-tcpGyI9zbizT9JbV6oYE477V6mTlXvvi0T0G3SNIYE2apm/G5huBa1+K89VGeovbg+jycCrfhl3ADxErOuO6Jg==} + engines: {node: '>=0.4.0'} + hasBin: true + + agent-base@6.0.2: + resolution: {integrity: sha512-RZNwNclF7+MS/8bDg70amg32dyeZGZxiDuQmZxKLAlQjr3jGyLx+4Kkk58UO7D2QdgFIQCovuSuZESne6RG6XQ==} + engines: {node: '>= 6.0.0'} + + ajv@6.12.6: + resolution: {integrity: sha512-j3fVLgvTo527anyYyJOGTYJbG+vnnQYvE0m5mmkc1TK+nxAppkCLMIL0aZ4dblVCNoGShhm+kzE4ZUykBoMg4g==} + + ansi-colors@4.1.3: + resolution: {integrity: sha512-/6w/C21Pm1A7aZitlI5Ni/2J6FFQN8i1Cvz3kHABAAbw93v/NlvKdVOqz7CCWz/3iv/JplRSEEZ83XION15ovw==} + engines: {node: '>=6'} + + ansi-escapes@4.3.2: + resolution: {integrity: sha512-gKXj5ALrKWQLsYG9jlTRmR/xKluxHV+Z9QEwNIgCfM1/uwPMCuzVVnh5mwTd+OuBZcwSIMbqssNWRm1lE51QaQ==} + engines: {node: '>=8'} + + ansi-regex@5.0.1: + resolution: {integrity: sha512-quJQXlTSUGL2LH9SUXo8VwsY4soanhgo6LNSm84E1LBcE8s3O0wpdiRzyR9z/ZZJMlMWv37qOOb9pdJlMUEKFQ==} + engines: {node: '>=8'} + + ansi-regex@6.1.0: + resolution: {integrity: sha512-7HSX4QQb4CspciLpVFwyRe79O3xsIZDDLER21kERQ71oaPodF8jL725AgJMFAYbooIqolJoRLuM81SpeUkpkvA==} + engines: {node: '>=12'} + + ansi-styles@4.3.0: + resolution: {integrity: sha512-zbB9rCJAT1rbjiVDb2hqKFHNYLxgtk8NURxZ3IZwD3F6NtxbXZQCnnSi1Lkx+IDohdPlFp222wVALIheZJQSEg==} + engines: {node: '>=8'} + + ansi-styles@5.2.0: + resolution: {integrity: sha512-Cxwpt2SfTzTtXcfOlzGEee8O+c+MmUgGrNiBcXnuWxuFJHe6a5Hz7qwhwe5OgaSYI0IJvkLqWX1ASG+cJOkEiA==} + engines: {node: '>=10'} + + ansi-styles@6.2.1: + resolution: {integrity: sha512-bN798gFfQX+viw3R7yrGWRqnrN2oRkEkUjjl4JNn4E8GxxbjtG3FbrEIIY3l8/hrwUwIeCZvi4QuOTP4MErVug==} + engines: {node: '>=12'} + + antd@5.20.6: + resolution: {integrity: sha512-TZFmNenHlh26DelHCJbkB+x1OVulIKsN1f/CnAd2NxZLysXqRvSuLUeHcgccqAnxTy7B03GZ6i1tocGxPCNjgA==} + peerDependencies: + react: '>=16.9.0' + react-dom: '>=16.9.0' + + anymatch@3.1.3: + resolution: {integrity: sha512-KMReFUr0B4t+D+OBkjR3KYqvocp2XaSzO55UcB6mgQMd3KbcE+mWTyvVV7D/zsdEbNnV6acZUutkiHQXvTr1Rw==} + engines: {node: '>= 8'} + + arg@4.1.3: + resolution: {integrity: sha512-58S9QDqG0Xx27YwPSt9fJxivjYl432YCwfDMfZ+71RAqUrZef7LrKQZ3LHLOwCS4FLNBplP533Zx895SeOCHvA==} + + argparse@1.0.10: + resolution: {integrity: sha512-o5Roy6tNG4SL/FOkCAN6RzjiakZS25RLYFrcMttJqbdd8BWrnA+fGz57iN5Pb06pvBGvl5gQ0B48dJlslXvoTg==} + + argparse@2.0.1: + resolution: {integrity: sha512-8+9WqebbFzpX9OR+Wa6O29asIogeRMzcGtAINdpMHHyAg10f05aSFVBbcEqGf/PXw1EjAZ+q2/bEBg3DvurK3Q==} + + aria-query@5.1.3: + resolution: {integrity: sha512-R5iJ5lkuHybztUfuOAznmboyjWq8O6sqNqtK7CLOqdydi54VNbORp49mb14KbWgG1QD3JFO9hJdZ+y4KutfdOQ==} + + aria-query@5.3.0: + resolution: {integrity: sha512-b0P0sZPKtyu8HkeRAfCq0IfURZK+SuwMjY1UXGBU27wpAiTwQAIlq56IbIO+ytk/JjS1fMR14ee5WBBfKi5J6A==} + + array-buffer-byte-length@1.0.1: + resolution: {integrity: sha512-ahC5W1xgou+KTXix4sAO8Ki12Q+jf4i0+tmk3sC+zgcynshkHxzpXdImBehiUYKKKDwvfFiJl1tZt6ewscS1Mg==} + engines: {node: '>= 0.4'} + + array-includes@3.1.8: + resolution: {integrity: sha512-itaWrbYbqpGXkGhZPGUulwnhVf5Hpy1xiCFsGqyIGglbBxmG5vSjxQen3/WGOjPpNEv1RtBLKxbmVXm8HpJStQ==} + engines: {node: '>= 0.4'} + + array-tree-filter@2.1.0: + resolution: {integrity: sha512-4ROwICNlNw/Hqa9v+rk5h22KjmzB1JGTMVKP2AKJBOCgb0yL0ASf0+YvCcLNNwquOHNX48jkeZIJ3a+oOQqKcw==} + + array.prototype.findlast@1.2.5: + resolution: {integrity: sha512-CVvd6FHg1Z3POpBLxO6E6zr+rSKEQ9L6rZHAaY7lLfhKsWYUBBOuMs0e9o24oopj6H+geRCX0YJ+TJLBK2eHyQ==} + engines: {node: '>= 0.4'} + + array.prototype.findlastindex@1.2.5: + resolution: {integrity: sha512-zfETvRFA8o7EiNn++N5f/kaCw221hrpGsDmcpndVupkPzEc1Wuf3VgC0qby1BbHs7f5DVYjgtEU2LLh5bqeGfQ==} + engines: {node: '>= 0.4'} + + array.prototype.flat@1.3.2: + resolution: {integrity: sha512-djYB+Zx2vLewY8RWlNCUdHjDXs2XOgm602S9E7P/UpHgfeHL00cRiIF+IN/G/aUJ7kGPb6yO/ErDI5V2s8iycA==} + engines: {node: '>= 0.4'} + + array.prototype.flatmap@1.3.2: + resolution: {integrity: sha512-Ewyx0c9PmpcsByhSW4r+9zDU7sGjFc86qf/kKtuSCRdhfbk0SNLLkaT5qvcHnRGgc5NP/ly/y+qkXkqONX54CQ==} + engines: {node: '>= 0.4'} + + array.prototype.tosorted@1.1.4: + resolution: {integrity: sha512-p6Fx8B7b7ZhL/gmUsAy0D15WhvDccw3mnGNbZpi3pmeJdxtWsj2jEaI4Y6oo3XiHfzuSgPwKc04MYt6KgvC/wA==} + engines: {node: '>= 0.4'} + + arraybuffer.prototype.slice@1.0.3: + resolution: {integrity: sha512-bMxMKAjg13EBSVscxTaYA4mRc5t1UAXa2kXiGTNfZ079HIWXEkKmkgFrh/nJqamaLSrXO5H4WFFkPEaLJWbs3A==} + engines: {node: '>= 0.4'} + + ast-types-flow@0.0.8: + resolution: {integrity: sha512-OH/2E5Fg20h2aPrbe+QL8JZQFko0YZaF+j4mnQ7BGhfavO7OpSLa8a0y9sBwomHdSbkhTS8TQNayBfnW5DwbvQ==} + + asynckit@0.4.0: + resolution: {integrity: sha512-Oei9OH4tRh0YqU3GxhX79dM/mwVgvbZJaSNaRk+bshkj0S5cfHcgYakreBjrHwatXKbz+IoIdYLxrKim2MjW0Q==} + + available-typed-arrays@1.0.7: + resolution: {integrity: sha512-wvUjBtSGN7+7SjNpq/9M2Tg350UZD3q62IFZLbRAR1bSMlCo1ZaeW+BJ+D090e4hIIZLBcTDWe4Mh4jvUDajzQ==} + engines: {node: '>= 0.4'} + + axe-core@4.10.0: + resolution: {integrity: sha512-Mr2ZakwQ7XUAjp7pAwQWRhhK8mQQ6JAaNWSjmjxil0R8BPioMtQsTLOolGYkji1rcL++3dCqZA3zWqpT+9Ew6g==} + engines: {node: '>=4'} + + axobject-query@4.1.0: + resolution: {integrity: sha512-qIj0G9wZbMGNLjLmg1PT6v2mE9AH2zlnADJD/2tC6E00hgmhUOfEB6greHPAfLRSufHqROIUTkw6E+M3lH0PTQ==} + engines: {node: '>= 0.4'} + + babel-jest@29.7.0: + resolution: {integrity: sha512-BrvGY3xZSwEcCzKvKsCi2GgHqDqsYkOP4/by5xCgIwGXQxIEh+8ew3gmrE1y7XRR6LHZIj6yLYnUi/mm2KXKBg==} + engines: {node: ^14.15.0 || ^16.10.0 || >=18.0.0} + peerDependencies: + '@babel/core': ^7.8.0 + + babel-plugin-istanbul@6.1.1: + resolution: {integrity: sha512-Y1IQok9821cC9onCx5otgFfRm7Lm+I+wwxOx738M/WLPZ9Q42m4IG5W0FNX8WLL2gYMZo3JkuXIH2DOpWM+qwA==} + engines: {node: '>=8'} + + babel-plugin-jest-hoist@29.6.3: + resolution: {integrity: sha512-ESAc/RJvGTFEzRwOTT4+lNDk/GNHMkKbNzsvT0qKRfDyyYTskxB5rnU2njIDYVxXCBHHEI1c0YwHob3WaYujOg==} + engines: {node: ^14.15.0 || ^16.10.0 || >=18.0.0} + + babel-preset-current-node-syntax@1.1.0: + resolution: {integrity: sha512-ldYss8SbBlWva1bs28q78Ju5Zq1F+8BrqBZZ0VFhLBvhh6lCpC2o3gDJi/5DRLs9FgYZCnmPYIVFU4lRXCkyUw==} + peerDependencies: + '@babel/core': ^7.0.0 + + babel-preset-jest@29.6.3: + resolution: {integrity: sha512-0B3bhxR6snWXJZtR/RliHTDPRgn1sNHOR0yVtq/IiQFyuOVjFS+wuio/R4gSNkyYmKmJB4wGZv2NZanmKmTnNA==} + engines: {node: ^14.15.0 || ^16.10.0 || >=18.0.0} + peerDependencies: + '@babel/core': ^7.0.0 + + balanced-match@1.0.2: + resolution: {integrity: sha512-3oSeUO0TMV67hN1AmbXsK4yaqU7tjiHlbxRDZOpH0KW9+CeX4bRAaX0Anxt0tx2MrpRpWwQaPwIlISEJhYU5Pw==} + + base64-js@1.5.1: + resolution: {integrity: sha512-AKpaYlHn8t4SVbOHCy+b5+KKgvR4vrsD8vbvrbiQJps7fKDTkjkDry6ji0rUJjC0kzbNePLwzxq8iypo41qeWA==} + + brace-expansion@1.1.11: + resolution: {integrity: sha512-iCuPHDFgrHX7H2vEI/5xpz07zSHB00TpugqhmYtVmMO6518mCuRMoOYFldEBl0g187ufozdaHgWKcYFb61qGiA==} + + brace-expansion@2.0.1: + resolution: {integrity: sha512-XnAIvQ8eM+kC6aULx6wuQiwVsnzsi9d3WxzV3FpWTGA19F621kwdbsAcFKXgKUHZWsy+mY6iL1sHTxWEFCytDA==} + + braces@3.0.3: + resolution: {integrity: sha512-yQbXgO/OSZVD2IsiLlro+7Hf6Q18EJrKSEsdoMzKePKXct3gvD8oLcOQdIzGupr5Fj+EDe8gO/lxc1BzfMpxvA==} + engines: {node: '>=8'} + + browserslist@4.24.2: + resolution: {integrity: sha512-ZIc+Q62revdMcqC6aChtW4jz3My3klmCO1fEmINZY/8J3EpBg5/A/D0AKmBveUh6pgoeycoMkVMko84tuYS+Gg==} + engines: {node: ^6 || ^7 || ^8 || ^9 || ^10 || ^11 || ^12 || >=13.7} + hasBin: true + + bser@2.1.1: + resolution: {integrity: sha512-gQxTNE/GAfIIrmHLUE3oJyp5FO6HRBfhjnw4/wMmA63ZGDJnWBmgY/lyQBpnDUkGmAhbSe39tx2d/iTOAfglwQ==} + + buffer-from@1.1.2: + resolution: {integrity: sha512-E+XQCRwSbaaiChtv6k6Dwgc+bx+Bs6vuKJHHl5kox/BaKbhiXzqQOwK4cO22yElGp2OCmjwVhT3HmxgyPGnJfQ==} + + buffer@6.0.3: + resolution: {integrity: sha512-FTiCpNxtwiZZHEZbcbTIcZjERVICn9yq/pDFkTl95/AxzD1naBctN7YO68riM/gLSDY7sdrMby8hofADYuuqOA==} + + busboy@1.6.0: + resolution: {integrity: sha512-8SFQbg/0hQ9xy3UNTB0YEnsNBbWfhf7RtnzpL7TkBiTBRfrQ9Fxcnz7VJsleJpyp6rVLvXiuORqjlHi5q+PYuA==} + engines: {node: '>=10.16.0'} + + call-bind@1.0.7: + resolution: {integrity: sha512-GHTSNSYICQ7scH7sZ+M2rFopRoLh8t2bLSW6BbgrtLsahOIB5iyAVJf9GjWK3cYTDaMj4XdBpM1cA6pIS0Kv2w==} + engines: {node: '>= 0.4'} + + callsites@3.1.0: + resolution: {integrity: sha512-P8BjAsXvZS+VIDUI11hHCQEv74YT67YUi5JJFNWIqL235sBmjX4+qx9Muvls5ivyNENctx46xQLQ3aTuE7ssaQ==} + engines: {node: '>=6'} + + camelcase@5.3.1: + resolution: {integrity: sha512-L28STB170nwWS63UjtlEOE3dldQApaJXZkOI1uMFfzf3rRuPegHaHesyee+YxQ+W6SvRDQV6UrdOdRiR153wJg==} + engines: {node: '>=6'} + + camelcase@6.3.0: + resolution: {integrity: sha512-Gmy6FhYlCY7uOElZUSbxo2UCDH8owEk996gkbrpsgGtrJLM3J7jGxl9Ic7Qwwj4ivOE5AWZWRMecDdF7hqGjFA==} + engines: {node: '>=10'} + + caniuse-lite@1.0.30001666: + resolution: {integrity: sha512-gD14ICmoV5ZZM1OdzPWmpx+q4GyefaK06zi8hmfHV5xe4/2nOQX3+Dw5o+fSqOws2xVwL9j+anOPFwHzdEdV4g==} + + caniuse-lite@1.0.30001677: + resolution: {integrity: sha512-fmfjsOlJUpMWu+mAAtZZZHz7UEwsUxIIvu1TJfO1HqFQvB/B+ii0xr9B5HpbZY/mC4XZ8SvjHJqtAY6pDPQEog==} + + chalk@3.0.0: + resolution: {integrity: sha512-4D3B6Wf41KOYRFdszmDqMCGq5VV/uMAB273JILmO+3jAlh8X4qDtdtgCR3fxtbLEMzSx22QdhnDcJvu2u1fVwg==} + engines: {node: '>=8'} + + chalk@4.1.2: + resolution: {integrity: sha512-oKnbhFyRIXpUuez8iBMmyEa4nbj4IOQyuhc/wy9kY7/WVPcwIO9VA668Pu8RkO7+0G76SLROeyw9CpQ061i4mA==} + engines: {node: '>=10'} + + char-regex@1.0.2: + resolution: {integrity: sha512-kWWXztvZ5SBQV+eRgKFeh8q5sLuZY2+8WUIzlxWVTg+oGwY14qylx1KbKzHd8P6ZYkAg0xyIDU9JMHhyJMZ1jw==} + engines: {node: '>=10'} + + chokidar@4.0.1: + resolution: {integrity: sha512-n8enUVCED/KVRQlab1hr3MVpcVMvxtZjmEa956u+4YijlmQED223XMSYj2tLuKvr4jcCTzNNMpQDUer72MMmzA==} + engines: {node: '>= 14.16.0'} + + ci-info@3.9.0: + resolution: {integrity: sha512-NIxF55hv4nSqQswkAeiOi1r83xy8JldOFDTWiug55KBu9Jnblncd2U6ViHmYgHf01TPZS77NJBhBMKdWj9HQMQ==} + engines: {node: '>=8'} + + cjs-module-lexer@1.4.1: + resolution: {integrity: sha512-cuSVIHi9/9E/+821Qjdvngor+xpnlwnuwIyZOaLmHBVdXL+gP+I6QQB9VkO7RI77YIcTV+S1W9AreJ5eN63JBA==} + + classnames@2.5.1: + resolution: {integrity: sha512-saHYOzhIQs6wy2sVxTM6bUDsQO4F50V9RQ22qBpEdCW+I+/Wmke2HOl6lS6dTpdxVhb88/I6+Hs+438c3lfUow==} + + client-only@0.0.1: + resolution: {integrity: sha512-IV3Ou0jSMzZrd3pZ48nLkT9DA7Ag1pnPzaiQhpW7c3RbcqqzvzzVu+L8gfqMp/8IM2MQtSiqaCxrrcfu8I8rMA==} + + cliui@8.0.1: + resolution: {integrity: sha512-BSeNnyus75C4//NQ9gQt1/csTXyo/8Sb+afLAkzAptFuMsod9HFokGNudZpi/oQV73hnVK+sR+5PVRMd+Dr7YQ==} + engines: {node: '>=12'} + + co@4.6.0: + resolution: {integrity: sha512-QVb0dM5HvG+uaxitm8wONl7jltx8dqhfU33DcqtOZcLSVIKSDDLDi7+0LbAKiyI8hD9u42m2YxXSkMGWThaecQ==} + engines: {iojs: '>= 1.0.0', node: '>= 0.12.0'} + + codemirror@6.0.1: + resolution: {integrity: sha512-J8j+nZ+CdWmIeFIGXEFbFPtpiYacFMDR8GlHK3IyHQJMCaVRfGx9NT+Hxivv1ckLWPvNdZqndbr/7lVhrf/Svg==} + + collect-v8-coverage@1.0.2: + resolution: {integrity: sha512-lHl4d5/ONEbLlJvaJNtsF/Lz+WvB07u2ycqTYbdrq7UypDXailES4valYb2eWiJFxZlVmpGekfqoxQhzyFdT4Q==} + + color-convert@2.0.1: + resolution: {integrity: sha512-RRECPsj7iu/xb5oKYcsFHSppFNnsj/52OVTRKb4zP5onXwVF3zVmmToNcOfGC+CRDpfK/U584fMg38ZHCaElKQ==} + engines: {node: '>=7.0.0'} + + color-name@1.1.4: + resolution: {integrity: sha512-dOy+3AuW3a2wNbZHIuMZpTcgjGuLU/uBL/ubcZF9OXbDo8ff4O8yVp5Bf0efS8uEoYo5q4Fx7dY9OgQGXgAsQA==} + + combined-stream@1.0.8: + resolution: {integrity: sha512-FQN4MRfuJeHf7cBbBMJFXhKSDq+2kAArBlmRBvcvFE5BB1HZKXtSFASDhdlz9zOYwxh8lDdnvmMOe/+5cdoEdg==} + engines: {node: '>= 0.8'} + + compute-scroll-into-view@3.1.0: + resolution: {integrity: sha512-rj8l8pD4bJ1nx+dAkMhV1xB5RuZEyVysfxJqB1pRchh1KVvwOv9b7CGB8ZfjTImVv2oF+sYMUkMZq6Na5Ftmbg==} + + concat-map@0.0.1: + resolution: {integrity: sha512-/Srv4dswyQNBfohGpz9o6Yb3Gz3SrUDqBH5rTuhGR7ahtlbYKnVxw2bCFMRljaA7EXHaXZ8wsHdodFvbkhKmqg==} + + convert-source-map@2.0.0: + resolution: {integrity: sha512-Kvp459HrV2FEJ1CAsi1Ku+MY3kasH19TFykTz2xWmMeq6bk2NU3XXvfJ+Q61m0xktWwt+1HSYf3JZsTms3aRJg==} + + copy-to-clipboard@3.3.3: + resolution: {integrity: sha512-2KV8NhB5JqC3ky0r9PMCAZKbUHSwtEo4CwCs0KXgruG43gX5PMqDEBbVU4OUzw2MuAWUfsuFmWvEKG5QRfSnJA==} + + core-util-is@1.0.3: + resolution: {integrity: sha512-ZQBvi1DcpJ4GDqanjucZ2Hj3wEO5pZDS89BWbkcrvdxksJorwUDDZamX9ldFkp9aw2lmBDLgkObEA4DWNJ9FYQ==} + + create-jest@29.7.0: + resolution: {integrity: sha512-Adz2bdH0Vq3F53KEMJOoftQFutWCukm6J24wbPWRO4k1kMY7gS7ds/uoJkNuV8wDCtWWnuwGcJwpWcih+zEW1Q==} + engines: {node: ^14.15.0 || ^16.10.0 || >=18.0.0} + hasBin: true + + create-require@1.1.1: + resolution: {integrity: sha512-dcKFX3jn0MpIaXjisoRvexIJVEKzaq7z2rZKxf+MSr9TkdmHmsU4m2lcLojrj/FHl8mk5VxMmYA+ftRkP/3oKQ==} + + crelt@1.0.6: + resolution: {integrity: sha512-VQ2MBenTq1fWZUH9DJNGti7kKv6EeAuYr3cLwxUWhIu1baTaXh4Ib5W2CqHVqib4/MqbYGJqiL3Zb8GJZr3l4g==} + + cross-spawn@7.0.3: + resolution: {integrity: sha512-iRDPJKUPVEND7dHPO8rkbOnPpyDygcDFtWjpeWNCgy8WP2rXcxXL8TskReQl6OrB2G7+UJrags1q15Fudc7G6w==} + engines: {node: '>= 8'} + + css.escape@1.5.1: + resolution: {integrity: sha512-YUifsXXuknHlUsmlgyY0PKzgPOr7/FjCePfHNt0jxm83wHZi44VDMQ7/fGNkjY3/jV1MC+1CmZbaHzugyeRtpg==} + + cssom@0.3.8: + resolution: {integrity: sha512-b0tGHbfegbhPJpxpiBPU2sCkigAqtM9O121le6bbOlgyV+NyGyCmVfJ6QW9eRjz8CpNfWEOYBIMIGRYkLwsIYg==} + + cssom@0.5.0: + resolution: {integrity: sha512-iKuQcq+NdHqlAcwUY0o/HL69XQrUaQdMjmStJ8JFmUaiiQErlhrmuigkg/CU4E2J0IyUKUrMAgl36TvN67MqTw==} + + cssstyle@2.3.0: + resolution: {integrity: sha512-AZL67abkUzIuvcHqk7c09cezpGNcxUxU4Ioi/05xHk4DQeTkWmGYftIE6ctU6AEt+Gn4n1lDStOtj7FKycP71A==} + engines: {node: '>=8'} + + csstype@3.1.3: + resolution: {integrity: sha512-M1uQkMl8rQK/szD0LNhtqxIPLpimGm8sOBwU7lLnCpSbTyY3yeU1Vc7l4KT5zT4s/yOxHH5O7tIuuLOCnLADRw==} + + damerau-levenshtein@1.0.8: + resolution: {integrity: sha512-sdQSFB7+llfUcQHUQO3+B8ERRj0Oa4w9POWMI/puGtuf7gFywGmkaLCElnudfTiKZV+NvHqL0ifzdrI8Ro7ESA==} + + data-urls@3.0.2: + resolution: {integrity: sha512-Jy/tj3ldjZJo63sVAvg6LHt2mHvl4V6AgRAmNDtLdm7faqtsx+aJG42rsyCo9JCoRVKwPFzKlIPx3DIibwSIaQ==} + engines: {node: '>=12'} + + data-view-buffer@1.0.1: + resolution: {integrity: sha512-0lht7OugA5x3iJLOWFhWK/5ehONdprk0ISXqVFn/NFrDu+cuc8iADFrGQz5BnRK7LLU3JmkbXSxaqX+/mXYtUA==} + engines: {node: '>= 0.4'} + + data-view-byte-length@1.0.1: + resolution: {integrity: sha512-4J7wRJD3ABAzr8wP+OcIcqq2dlUKp4DVflx++hs5h5ZKydWMI6/D/fAot+yh6g2tHh8fLFTvNOaVN357NvSrOQ==} + engines: {node: '>= 0.4'} + + data-view-byte-offset@1.0.0: + resolution: {integrity: sha512-t/Ygsytq+R995EJ5PZlD4Cu56sWa8InXySaViRzw9apusqsOO2bQP+SbYzAhR0pFKoB+43lYy8rWban9JSuXnA==} + engines: {node: '>= 0.4'} + + dayjs@1.11.13: + resolution: {integrity: sha512-oaMBel6gjolK862uaPQOVTA7q3TZhuSvuMQAAglQDOWYO9A91IrAOUJEyKVlqJlHE0vq5p5UXxzdPfMH/x6xNg==} + + debug@3.2.7: + resolution: {integrity: sha512-CFjzYYAi4ThfiQvizrFQevTTXHtnCqWfe7x1AhgEscTz6ZbLbfoLRLPugTQyBth6f8ZERVUSyWHFD/7Wu4t1XQ==} + peerDependencies: + supports-color: '*' + peerDependenciesMeta: + supports-color: + optional: true + + debug@4.3.7: + resolution: {integrity: sha512-Er2nc/H7RrMXZBFCEim6TCmMk02Z8vLC2Rbi1KEBggpo0fS6l0S1nnapwmIi3yW/+GOJap1Krg4w0Hg80oCqgQ==} + engines: {node: '>=6.0'} + peerDependencies: + supports-color: '*' + peerDependenciesMeta: + supports-color: + optional: true + + decimal.js@10.4.3: + resolution: {integrity: sha512-VBBaLc1MgL5XpzgIP7ny5Z6Nx3UrRkIViUkPUdtl9aya5amy3De1gsUUSB1g3+3sExYNjCAsAznmukyxCb1GRA==} + + dedent@1.5.3: + resolution: {integrity: sha512-NHQtfOOW68WD8lgypbLA5oT+Bt0xXJhiYvoR6SmmNXZfpzOGXwdKWmcwG8N7PwVVWV3eF/68nmD9BaJSsTBhyQ==} + peerDependencies: + babel-plugin-macros: ^3.1.0 + peerDependenciesMeta: + babel-plugin-macros: + optional: true + + deep-equal@2.2.3: + resolution: {integrity: sha512-ZIwpnevOurS8bpT4192sqAowWM76JDKSHYzMLty3BZGSswgq6pBaH3DhCSW5xVAZICZyKdOBPjwww5wfgT/6PA==} + engines: {node: '>= 0.4'} + + deep-is@0.1.4: + resolution: {integrity: sha512-oIPzksmTg4/MriiaYGO+okXDT7ztn/w3Eptv/+gSIdMdKsJo0u4CfYNFJPy+4SKMuCqGw2wxnA+URMg3t8a/bQ==} + + deepmerge@4.3.1: + resolution: {integrity: sha512-3sUqbMEc77XqpdNO7FRyRog+eW3ph+GYCbj+rK+uYyRMuwsVy0rMiVtPn+QJlKFvWP/1PYpapqYn0Me2knFn+A==} + engines: {node: '>=0.10.0'} + + define-data-property@1.1.4: + resolution: {integrity: sha512-rBMvIzlpA8v6E+SJZoo++HAYqsLrkg7MSfIinMPFhmkorw7X+dOXVJQs+QT69zGkzMyfDnIMN2Wid1+NbL3T+A==} + engines: {node: '>= 0.4'} + + define-properties@1.2.1: + resolution: {integrity: sha512-8QmQKqEASLd5nx0U1B1okLElbUuuttJ/AnYmRXbbbGDWh6uS208EjD4Xqq/I9wK7u0v6O08XhTWnt5XtEbR6Dg==} + engines: {node: '>= 0.4'} + + delayed-stream@1.0.0: + resolution: {integrity: sha512-ZySD7Nf91aLB0RxL4KGrKHBXl7Eds1DAmEdcoVawXnLD7SDhpNgtuII2aAkg7a7QS41jxPSZ17p4VdGnMHk3MQ==} + engines: {node: '>=0.4.0'} + + dequal@2.0.3: + resolution: {integrity: sha512-0je+qPKHEMohvfRTCEo3CrPG6cAzAYgmzKyxRiYSSDkS6eGJdyVJm7WaYA5ECaAD9wLB2T4EEeymA5aFVcYXCA==} + engines: {node: '>=6'} + + detect-newline@3.1.0: + resolution: {integrity: sha512-TLz+x/vEXm/Y7P7wn1EJFNLxYpUD4TgMosxY6fAVJUnJMbupHBOncxyWUG9OpTaH9EBD7uFI5LfEgmMOc54DsA==} + engines: {node: '>=8'} + + diff-sequences@29.6.3: + resolution: {integrity: sha512-EjePK1srD3P08o2j4f0ExnylqRs5B9tJjcp9t1krH2qRi8CCdsYfwe9JgSLurFBWwq4uOlipzfk5fHNvwFKr8Q==} + engines: {node: ^14.15.0 || ^16.10.0 || >=18.0.0} + + diff@4.0.2: + resolution: {integrity: sha512-58lmxKSA4BNyLz+HHMUzlOEpg09FV+ev6ZMe3vJihgdxzgcwZ8VoEEPmALCZG9LmqfVoNMMKpttIYTVG6uDY7A==} + engines: {node: '>=0.3.1'} + + doctrine@2.1.0: + resolution: {integrity: sha512-35mSku4ZXK0vfCuHEDAwt55dg2jNajHZ1odvF+8SSr82EsZY4QmXfuWso8oEd8zRhVObSN18aM0CjSdoBX7zIw==} + engines: {node: '>=0.10.0'} + + doctrine@3.0.0: + resolution: {integrity: sha512-yS+Q5i3hBf7GBkd4KG8a7eBNNWNGLTaEwwYWUijIYM7zrlYDM0BFXHjjPWlWZ1Rg7UaddZeIDmi9jF3HmqiQ2w==} + engines: {node: '>=6.0.0'} + + dom-accessibility-api@0.5.16: + resolution: {integrity: sha512-X7BJ2yElsnOJ30pZF4uIIDfBEVgF4XEBxL9Bxhy6dnrm5hkzqmsWHGTiHqRiITNhMyFLyAiWndIJP7Z1NTteDg==} + + dom-accessibility-api@0.6.3: + resolution: {integrity: sha512-7ZgogeTnjuHbo+ct10G9Ffp0mif17idi0IyWNVA/wcwcm7NPOD/WEHVP3n7n3MhXqxoIYm8d6MuZohYWIZ4T3w==} + + domexception@4.0.0: + resolution: {integrity: sha512-A2is4PLG+eeSfoTMA95/s4pvAoSo2mKtiM5jlHkAVewmiO8ISFTFKZjH7UAM1Atli/OT/7JHOrJRJiMKUZKYBw==} + engines: {node: '>=12'} + deprecated: Use your platform's native DOMException instead + + eastasianwidth@0.2.0: + resolution: {integrity: sha512-I88TYZWc9XiYHRQ4/3c5rjjfgkjhLyW2luGIheGERbNQ6OY7yTybanSpDXZa8y7VUP9YmDcYa+eyq4ca7iLqWA==} + + electron-to-chromium@1.5.50: + resolution: {integrity: sha512-eMVObiUQ2LdgeO1F/ySTXsvqvxb6ZH2zPGaMYsWzRDdOddUa77tdmI0ltg+L16UpbWdhPmuF3wIQYyQq65WfZw==} + + emittery@0.13.1: + resolution: {integrity: sha512-DeWwawk6r5yR9jFgnDKYt4sLS0LmHJJi3ZOnb5/JdbYwj3nW+FxQnHIjhBKz8YLC7oRNPVM9NQ47I3CVx34eqQ==} + engines: {node: '>=12'} + + emoji-regex@8.0.0: + resolution: {integrity: sha512-MSjYzcWNOA0ewAHpz0MxpYFvwg6yjy1NG3xteoqz644VCo/RPgnr1/GGt+ic3iJTzQ8Eu3TdM14SawnVUmGE6A==} + + emoji-regex@9.2.2: + resolution: {integrity: sha512-L18DaJsXSUk2+42pv8mLs5jJT2hqFkFE4j21wOmgbUqsZ2hL72NsUU785g9RXgo3s0ZNgVl42TiHp3ZtOv/Vyg==} + + enhanced-resolve@5.17.1: + resolution: {integrity: sha512-LMHl3dXhTcfv8gM4kEzIUeTQ+7fpdA0l2tUf34BddXPkz2A5xJ5L/Pchd5BL6rdccM9QGvu0sWZzK1Z1t4wwyg==} + engines: {node: '>=10.13.0'} + + enquirer@2.4.1: + resolution: {integrity: sha512-rRqJg/6gd538VHvR3PSrdRBb/1Vy2YfzHqzvbhGIQpDRKIa4FgV/54b5Q1xYSxOOwKvjXweS26E0Q+nAMwp2pQ==} + engines: {node: '>=8.6'} + + entities@4.5.0: + resolution: {integrity: sha512-V0hjH4dGPh9Ao5p0MoRY6BVqtwCjhz6vI5LT8AJ55H+4g9/4vbHx1I54fS0XuclLhDHArPQCiMjDxjaL8fPxhw==} + engines: {node: '>=0.12'} + + err-code@3.0.1: + resolution: {integrity: sha512-GiaH0KJUewYok+eeY05IIgjtAe4Yltygk9Wqp1V5yVWLdhf0hYZchRjNIT9bb0mSwRcIusT3cx7PJUf3zEIfUA==} + + error-ex@1.3.2: + resolution: {integrity: sha512-7dFHNmqeFSEt2ZBsCriorKnn3Z2pj+fd9kmI6QoWw4//DL+icEBfc0U7qJCisqrTsKTjw4fNFy2pW9OqStD84g==} + + es-abstract@1.23.3: + resolution: {integrity: sha512-e+HfNH61Bj1X9/jLc5v1owaLYuHdeHHSQlkhCBiTK8rBvKaULl/beGMxwrMXjpYrv4pz22BlY570vVePA2ho4A==} + engines: {node: '>= 0.4'} + + es-define-property@1.0.0: + resolution: {integrity: sha512-jxayLKShrEqqzJ0eumQbVhTYQM27CfT1T35+gCgDFoL82JLsXqTJ76zv6A0YLOgEnLUMvLzsDsGIrl8NFpT2gQ==} + engines: {node: '>= 0.4'} + + es-errors@1.3.0: + resolution: {integrity: sha512-Zf5H2Kxt2xjTvbJvP2ZWLEICxA6j+hAmMzIlypy4xcBg1vKVnx89Wy0GbS+kf5cwCVFFzdCFh2XSCFNULS6csw==} + engines: {node: '>= 0.4'} + + es-get-iterator@1.1.3: + resolution: {integrity: sha512-sPZmqHBe6JIiTfN5q2pEi//TwxmAFHwj/XEuYjTuse78i8KxaqMTTzxPoFKuzRpDpTJ+0NAbpfenkmH2rePtuw==} + + es-iterator-helpers@1.0.19: + resolution: {integrity: sha512-zoMwbCcH5hwUkKJkT8kDIBZSz9I6mVG//+lDCinLCGov4+r7NIy0ld8o03M0cJxl2spVf6ESYVS6/gpIfq1FFw==} + engines: {node: '>= 0.4'} + + es-object-atoms@1.0.0: + resolution: {integrity: sha512-MZ4iQ6JwHOBQjahnjwaC1ZtIBH+2ohjamzAO3oaHcXYup7qxjF2fixyH+Q71voWHeOkI2q/TnJao/KfXYIZWbw==} + engines: {node: '>= 0.4'} + + es-set-tostringtag@2.0.3: + resolution: {integrity: sha512-3T8uNMC3OQTHkFUsFq8r/BwAXLHvU/9O9mE0fBc/MY5iq/8H7ncvO947LmYA6ldWw9Uh8Yhf25zu6n7nML5QWQ==} + engines: {node: '>= 0.4'} + + es-shim-unscopables@1.0.2: + resolution: {integrity: sha512-J3yBRXCzDu4ULnQwxyToo/OjdMx6akgVC7K6few0a7F/0wLtmKKN7I73AH5T2836UuXRqN7Qg+IIUw/+YJksRw==} + + es-to-primitive@1.2.1: + resolution: {integrity: sha512-QCOllgZJtaUo9miYBcLChTUaHNjJF3PYs1VidD7AwiEj1kYxKeQTctLAezAOH5ZKRH0g2IgPn6KwB4IT8iRpvA==} + engines: {node: '>= 0.4'} + + escalade@3.2.0: + resolution: {integrity: sha512-WUj2qlxaQtO4g6Pq5c29GTcWGDyd8itL8zTlipgECz3JesAiiOKotd8JU6otB3PACgG6xkJUyVhboMS+bje/jA==} + engines: {node: '>=6'} + + escape-string-regexp@2.0.0: + resolution: {integrity: sha512-UpzcLCXolUWcNu5HtVMHYdXJjArjsF9C0aNnquZYY4uW/Vu0miy5YoWvbV345HauVvcAUnpRuhMMcqTcGOY2+w==} + engines: {node: '>=8'} + + escape-string-regexp@4.0.0: + resolution: {integrity: sha512-TtpcNJ3XAzx3Gq8sWRzJaVajRs0uVxA2YAkdb1jm2YkPz4G6egUFAyA3n5vtEIZefPk5Wa4UXbKuS5fKkJWdgA==} + engines: {node: '>=10'} + + escodegen@2.1.0: + resolution: {integrity: sha512-2NlIDTwUWJN0mRPQOdtQBzbUHvdGY2P1VXSyU83Q3xKxM7WHX2Ql8dKq782Q9TgQUNOLEzEYu9bzLNj1q88I5w==} + engines: {node: '>=6.0'} + hasBin: true + + eslint-config-next@14.2.13: + resolution: {integrity: sha512-aro1EKAoyYchnO/3Tlo91hnNBO7QO7qnv/79MAFC+4Jq8TdUVKQlht5d2F+YjrePjdpOvfL+mV9JPfyYNwkk1g==} + peerDependencies: + eslint: ^7.23.0 || ^8.0.0 + typescript: '>=3.3.1' + peerDependenciesMeta: + typescript: + optional: true + + eslint-import-resolver-node@0.3.9: + resolution: {integrity: sha512-WFj2isz22JahUv+B788TlO3N6zL3nNJGU8CcZbPZvVEkBPaJdCV4vy5wyghty5ROFbCRnm132v8BScu5/1BQ8g==} + + eslint-import-resolver-typescript@3.6.3: + resolution: {integrity: sha512-ud9aw4szY9cCT1EWWdGv1L1XR6hh2PaRWif0j2QjQ0pgTY/69iw+W0Z4qZv5wHahOl8isEr+k/JnyAqNQkLkIA==} + engines: {node: ^14.18.0 || >=16.0.0} + peerDependencies: + eslint: '*' + eslint-plugin-import: '*' + eslint-plugin-import-x: '*' + peerDependenciesMeta: + eslint-plugin-import: + optional: true + eslint-plugin-import-x: + optional: true + + eslint-module-utils@2.12.0: + resolution: {integrity: sha512-wALZ0HFoytlyh/1+4wuZ9FJCD/leWHQzzrxJ8+rebyReSLk7LApMyd3WJaLVoN+D5+WIdJyDK1c6JnE65V4Zyg==} + engines: {node: '>=4'} + peerDependencies: + '@typescript-eslint/parser': '*' + eslint: '*' + eslint-import-resolver-node: '*' + eslint-import-resolver-typescript: '*' + eslint-import-resolver-webpack: '*' + peerDependenciesMeta: + '@typescript-eslint/parser': + optional: true + eslint: + optional: true + eslint-import-resolver-node: + optional: true + eslint-import-resolver-typescript: + optional: true + eslint-import-resolver-webpack: + optional: true + + eslint-plugin-import@2.30.0: + resolution: {integrity: sha512-/mHNE9jINJfiD2EKkg1BKyPyUk4zdnT54YgbOgfjSakWT5oyX/qQLVNTkehyfpcMxZXMy1zyonZ2v7hZTX43Yw==} + engines: {node: '>=4'} + peerDependencies: + '@typescript-eslint/parser': '*' + eslint: ^2 || ^3 || ^4 || ^5 || ^6 || ^7.2.0 || ^8 + peerDependenciesMeta: + '@typescript-eslint/parser': + optional: true + + eslint-plugin-jsx-a11y@6.10.0: + resolution: {integrity: sha512-ySOHvXX8eSN6zz8Bywacm7CvGNhUtdjvqfQDVe6020TUK34Cywkw7m0KsCCk1Qtm9G1FayfTN1/7mMYnYO2Bhg==} + engines: {node: '>=4.0'} + peerDependencies: + eslint: ^3 || ^4 || ^5 || ^6 || ^7 || ^8 || ^9 + + eslint-plugin-react-hooks@4.6.2: + resolution: {integrity: sha512-QzliNJq4GinDBcD8gPB5v0wh6g8q3SUi6EFF0x8N/BL9PoVs0atuGc47ozMRyOWAKdwaZ5OnbOEa3WR+dSGKuQ==} + engines: {node: '>=10'} + peerDependencies: + eslint: ^3.0.0 || ^4.0.0 || ^5.0.0 || ^6.0.0 || ^7.0.0 || ^8.0.0-0 + + eslint-plugin-react@7.37.1: + resolution: {integrity: sha512-xwTnwDqzbDRA8uJ7BMxPs/EXRB3i8ZfnOIp8BsxEQkT0nHPp+WWceqGgo6rKb9ctNi8GJLDT4Go5HAWELa/WMg==} + engines: {node: '>=4'} + peerDependencies: + eslint: ^3 || ^4 || ^5 || ^6 || ^7 || ^8 || ^9.7 + + eslint-scope@6.0.0: + resolution: {integrity: sha512-uRDL9MWmQCkaFus8RF5K9/L/2fn+80yoW3jkD53l4shjCh26fCtvJGasxjUqP5OT87SYTxCVA3BwTUzuELx9kA==} + engines: {node: ^12.22.0 || ^14.17.0 || >=16.0.0} + + eslint-utils@3.0.0: + resolution: {integrity: sha512-uuQC43IGctw68pJA1RgbQS8/NP7rch6Cwd4j3ZBtgo4/8Flj4eGE7ZYSZRN3iq5pVUv6GPdW5Z1RFleo84uLDA==} + engines: {node: ^10.0.0 || ^12.0.0 || >= 14.0.0} + peerDependencies: + eslint: '>=5' + + eslint-visitor-keys@2.1.0: + resolution: {integrity: sha512-0rSmRBzXgDzIsD6mGdJgevzgezI534Cer5L/vyMX0kHzT/jiB43jRhd9YUlMGYLQy2zprNmoT8qasCGtY+QaKw==} + engines: {node: '>=10'} + + eslint-visitor-keys@3.4.3: + resolution: {integrity: sha512-wpc+LXeiyiisxPlEkUzU6svyS1frIO3Mgxj1fdy7Pm8Ygzguax2N3Fa/D/ag1WqbOprdI+uY6wMUl8/a2G+iag==} + engines: {node: ^12.22.0 || ^14.17.0 || >=16.0.0} + + eslint@8.0.0: + resolution: {integrity: sha512-03spzPzMAO4pElm44m60Nj08nYonPGQXmw6Ceai/S4QK82IgwWO1EXx1s9namKzVlbVu3Jf81hb+N+8+v21/HQ==} + engines: {node: ^12.22.0 || ^14.17.0 || >=16.0.0} + hasBin: true + + espree@9.6.1: + resolution: {integrity: sha512-oruZaFkjorTpF32kDSI5/75ViwGeZginGGy2NoOSg3Q9bnwlnmDm4HLnkl0RE3n+njDXR037aY1+x58Z/zFdwQ==} + engines: {node: ^12.22.0 || ^14.17.0 || >=16.0.0} + + esprima@4.0.1: + resolution: {integrity: sha512-eGuFFw7Upda+g4p+QHvnW0RyTX/SVeJBDM/gCtMARO0cLuT2HcEKnTPvhjV6aGeqrCB/sbNop0Kszm0jsaWU4A==} + engines: {node: '>=4'} + hasBin: true + + esquery@1.6.0: + resolution: {integrity: sha512-ca9pw9fomFcKPvFLXhBKUK90ZvGibiGOvRJNbjljY7s7uq/5YO4BOzcYtJqExdx99rF6aAcnRxHmcUHcz6sQsg==} + engines: {node: '>=0.10'} + + esrecurse@4.3.0: + resolution: {integrity: sha512-KmfKL3b6G+RXvP8N1vr3Tq1kL/oCFgn2NYXEtqP8/L3pKapUA4G8cFVaoF3SU323CD4XypR/ffioHmkti6/Tag==} + engines: {node: '>=4.0'} + + estraverse@5.3.0: + resolution: {integrity: sha512-MMdARuVEQziNTeJD8DgMqmhwR11BRQ/cBP+pLtYdSTnf3MIO8fFeiINEbX36ZdNlfU/7A9f3gUw49B3oQsvwBA==} + engines: {node: '>=4.0'} + + esutils@2.0.3: + resolution: {integrity: sha512-kVscqXk4OCp68SZ0dkgEKVi6/8ij300KBWTJq32P/dYeWTSwK41WyTxalN1eRmA5Z9UU/LX9D7FWSmV9SAYx6g==} + engines: {node: '>=0.10.0'} + + eventemitter3@4.0.7: + resolution: {integrity: sha512-8guHBZCwKnFhYdHr2ysuRWErTwhoN2X8XELRlrRwpmfeY2jjuUN4taQMsULKUVo1K4DvZl+0pgfyoysHxvmvEw==} + + execa@5.1.1: + resolution: {integrity: sha512-8uSpZZocAZRBAPIEINJj3Lo9HyGitllczc27Eh5YYojjMFMn8yHMDMaUHE2Jqfq05D/wucwI4JGURyXt1vchyg==} + engines: {node: '>=10'} + + exit@0.1.2: + resolution: {integrity: sha512-Zk/eNKV2zbjpKzrsQ+n1G6poVbErQxJ0LBOJXaKZ1EViLzH+hrLu9cdXI4zw9dBQJslwBEpbQ2P1oS7nDxs6jQ==} + engines: {node: '>= 0.8.0'} + + expect@29.7.0: + resolution: {integrity: sha512-2Zks0hf1VLFYI1kbh0I5jP3KHHyCHpkfyHBzsSXRFgl/Bg9mWYfMW8oD+PdMPlEwy5HNsR9JutYy6pMeOh61nw==} + engines: {node: ^14.15.0 || ^16.10.0 || >=18.0.0} + + fast-deep-equal@3.1.3: + resolution: {integrity: sha512-f3qQ9oQy9j2AhBe/H9VC91wLmKBCCU/gDOnKNAYG5hswO7BLKj09Hc5HYNz9cGI++xlpDCIgDaitVs03ATR84Q==} + + fast-glob@3.3.2: + resolution: {integrity: sha512-oX2ruAFQwf/Orj8m737Y5adxDQO0LAB7/S5MnxCdTNDd4p6BsyIVsv9JQsATbTSq8KHRpLwIHbVlUNatxd+1Ow==} + engines: {node: '>=8.6.0'} + + fast-json-stable-stringify@2.1.0: + resolution: {integrity: sha512-lhd/wF+Lk98HZoTCtlVraHtfh5XYijIjalXck7saUtuanSDyLMxnHhSXEDJqHxD7msR8D0uCmqlkwjCV8xvwHw==} + + fast-levenshtein@2.0.6: + resolution: {integrity: sha512-DCXu6Ifhqcks7TZKY3Hxp3y6qphY5SJZmrWMDrKcERSOXWQdMhU9Ig/PYrzyw/ul9jOIyh0N4M0tbC5hodg8dw==} + + fastq@1.17.1: + resolution: {integrity: sha512-sRVD3lWVIXWg6By68ZN7vho9a1pQcN/WBFaAAsDDFzlJjvoGx0P8z7V1t72grFJfJhu3YPZBuu25f7Kaw2jN1w==} + + fb-watchman@2.0.2: + resolution: {integrity: sha512-p5161BqbuCaSnB8jIbzQHOlpgsPmK5rJVDfDKO91Axs5NC1uu3HRQm6wt9cd9/+GtQQIO53JdGXXoyDpTAsgYA==} + + file-entry-cache@6.0.1: + resolution: {integrity: sha512-7Gps/XWymbLk2QLYK4NzpMOrYjMhdIxXuIvy2QBsLE6ljuodKvdkWs/cpyJJ3CVIVpH0Oi1Hvg1ovbMzLdFBBg==} + engines: {node: ^10.12.0 || >=12.0.0} + + fill-range@7.1.1: + resolution: {integrity: sha512-YsGpe3WHLK8ZYi4tWDg2Jy3ebRz2rXowDxnld4bkQB00cc/1Zw9AWnC0i9ztDJitivtQvaI9KaLyKrc+hBW0yg==} + engines: {node: '>=8'} + + find-up@4.1.0: + resolution: {integrity: sha512-PpOwAdQ/YlXQ2vj8a3h8IipDuYRi3wceVQQGYWxNINccq40Anw7BlsEXCMbt1Zt+OLA6Fq9suIpIWD0OsnISlw==} + engines: {node: '>=8'} + + flat-cache@3.2.0: + resolution: {integrity: sha512-CYcENa+FtcUKLmhhqyctpclsq7QF38pKjZHsGNiSQF5r4FtoKDWabFDl3hzaEQMvT1LHEysw5twgLvpYYb4vbw==} + engines: {node: ^10.12.0 || >=12.0.0} + + flatted@3.3.1: + resolution: {integrity: sha512-X8cqMLLie7KsNUDSdzeN8FYK9rEt4Dt67OsG/DNGnYTSDBG4uFAJFBnUeiV+zCVAvwFy56IjM9sH51jVaEhNxw==} + + for-each@0.3.3: + resolution: {integrity: sha512-jqYfLp7mo9vIyQf8ykW2v7A+2N4QjeCeI5+Dz9XraiO1ign81wjiH7Fb9vSOWvQfNtmSa4H2RoQTrrXivdUZmw==} + + foreground-child@3.3.0: + resolution: {integrity: sha512-Ld2g8rrAyMYFXBhEqMz8ZAHBi4J4uS1i/CxGMDnjyFWddMXLVcDp051DZfu+t7+ab7Wv6SMqpWmyFIj5UbfFvg==} + engines: {node: '>=14'} + + form-data@4.0.1: + resolution: {integrity: sha512-tzN8e4TX8+kkxGPK8D5u0FNmjPUjw3lwC9lSLxxoB/+GtsJG91CO8bSWy73APlgAZzZbXEYZJuxjkHH2w+Ezhw==} + engines: {node: '>= 6'} + + fs.realpath@1.0.0: + resolution: {integrity: sha512-OO0pH2lK6a0hZnAdau5ItzHPI6pUlvI7jMVnxUQRtw4owF2wk8lOSabtGDCTP4Ggrg2MbGnWO9X8K1t4+fGMDw==} + + fsevents@2.3.3: + resolution: {integrity: sha512-5xoDfX+fL7faATnagmWPpbFtwh/R77WmMMqqHGS65C3vvB0YHrgF+B1YmZ3441tMj5n63k0212XNoJwzlhffQw==} + engines: {node: ^8.16.0 || ^10.6.0 || >=11.0.0} + os: [darwin] + + function-bind@1.1.2: + resolution: {integrity: sha512-7XHNxH7qX9xG5mIwxkhumTox/MIRNcOgDrxWsMt2pAr23WHp6MrRlN7FBSFpCpr+oVO0F744iUgR82nJMfG2SA==} + + function.prototype.name@1.1.6: + resolution: {integrity: sha512-Z5kx79swU5P27WEayXM1tBi5Ze/lbIyiNgU3qyXUOf9b2rgXYyF9Dy9Cx+IQv/Lc8WCG6L82zwUPpSS9hGehIg==} + engines: {node: '>= 0.4'} + + functional-red-black-tree@1.0.1: + resolution: {integrity: sha512-dsKNQNdj6xA3T+QlADDA7mOSlX0qiMINjn0cgr+eGHGsbSHzTabcIogz2+p/iqP1Xs6EP/sS2SbqH+brGTbq0g==} + + functions-have-names@1.2.3: + resolution: {integrity: sha512-xckBUXyTIqT97tq2x2AMb+g163b5JFysYk0x4qxNFwbfQkmNZoiRHb6sPzI9/QV33WeuvVYBUIiD4NzNIyqaRQ==} + + gensync@1.0.0-beta.2: + resolution: {integrity: sha512-3hN7NaskYvMDLQY55gnW3NQ+mesEAepTqlg+VEbj7zzqEMBVNhzcGYYeqFo/TlYz6eQiFcp1HcsCZO+nGgS8zg==} + engines: {node: '>=6.9.0'} + + get-browser-rtc@1.1.0: + resolution: {integrity: sha512-MghbMJ61EJrRsDe7w1Bvqt3ZsBuqhce5nrn/XAwgwOXhcsz53/ltdxOse1h/8eKXj5slzxdsz56g5rzOFSGwfQ==} + + get-caller-file@2.0.5: + resolution: {integrity: sha512-DyFP3BM/3YHTQOCUL/w0OZHR0lpKeGrxotcHWcqNEdnltqFwXVfhEBQ94eIo34AfQpo0rGki4cyIiftY06h2Fg==} + engines: {node: 6.* || 8.* || >= 10.*} + + get-intrinsic@1.2.4: + resolution: {integrity: sha512-5uYhsJH8VJBTv7oslg4BznJYhDoRI6waYCxMmCdnTrcCrHA/fCFKoTFz2JKKE0HdDFUF7/oQuhzumXJK7paBRQ==} + engines: {node: '>= 0.4'} + + get-package-type@0.1.0: + resolution: {integrity: sha512-pjzuKtY64GYfWizNAJ0fr9VqttZkNiK2iS430LtIHzjBEr6bX8Am2zm4sW4Ro5wjWW5cAlRL1qAMTcXbjNAO2Q==} + engines: {node: '>=8.0.0'} + + get-stream@6.0.1: + resolution: {integrity: sha512-ts6Wi+2j3jQjqi70w5AlN8DFnkSwC+MqmxEzdEALB2qXZYV3X/b1CTfgPLGJNMeAWxdPfU8FO1ms3NUfaHCPYg==} + engines: {node: '>=10'} + + get-symbol-description@1.0.2: + resolution: {integrity: sha512-g0QYk1dZBxGwk+Ngc+ltRH2IBp2f7zBkBMBJZCDerh6EhlhSR6+9irMCuT/09zD6qkarHUSn529sK/yL4S27mg==} + engines: {node: '>= 0.4'} + + get-tsconfig@4.8.1: + resolution: {integrity: sha512-k9PN+cFBmaLWtVz29SkUoqU5O0slLuHJXt/2P+tMVFT+phsSGXGkp9t3rQIqdz0e+06EHNGs3oM6ZX1s2zHxRg==} + + glob-parent@5.1.2: + resolution: {integrity: sha512-AOIgSQCepiJYwP3ARnGx+5VnTu2HBYdzbGP45eLw1vr3zB3vZLeyed1sC9hnbcOc9/SrMyM5RPQrkGz4aS9Zow==} + engines: {node: '>= 6'} + + glob-parent@6.0.2: + resolution: {integrity: sha512-XxwI8EOhVQgWp6iDL+3b0r86f4d6AX6zSU55HfB4ydCEuXLXc5FcYeOu+nnGftS4TEju/11rt4KJPTMgbfmv4A==} + engines: {node: '>=10.13.0'} + + glob@10.3.10: + resolution: {integrity: sha512-fa46+tv1Ak0UPK1TOy/pZrIybNNt4HCv7SDzwyfiOZkvZLEbjsZkJBPtDHVshZjbecAoAGSC20MjLDG/qr679g==} + engines: {node: '>=16 || 14 >=14.17'} + hasBin: true + + glob@7.2.3: + resolution: {integrity: sha512-nFR0zLpU2YCaRxwoCJvL6UvCH2JFyFVIvwTLsIf21AuHlMskA1hhTdk+LlYJtOlYt9v6dvszD2BGRqBL+iQK9Q==} + deprecated: Glob versions prior to v9 are no longer supported + + globals@11.12.0: + resolution: {integrity: sha512-WOBp/EEGUiIsJSp7wcv/y6MO+lV9UoncWqxuFfm8eBwzWNgyfBd6Gz+IeKQ9jCmyhoH99g15M3T+QaVHFjizVA==} + engines: {node: '>=4'} + + globals@13.24.0: + resolution: {integrity: sha512-AhO5QUcj8llrbG09iWhPU2B204J1xnPeL8kQmVorSsy+Sjj1sk8gIyh6cUocGmH4L0UuhAJy+hJMRA4mgA4mFQ==} + engines: {node: '>=8'} + + globalthis@1.0.4: + resolution: {integrity: sha512-DpLKbNU4WylpxJykQujfCcwYWiV/Jhm50Goo0wrVILAv5jOr9d+H+UR3PhSCD2rCCEIg0uc+G+muBTwD54JhDQ==} + engines: {node: '>= 0.4'} + + gopd@1.0.1: + resolution: {integrity: sha512-d65bNlIadxvpb/A2abVdlqKqV563juRnZ1Wtk6s1sIR8uNsXR70xqIzVqxVf1eTqDunwT2MkczEeaezCKTZhwA==} + + graceful-fs@4.2.11: + resolution: {integrity: sha512-RbJ5/jmFcNNCcDV5o9eTnBLJ/HszWV0P73bc+Ff4nS/rJj+YaS6IGyiOL0VoBYX+l1Wrl3k63h/KrH+nhJ0XvQ==} + + graphemer@1.4.0: + resolution: {integrity: sha512-EtKwoO6kxCL9WO5xipiHTZlSzBm7WLT627TqC/uVRd0HKmq8NXyebnNYxDoBi7wt8eTWrUrKXCOVaFq9x1kgag==} + + has-bigints@1.0.2: + resolution: {integrity: sha512-tSvCKtBr9lkF0Ex0aQiP9N+OpV4zi2r/Nee5VkRDbaqv35RLYMzbwQfFSZZH0kR+Rd6302UJZ2p/bJCEoR3VoQ==} + + has-flag@4.0.0: + resolution: {integrity: sha512-EykJT/Q1KjTWctppgIAgfSO0tKVuZUjhgMr17kqTumMl6Afv3EISleU7qZUzoXDFTAHTDC4NOoG/ZxU3EvlMPQ==} + engines: {node: '>=8'} + + has-property-descriptors@1.0.2: + resolution: {integrity: sha512-55JNKuIW+vq4Ke1BjOTjM2YctQIvCT7GFzHwmfZPGo5wnrgkid0YQtnAleFSqumZm4az3n2BS+erby5ipJdgrg==} + + has-proto@1.0.3: + resolution: {integrity: sha512-SJ1amZAJUiZS+PhsVLf5tGydlaVB8EdFpaSO4gmiUKUOxk8qzn5AIy4ZeJUmh22znIdk/uMAUT2pl3FxzVUH+Q==} + engines: {node: '>= 0.4'} + + has-symbols@1.0.3: + resolution: {integrity: sha512-l3LCuF6MgDNwTDKkdYGEihYjt5pRPbEg46rtlmnSPlUbgmB8LOIrKJbYYFBSbnPaJexMKtiPO8hmeRjRz2Td+A==} + engines: {node: '>= 0.4'} + + has-tostringtag@1.0.2: + resolution: {integrity: sha512-NqADB8VjPFLM2V0VvHUewwwsw0ZWBaIdgo+ieHtK3hasLz4qeCRjYcqfB6AQrBggRKppKF8L52/VqdVsO47Dlw==} + engines: {node: '>= 0.4'} + + hasown@2.0.2: + resolution: {integrity: sha512-0hJU9SCPvmMzIBdZFqNPXWa6dqh7WdH0cII9y+CyS8rG3nL48Bclra9HmKhVVUHyPWNH5Y7xDwAB7bfgSjkUMQ==} + engines: {node: '>= 0.4'} + + html-encoding-sniffer@3.0.0: + resolution: {integrity: sha512-oWv4T4yJ52iKrufjnyZPkrN0CH3QnrUqdB6In1g5Fe1mia8GmF36gnfNySxoZtxD5+NmYw1EElVXiBk93UeskA==} + engines: {node: '>=12'} + + html-escaper@2.0.2: + resolution: {integrity: sha512-H2iMtd0I4Mt5eYiapRdIDjp+XzelXQ0tFE4JS7YFwFevXXMmOp9myNrUvCg0D6ws8iqkRPBfKHgbwig1SmlLfg==} + + http-proxy-agent@5.0.0: + resolution: {integrity: sha512-n2hY8YdoRE1i7r6M0w9DIw5GgZN0G25P8zLCRQ8rjXtTU3vsNFBI/vWK/UIeE6g5MUUz6avwAPXmL6Fy9D/90w==} + engines: {node: '>= 6'} + + https-proxy-agent@5.0.1: + resolution: {integrity: sha512-dFcAjpTQFgoLMzC2VwU+C/CbS7uRL0lWmxDITmqm7C+7F0Odmj6s9l6alZc6AELXhrnggM2CeWSXHGOdX2YtwA==} + engines: {node: '>= 6'} + + human-signals@2.1.0: + resolution: {integrity: sha512-B4FFZ6q/T2jhhksgkbEW3HBvWIfDW85snkQgawt07S7J5QXTk6BkNV+0yAeZrM5QpMAdYlocGoljn0sJ/WQkFw==} + engines: {node: '>=10.17.0'} + + iconv-lite@0.6.3: + resolution: {integrity: sha512-4fCk79wshMdzMp2rH06qWrJE4iolqLhCUH+OiuIgU++RB0+94NlDL81atO7GX55uUKueo0txHNtvEyI6D7WdMw==} + engines: {node: '>=0.10.0'} + + ieee754@1.2.1: + resolution: {integrity: sha512-dcyqhDvX1C46lXZcVqCpK+FtMRQVdIMN6/Df5js2zouUsqG7I6sFxitIC+7KYK29KdXOLHdu9zL4sFnoVQnqaA==} + + ignore@4.0.6: + resolution: {integrity: sha512-cyFDKrqc/YdcWFniJhzI42+AzS+gNwmUzOSFcRCQYwySuBBBy/KjuxWLZ/FHEH6Moq1NizMOBWyTcv8O4OZIMg==} + engines: {node: '>= 4'} + + ignore@5.3.2: + resolution: {integrity: sha512-hsBTNUqQTDwkWtcdYI2i06Y/nUBEsNEDJKjWdigLvegy8kDuJAS8uRlpkkcQpyEXL0Z/pjDy5HBmMjRCJ2gq+g==} + engines: {node: '>= 4'} + + immediate@3.0.6: + resolution: {integrity: sha512-XXOFtyqDjNDAQxVfYxuF7g9Il/IbWmmlQg2MYKOH8ExIT1qg6xc4zyS3HaEEATgs1btfzxq15ciUiY7gjSXRGQ==} + + immutable@4.3.7: + resolution: {integrity: sha512-1hqclzwYwjRDFLjcFxOM5AYkkG0rpFPpr1RLPMEuGczoS7YA8gLhy8SWXYRAA/XwfEHpfo3cw5JGioS32fnMRw==} + + import-fresh@3.3.0: + resolution: {integrity: sha512-veYYhQa+D1QBKznvhUHxb8faxlrwUnxseDAbAp457E0wLNio2bOSKnjYDhMj+YiAq61xrMGhQk9iXVk5FzgQMw==} + engines: {node: '>=6'} + + import-local@3.2.0: + resolution: {integrity: sha512-2SPlun1JUPWoM6t3F0dw0FkCF/jWY8kttcY4f599GLTSjh2OCuuhdTkJQsEcZzBqbXZGKMK2OqW1oZsjtf/gQA==} + engines: {node: '>=8'} + hasBin: true + + imurmurhash@0.1.4: + resolution: {integrity: sha512-JmXMZ6wuvDmLiHEml9ykzqO6lwFbof0GG4IkcGaENdCRDDmMVnny7s5HsIgHCbaq0w2MyPhDqkhTUgS2LU2PHA==} + engines: {node: '>=0.8.19'} + + indent-string@4.0.0: + resolution: {integrity: sha512-EdDDZu4A2OyIK7Lr/2zG+w5jmbuk1DVBnEwREQvBzspBJkCEbRa8GxU1lghYcaGJCnRWibjDXlq779X1/y5xwg==} + engines: {node: '>=8'} + + inflight@1.0.6: + resolution: {integrity: sha512-k92I/b08q4wvFscXCLvqfsHCrjrF7yiXsQuIVvVE7N82W3+aqpzuUdBbfhWcy/FZR3/4IgflMgKLOsvPDrGCJA==} + deprecated: This module is not supported, and leaks memory. Do not use it. Check out lru-cache if you want a good and tested way to coalesce async requests by a key value, which is much more comprehensive and powerful. + + inherits@2.0.4: + resolution: {integrity: sha512-k/vGaX4/Yla3WzyMCvTQOXYeIHvqOKtnqBduzTHpzpQZzAskKMhZ2K+EnBiSM9zGSoIFeMpXKxa4dYeZIQqewQ==} + + internal-slot@1.0.7: + resolution: {integrity: sha512-NGnrKwXzSms2qUUih/ILZ5JBqNTSa1+ZmP6flaIp6KmSElgE9qdndzS3cqjrDovwFdmwsGsLdeFgB6suw+1e9g==} + engines: {node: '>= 0.4'} + + is-arguments@1.1.1: + resolution: {integrity: sha512-8Q7EARjzEnKpt/PCD7e1cgUS0a6X8u5tdSiMqXhojOdoV9TsMsiO+9VLC5vAmO8N7/GmXn7yjR8qnA6bVAEzfA==} + engines: {node: '>= 0.4'} + + is-array-buffer@3.0.4: + resolution: {integrity: sha512-wcjaerHw0ydZwfhiKbXJWLDY8A7yV7KhjQOpb83hGgGfId/aQa4TOvwyzn2PuswW2gPCYEL/nEAiSVpdOj1lXw==} + engines: {node: '>= 0.4'} + + is-arrayish@0.2.1: + resolution: {integrity: sha512-zz06S8t0ozoDXMG+ube26zeCTNXcKIPJZJi8hBrF4idCLms4CG9QtK7qBl1boi5ODzFpjswb5JPmHCbMpjaYzg==} + + is-async-function@2.0.0: + resolution: {integrity: sha512-Y1JXKrfykRJGdlDwdKlLpLyMIiWqWvuSd17TvZk68PLAOGOoF4Xyav1z0Xhoi+gCYjZVeC5SI+hYFOfvXmGRCA==} + engines: {node: '>= 0.4'} + + is-bigint@1.0.4: + resolution: {integrity: sha512-zB9CruMamjym81i2JZ3UMn54PKGsQzsJeo6xvN3HJJ4CAsQNB6iRutp2To77OfCNuoxspsIhzaPoO1zyCEhFOg==} + + is-boolean-object@1.1.2: + resolution: {integrity: sha512-gDYaKHJmnj4aWxyj6YHyXVpdQawtVLHU5cb+eztPGczf6cjuTdwve5ZIEfgXqH4e57An1D1AKf8CZ3kYrQRqYA==} + engines: {node: '>= 0.4'} + + is-bun-module@1.2.1: + resolution: {integrity: sha512-AmidtEM6D6NmUiLOvvU7+IePxjEjOzra2h0pSrsfSAcXwl/83zLLXDByafUJy9k/rKK0pvXMLdwKwGHlX2Ke6Q==} + + is-callable@1.2.7: + resolution: {integrity: sha512-1BC0BVFhS/p0qtw6enp8e+8OD0UrK0oFLztSjNzhcKA3WDuJxxAPXzPuPtKkjEY9UUoEWlX/8fgKeu2S8i9JTA==} + engines: {node: '>= 0.4'} + + is-core-module@2.15.1: + resolution: {integrity: sha512-z0vtXSwucUJtANQWldhbtbt7BnL0vxiFjIdDLAatwhDYty2bad6s+rijD6Ri4YuYJubLzIJLUidCh09e1djEVQ==} + engines: {node: '>= 0.4'} + + is-data-view@1.0.1: + resolution: {integrity: sha512-AHkaJrsUVW6wq6JS8y3JnM/GJF/9cf+k20+iDzlSaJrinEo5+7vRiteOSwBhHRiAyQATN1AmY4hwzxJKPmYf+w==} + engines: {node: '>= 0.4'} + + is-date-object@1.0.5: + resolution: {integrity: sha512-9YQaSxsAiSwcvS33MBk3wTCVnWK+HhF8VZR2jRxehM16QcVOdHqPn4VPHmRK4lSr38n9JriurInLcP90xsYNfQ==} + engines: {node: '>= 0.4'} + + is-extglob@2.1.1: + resolution: {integrity: sha512-SbKbANkN603Vi4jEZv49LeVJMn4yGwsbzZworEoyEiutsN3nJYdbO36zfhGJ6QEDpOZIFkDtnq5JRxmvl3jsoQ==} + engines: {node: '>=0.10.0'} + + is-finalizationregistry@1.0.2: + resolution: {integrity: sha512-0by5vtUJs8iFQb5TYUHHPudOR+qXYIMKtiUzvLIZITZUjknFmziyBJuLhVRc+Ds0dREFlskDNJKYIdIzu/9pfw==} + + is-fullwidth-code-point@3.0.0: + resolution: {integrity: sha512-zymm5+u+sCsSWyD9qNaejV3DFvhCKclKdizYaJUuHA83RLjb7nSuGnddCHGv0hk+KY7BMAlsWeK4Ueg6EV6XQg==} + engines: {node: '>=8'} + + is-generator-fn@2.1.0: + resolution: {integrity: sha512-cTIB4yPYL/Grw0EaSzASzg6bBy9gqCofvWN8okThAYIxKJZC+udlRAmGbM0XLeniEJSs8uEgHPGuHSe1XsOLSQ==} + engines: {node: '>=6'} + + is-generator-function@1.0.10: + resolution: {integrity: sha512-jsEjy9l3yiXEQ+PsXdmBwEPcOxaXWLspKdplFUVI9vq1iZgIekeC0L167qeu86czQaxed3q/Uzuw0swL0irL8A==} + engines: {node: '>= 0.4'} + + is-glob@4.0.3: + resolution: {integrity: sha512-xelSayHH36ZgE7ZWhli7pW34hNbNl8Ojv5KVmkJD4hBdD3th8Tfk9vYasLM+mXWOZhFkgZfxhLSnrwRr4elSSg==} + engines: {node: '>=0.10.0'} + + is-map@2.0.3: + resolution: {integrity: sha512-1Qed0/Hr2m+YqxnM09CjA2d/i6YZNfF6R2oRAOj36eUdS6qIV/huPJNSEpKbupewFs+ZsJlxsjjPbc0/afW6Lw==} + engines: {node: '>= 0.4'} + + is-negative-zero@2.0.3: + resolution: {integrity: sha512-5KoIu2Ngpyek75jXodFvnafB6DJgr3u8uuK0LEZJjrU19DrMD3EVERaR8sjz8CCGgpZvxPl9SuE1GMVPFHx1mw==} + engines: {node: '>= 0.4'} + + is-number-object@1.0.7: + resolution: {integrity: sha512-k1U0IRzLMo7ZlYIfzRu23Oh6MiIFasgpb9X76eqfFZAqwH44UI4KTBvBYIZ1dSL9ZzChTB9ShHfLkR4pdW5krQ==} + engines: {node: '>= 0.4'} + + is-number@7.0.0: + resolution: {integrity: sha512-41Cifkg6e8TylSpdtTpeLVMqvSBEVzTttHvERD741+pnZ8ANv0004MRL43QKPDlK9cGvNp6NZWZUBlbGXYxxng==} + engines: {node: '>=0.12.0'} + + is-potential-custom-element-name@1.0.1: + resolution: {integrity: sha512-bCYeRA2rVibKZd+s2625gGnGF/t7DSqDs4dP7CrLA1m7jKWz6pps0LpYLJN8Q64HtmPKJ1hrN3nzPNKFEKOUiQ==} + + is-regex@1.1.4: + resolution: {integrity: sha512-kvRdxDsxZjhzUX07ZnLydzS1TU/TJlTUHHY4YLL87e37oUA49DfkLqgy+VjFocowy29cKvcSiu+kIv728jTTVg==} + engines: {node: '>= 0.4'} + + is-set@2.0.3: + resolution: {integrity: sha512-iPAjerrse27/ygGLxw+EBR9agv9Y6uLeYVJMu+QNCoouJ1/1ri0mGrcWpfCqFZuzzx3WjtwxG098X+n4OuRkPg==} + engines: {node: '>= 0.4'} + + is-shared-array-buffer@1.0.3: + resolution: {integrity: sha512-nA2hv5XIhLR3uVzDDfCIknerhx8XUKnstuOERPNNIinXG7v9u+ohXF67vxm4TPTEPU6lm61ZkwP3c9PCB97rhg==} + engines: {node: '>= 0.4'} + + is-stream@2.0.1: + resolution: {integrity: sha512-hFoiJiTl63nn+kstHGBtewWSKnQLpyb155KHheA1l39uvtO9nWIop1p3udqPcUd/xbF1VLMO4n7OI6p7RbngDg==} + engines: {node: '>=8'} + + is-string@1.0.7: + resolution: {integrity: sha512-tE2UXzivje6ofPW7l23cjDOMa09gb7xlAqG6jG5ej6uPV32TlWP3NKPigtaGeHNu9fohccRYvIiZMfOOnOYUtg==} + engines: {node: '>= 0.4'} + + is-symbol@1.0.4: + resolution: {integrity: sha512-C/CPBqKWnvdcxqIARxyOh4v1UUEOCHpgDa0WYgpKDFMszcrPcffg5uhwSgPCLD2WWxmq6isisz87tzT01tuGhg==} + engines: {node: '>= 0.4'} + + is-typed-array@1.1.13: + resolution: {integrity: sha512-uZ25/bUAlUY5fR4OKT4rZQEBrzQWYV9ZJYGGsUmEJ6thodVJ1HX64ePQ6Z0qPWP+m+Uq6e9UugrE38jeYsDSMw==} + engines: {node: '>= 0.4'} + + is-weakmap@2.0.2: + resolution: {integrity: sha512-K5pXYOm9wqY1RgjpL3YTkF39tni1XajUIkawTLUo9EZEVUFga5gSQJF8nNS7ZwJQ02y+1YCNYcMh+HIf1ZqE+w==} + engines: {node: '>= 0.4'} + + is-weakref@1.0.2: + resolution: {integrity: sha512-qctsuLZmIQ0+vSSMfoVvyFe2+GSEvnmZ2ezTup1SBse9+twCCeial6EEi3Nc2KFcf6+qz2FBPnjXsk8xhKSaPQ==} + + is-weakset@2.0.3: + resolution: {integrity: sha512-LvIm3/KWzS9oRFHugab7d+M/GcBXuXX5xZkzPmN+NxihdQlZUQ4dWuSV1xR/sq6upL1TJEDrfBgRepHFdBtSNQ==} + engines: {node: '>= 0.4'} + + isarray@1.0.0: + resolution: {integrity: sha512-VLghIWNM6ELQzo7zwmcg0NmTVyWKYjvIeM83yjp0wRDTmUnrM678fQbcKBo6n2CJEF0szoG//ytg+TKla89ALQ==} + + isarray@2.0.5: + resolution: {integrity: sha512-xHjhDr3cNBK0BzdUJSPXZntQUx/mwMS5Rw4A7lPJ90XGAO6ISP/ePDNuo0vhqOZU+UD5JoodwCAAoZQd3FeAKw==} + + isexe@2.0.0: + resolution: {integrity: sha512-RHxMLp9lnKHGHRng9QFhRCMbYAcVpn69smSGcq3f36xjgVVWThj4qqLbTLlq7Ssj8B+fIQ1EuCEGI2lKsyQeIw==} + + isomorphic.js@0.2.5: + resolution: {integrity: sha512-PIeMbHqMt4DnUP3MA/Flc0HElYjMXArsw1qwJZcm9sqR8mq3l8NYizFMty0pWwE/tzIGH3EKK5+jes5mAr85yw==} + + istanbul-lib-coverage@3.2.2: + resolution: {integrity: sha512-O8dpsF+r0WV/8MNRKfnmrtCWhuKjxrq2w+jpzBL5UZKTi2LeVWnWOmWRxFlesJONmc+wLAGvKQZEOanko0LFTg==} + engines: {node: '>=8'} + + istanbul-lib-instrument@5.2.1: + resolution: {integrity: sha512-pzqtp31nLv/XFOzXGuvhCb8qhjmTVo5vjVk19XE4CRlSWz0KoeJ3bw9XsA7nOp9YBf4qHjwBxkDzKcME/J29Yg==} + engines: {node: '>=8'} + + istanbul-lib-instrument@6.0.3: + resolution: {integrity: sha512-Vtgk7L/R2JHyyGW07spoFlB8/lpjiOLTjMdms6AFMraYt3BaJauod/NGrfnVG/y4Ix1JEuMRPDPEj2ua+zz1/Q==} + engines: {node: '>=10'} + + istanbul-lib-report@3.0.1: + resolution: {integrity: sha512-GCfE1mtsHGOELCU8e/Z7YWzpmybrx/+dSTfLrvY8qRmaY6zXTKWn6WQIjaAFw069icm6GVMNkgu0NzI4iPZUNw==} + engines: {node: '>=10'} + + istanbul-lib-source-maps@4.0.1: + resolution: {integrity: sha512-n3s8EwkdFIJCG3BPKBYvskgXGoy88ARzvegkitk60NxRdwltLOTaH7CUiMRXvwYorl0Q712iEjcWB+fK/MrWVw==} + engines: {node: '>=10'} + + istanbul-reports@3.1.7: + resolution: {integrity: sha512-BewmUXImeuRk2YY0PVbxgKAysvhRPUQE0h5QRM++nVWyubKGV0l8qQ5op8+B2DOmwSe63Jivj0BjkPQVf8fP5g==} + engines: {node: '>=8'} + + iterator.prototype@1.1.2: + resolution: {integrity: sha512-DR33HMMr8EzwuRL8Y9D3u2BMj8+RqSE850jfGu59kS7tbmPLzGkZmVSfyCFSDxuZiEY6Rzt3T2NA/qU+NwVj1w==} + + jackspeak@2.3.6: + resolution: {integrity: sha512-N3yCS/NegsOBokc8GAdM8UcmfsKiSS8cipheD/nivzr700H+nsMOxJjQnvwOcRYVuFkdH0wGUvW2WbXGmrZGbQ==} + engines: {node: '>=14'} + + jest-changed-files@29.7.0: + resolution: {integrity: sha512-fEArFiwf1BpQ+4bXSprcDc3/x4HSzL4al2tozwVpDFpsxALjLYdyiIK4e5Vz66GQJIbXJ82+35PtysofptNX2w==} + engines: {node: ^14.15.0 || ^16.10.0 || >=18.0.0} + + jest-circus@29.7.0: + resolution: {integrity: sha512-3E1nCMgipcTkCocFwM90XXQab9bS+GMsjdpmPrlelaxwD93Ad8iVEjX/vvHPdLPnFf+L40u+5+iutRdA1N9myw==} + engines: {node: ^14.15.0 || ^16.10.0 || >=18.0.0} + + jest-cli@29.7.0: + resolution: {integrity: sha512-OVVobw2IubN/GSYsxETi+gOe7Ka59EFMR/twOU3Jb2GnKKeMGJB5SGUUrEz3SFVmJASUdZUzy83sLNNQ2gZslg==} + engines: {node: ^14.15.0 || ^16.10.0 || >=18.0.0} + hasBin: true + peerDependencies: + node-notifier: ^8.0.1 || ^9.0.0 || ^10.0.0 + peerDependenciesMeta: + node-notifier: + optional: true + + jest-config@29.7.0: + resolution: {integrity: sha512-uXbpfeQ7R6TZBqI3/TxCU4q4ttk3u0PJeC+E0zbfSoSjq6bJ7buBPxzQPL0ifrkY4DNu4JUdk0ImlBUYi840eQ==} + engines: {node: ^14.15.0 || ^16.10.0 || >=18.0.0} + peerDependencies: + '@types/node': '*' + ts-node: '>=9.0.0' + peerDependenciesMeta: + '@types/node': + optional: true + ts-node: + optional: true + + jest-diff@29.7.0: + resolution: {integrity: sha512-LMIgiIrhigmPrs03JHpxUh2yISK3vLFPkAodPeo0+BuF7wA2FoQbkEg1u8gBYBThncu7e1oEDUfIXVuTqLRUjw==} + engines: {node: ^14.15.0 || ^16.10.0 || >=18.0.0} + + jest-docblock@29.7.0: + resolution: {integrity: sha512-q617Auw3A612guyaFgsbFeYpNP5t2aoUNLwBUbc/0kD1R4t9ixDbyFTHd1nok4epoVFpr7PmeWHrhvuV3XaJ4g==} + engines: {node: ^14.15.0 || ^16.10.0 || >=18.0.0} + + jest-each@29.7.0: + resolution: {integrity: sha512-gns+Er14+ZrEoC5fhOfYCY1LOHHr0TI+rQUHZS8Ttw2l7gl+80eHc/gFf2Ktkw0+SIACDTeWvpFcv3B04VembQ==} + engines: {node: ^14.15.0 || ^16.10.0 || >=18.0.0} + + jest-environment-jsdom@29.7.0: + resolution: {integrity: sha512-k9iQbsf9OyOfdzWH8HDmrRT0gSIcX+FLNW7IQq94tFX0gynPwqDTW0Ho6iMVNjGz/nb+l/vW3dWM2bbLLpkbXA==} + engines: {node: ^14.15.0 || ^16.10.0 || >=18.0.0} + peerDependencies: + canvas: ^2.5.0 + peerDependenciesMeta: + canvas: + optional: true + + jest-environment-node@29.7.0: + resolution: {integrity: sha512-DOSwCRqXirTOyheM+4d5YZOrWcdu0LNZ87ewUoywbcb2XR4wKgqiG8vNeYwhjFMbEkfju7wx2GYH0P2gevGvFw==} + engines: {node: ^14.15.0 || ^16.10.0 || >=18.0.0} + + jest-get-type@29.6.3: + resolution: {integrity: sha512-zrteXnqYxfQh7l5FHyL38jL39di8H8rHoecLH3JNxH3BwOrBsNeabdap5e0I23lD4HHI8W5VFBZqG4Eaq5LNcw==} + engines: {node: ^14.15.0 || ^16.10.0 || >=18.0.0} + + jest-haste-map@29.7.0: + resolution: {integrity: sha512-fP8u2pyfqx0K1rGn1R9pyE0/KTn+G7PxktWidOBTqFPLYX0b9ksaMFkhK5vrS3DVun09pckLdlx90QthlW7AmA==} + engines: {node: ^14.15.0 || ^16.10.0 || >=18.0.0} + + jest-leak-detector@29.7.0: + resolution: {integrity: sha512-kYA8IJcSYtST2BY9I+SMC32nDpBT3J2NvWJx8+JCuCdl/CR1I4EKUJROiP8XtCcxqgTTBGJNdbB1A8XRKbTetw==} + engines: {node: ^14.15.0 || ^16.10.0 || >=18.0.0} + + jest-matcher-utils@29.7.0: + resolution: {integrity: sha512-sBkD+Xi9DtcChsI3L3u0+N0opgPYnCRPtGcQYrgXmR+hmt/fYfWAL0xRXYU8eWOdfuLgBe0YCW3AFtnRLagq/g==} + engines: {node: ^14.15.0 || ^16.10.0 || >=18.0.0} + + jest-message-util@29.7.0: + resolution: {integrity: sha512-GBEV4GRADeP+qtB2+6u61stea8mGcOT4mCtrYISZwfu9/ISHFJ/5zOMXYbpBE9RsS5+Gb63DW4FgmnKJ79Kf6w==} + engines: {node: ^14.15.0 || ^16.10.0 || >=18.0.0} + + jest-mock@29.7.0: + resolution: {integrity: sha512-ITOMZn+UkYS4ZFh83xYAOzWStloNzJFO2s8DWrE4lhtGD+AorgnbkiKERe4wQVBydIGPx059g6riW5Btp6Llnw==} + engines: {node: ^14.15.0 || ^16.10.0 || >=18.0.0} + + jest-pnp-resolver@1.2.3: + resolution: {integrity: sha512-+3NpwQEnRoIBtx4fyhblQDPgJI0H1IEIkX7ShLUjPGA7TtUTvI1oiKi3SR4oBR0hQhQR80l4WAe5RrXBwWMA8w==} + engines: {node: '>=6'} + peerDependencies: + jest-resolve: '*' + peerDependenciesMeta: + jest-resolve: + optional: true + + jest-regex-util@29.6.3: + resolution: {integrity: sha512-KJJBsRCyyLNWCNBOvZyRDnAIfUiRJ8v+hOBQYGn8gDyF3UegwiP4gwRR3/SDa42g1YbVycTidUF3rKjyLFDWbg==} + engines: {node: ^14.15.0 || ^16.10.0 || >=18.0.0} + + jest-resolve-dependencies@29.7.0: + resolution: {integrity: sha512-un0zD/6qxJ+S0et7WxeI3H5XSe9lTBBR7bOHCHXkKR6luG5mwDDlIzVQ0V5cZCuoTgEdcdwzTghYkTWfubi+nA==} + engines: {node: ^14.15.0 || ^16.10.0 || >=18.0.0} + + jest-resolve@29.7.0: + resolution: {integrity: sha512-IOVhZSrg+UvVAshDSDtHyFCCBUl/Q3AAJv8iZ6ZjnZ74xzvwuzLXid9IIIPgTnY62SJjfuupMKZsZQRsCvxEgA==} + engines: {node: ^14.15.0 || ^16.10.0 || >=18.0.0} + + jest-runner@29.7.0: + resolution: {integrity: sha512-fsc4N6cPCAahybGBfTRcq5wFR6fpLznMg47sY5aDpsoejOcVYFb07AHuSnR0liMcPTgBsA3ZJL6kFOjPdoNipQ==} + engines: {node: ^14.15.0 || ^16.10.0 || >=18.0.0} + + jest-runtime@29.7.0: + resolution: {integrity: sha512-gUnLjgwdGqW7B4LvOIkbKs9WGbn+QLqRQQ9juC6HndeDiezIwhDP+mhMwHWCEcfQ5RUXa6OPnFF8BJh5xegwwQ==} + engines: {node: ^14.15.0 || ^16.10.0 || >=18.0.0} + + jest-snapshot@29.7.0: + resolution: {integrity: sha512-Rm0BMWtxBcioHr1/OX5YCP8Uov4riHvKPknOGs804Zg9JGZgmIBkbtlxJC/7Z4msKYVbIJtfU+tKb8xlYNfdkw==} + engines: {node: ^14.15.0 || ^16.10.0 || >=18.0.0} + + jest-util@29.7.0: + resolution: {integrity: sha512-z6EbKajIpqGKU56y5KBUgy1dt1ihhQJgWzUlZHArA/+X2ad7Cb5iF+AK1EWVL/Bo7Rz9uurpqw6SiBCefUbCGA==} + engines: {node: ^14.15.0 || ^16.10.0 || >=18.0.0} + + jest-validate@29.7.0: + resolution: {integrity: sha512-ZB7wHqaRGVw/9hST/OuFUReG7M8vKeq0/J2egIGLdvjHCmYqGARhzXmtgi+gVeZ5uXFF219aOc3Ls2yLg27tkw==} + engines: {node: ^14.15.0 || ^16.10.0 || >=18.0.0} + + jest-watcher@29.7.0: + resolution: {integrity: sha512-49Fg7WXkU3Vl2h6LbLtMQ/HyB6rXSIX7SqvBLQmssRBGN9I0PNvPmAmCWSOY6SOvrjhI/F7/bGAv9RtnsPA03g==} + engines: {node: ^14.15.0 || ^16.10.0 || >=18.0.0} + + jest-worker@29.7.0: + resolution: {integrity: sha512-eIz2msL/EzL9UFTFFx7jBTkeZfku0yUAyZZZmJ93H2TYEiroIx2PQjEXcwYtYl8zXCxb+PAmA2hLIt/6ZEkPHw==} + engines: {node: ^14.15.0 || ^16.10.0 || >=18.0.0} + + jest@29.7.0: + resolution: {integrity: sha512-NIy3oAFp9shda19hy4HK0HRTWKtPJmGdnvywu01nOqNC2vZg+Z+fvJDxpMQA88eb2I9EcafcdjYgsDthnYTvGw==} + engines: {node: ^14.15.0 || ^16.10.0 || >=18.0.0} + hasBin: true + peerDependencies: + node-notifier: ^8.0.1 || ^9.0.0 || ^10.0.0 + peerDependenciesMeta: + node-notifier: + optional: true + + js-tokens@4.0.0: + resolution: {integrity: sha512-RdJUflcE3cUzKiMqQgsCu06FPu9UdIJO0beYbPhHN4k6apgJtifcoCtT9bcxOpYBtpD2kCM6Sbzg4CausW/PKQ==} + + js-yaml@3.14.1: + resolution: {integrity: sha512-okMH7OXXJ7YrN9Ok3/SXrnu4iX9yOk+25nqX4imS2npuvTYDmo/QEZoqwZkYaIDk3jVvBOTOIEgEhaLOynBS9g==} + hasBin: true + + js-yaml@4.1.0: + resolution: {integrity: sha512-wpxZs9NoxZaJESJGIZTyDEaYpl0FKSA+FB9aJiyemKhMwkxQg63h4T1KJgUGHpTqPDNRcmmYLugrRjJlBtWvRA==} + hasBin: true + + jsdom@20.0.3: + resolution: {integrity: sha512-SYhBvTh89tTfCD/CRdSOm13mOBa42iTaTyfyEWBdKcGdPxPtLFBXuHR8XHb33YNYaP+lLbmSvBTsnoesCNJEsQ==} + engines: {node: '>=14'} + peerDependencies: + canvas: ^2.5.0 + peerDependenciesMeta: + canvas: + optional: true + + jsesc@3.0.2: + resolution: {integrity: sha512-xKqzzWXDttJuOcawBt4KnKHHIf5oQ/Cxax+0PWFG+DFDgHNAdi+TXECADI+RYiFUMmx8792xsMbbgXj4CwnP4g==} + engines: {node: '>=6'} + hasBin: true + + json-buffer@3.0.1: + resolution: {integrity: sha512-4bV5BfR2mqfQTJm+V5tPPdf+ZpuhiIvTuAB5g8kcrXOZpTT/QwwVRWBywX1ozr6lEuPdbHxwaJlm9G6mI2sfSQ==} + + json-parse-even-better-errors@2.3.1: + resolution: {integrity: sha512-xyFwyhro/JEof6Ghe2iz2NcXoj2sloNsWr/XsERDK/oiPCfaNhl5ONfp+jQdAZRQQ0IJWNzH9zIZF7li91kh2w==} + + json-schema-traverse@0.4.1: + resolution: {integrity: sha512-xbbCH5dCYU5T8LcEhhuh7HJ88HXuW3qsI3Y0zOZFKfZEHcpWiHU/Jxzk629Brsab/mMiHQti9wMP+845RPe3Vg==} + + json-stable-stringify-without-jsonify@1.0.1: + resolution: {integrity: sha512-Bdboy+l7tA3OGW6FjyFHWkP5LuByj1Tk33Ljyq0axyzdk9//JSi2u3fP1QSmd1KNwq6VOKYGlAu87CisVir6Pw==} + + json2mq@0.2.0: + resolution: {integrity: sha512-SzoRg7ux5DWTII9J2qkrZrqV1gt+rTaoufMxEzXbS26Uid0NwaJd123HcoB80TgubEppxxIGdNxCx50fEoEWQA==} + + json5@1.0.2: + resolution: {integrity: sha512-g1MWMLBiz8FKi1e4w0UyVL3w+iJceWAFBAaBnnGKOpNa5f8TLktkbre1+s6oICydWAm+HRUGTmI+//xv2hvXYA==} + hasBin: true + + json5@2.2.3: + resolution: {integrity: sha512-XmOWe7eyHYH14cLdVPoyg+GOH3rYX++KpzrylJwSW98t3Nk+U8XOl8FWKOgwtzdb8lXGf6zYwDUzeHMWfxasyg==} + engines: {node: '>=6'} + hasBin: true + + jsx-ast-utils@3.3.5: + resolution: {integrity: sha512-ZZow9HBI5O6EPgSJLUb8n2NKgmVWTwCvHGwFuJlMjvLFqlGG6pjirPhtdsseaLZjSibD8eegzmYpUZwoIlj2cQ==} + engines: {node: '>=4.0'} + + jszip@3.10.1: + resolution: {integrity: sha512-xXDvecyTpGLrqFrvkrUSoxxfJI5AH7U8zxxtVclpsUtMCq4JQ290LY8AW5c7Ggnr/Y/oK+bQMbqK2qmtk3pN4g==} + + jwt-decode@4.0.0: + resolution: {integrity: sha512-+KJGIyHgkGuIq3IEBNftfhW/LfWhXUIY6OmyVWjliu5KH1y0fw7VQ8YndE2O4qZdMSd9SqbnC8GOcZEy0Om7sA==} + engines: {node: '>=18'} + + keyv@4.5.4: + resolution: {integrity: sha512-oxVHkHR/EJf2CNXnWxRLW6mg7JyCCUcG0DtEGmL2ctUo1PNTin1PUil+r/+4r5MpVgC/fn1kjsx7mjSujKqIpw==} + + kleur@3.0.3: + resolution: {integrity: sha512-eTIzlVOSUR+JxdDFepEYcBMtZ9Qqdef+rnzWdRZuMbOywu5tO2w2N7rqjoANZ5k9vywhL6Br1VRjUIgTQx4E8w==} + engines: {node: '>=6'} + + language-subtag-registry@0.3.23: + resolution: {integrity: sha512-0K65Lea881pHotoGEa5gDlMxt3pctLi2RplBb7Ezh4rRdLEOtgi7n4EwK9lamnUCkKBqaeKRVebTq6BAxSkpXQ==} + + language-tags@1.0.9: + resolution: {integrity: sha512-MbjN408fEndfiQXbFQ1vnd+1NoLDsnQW41410oQBXiyXDMYH5z505juWa4KUE1LqxRC7DgOgZDbKLxHIwm27hA==} + engines: {node: '>=0.10'} + + leven@3.1.0: + resolution: {integrity: sha512-qsda+H8jTaUaN/x5vzW2rzc+8Rw4TAQ/4KjB46IwK5VH+IlVeeeje/EoZRpiXvIqjFgK84QffqPztGI3VBLG1A==} + engines: {node: '>=6'} + + levn@0.4.1: + resolution: {integrity: sha512-+bT2uH4E5LGE7h/n3evcS/sQlJXCpIp6ym8OWJ5eV6+67Dsql/LaaT7qJBAt2rzfoa/5QBGBhxDix1dMt2kQKQ==} + engines: {node: '>= 0.8.0'} + + lib0@0.2.98: + resolution: {integrity: sha512-XteTiNO0qEXqqweWx+b21p/fBnNHUA1NwAtJNJek1oPrewEZs2uiT4gWivHKr9GqCjDPAhchz0UQO8NwU3bBNA==} + engines: {node: '>=16'} + hasBin: true + + lie@3.3.0: + resolution: {integrity: sha512-UaiMJzeWRlEujzAuw5LokY1L5ecNQYZKfmyZ9L7wDHb/p5etKaxXhohBcrw0EYby+G/NA52vRSN4N39dxHAIwQ==} + + lines-and-columns@1.2.4: + resolution: {integrity: sha512-7ylylesZQ/PV29jhEDl3Ufjo6ZX7gCqJr5F7PKrqc93v7fzSymt1BpwEU8nAUXs8qzzvqhbjhK5QZg6Mt/HkBg==} + + locate-path@5.0.0: + resolution: {integrity: sha512-t7hw9pI+WvuwNJXwk5zVHpyhIqzg2qTlklJOf0mVxGSbe3Fp2VieZcduNYjaLDoy6p9uGpQEGWG87WpMKlNq8g==} + engines: {node: '>=8'} + + lodash.merge@4.6.2: + resolution: {integrity: sha512-0KpjqXRVvrYyCsX1swR/XTK0va6VQkQM6MNo7PqW77ByjAhoARA8EfrP1N4+KlKj8YS0ZUCtRT/YUuhyYDujIQ==} + + lodash@4.17.21: + resolution: {integrity: sha512-v2kDEe57lecTulaDIuNTPy3Ry4gLGJ6Z1O3vE1krgXZNrsQ+LFTGHVxVjcXPs17LhbZVGedAJv8XZ1tvj5FvSg==} + + loose-envify@1.4.0: + resolution: {integrity: sha512-lyuxPGr/Wfhrlem2CL/UcnUc1zcqKAImBDzukY7Y5F/yQiNdko6+fRLevlw1HgMySw7f611UIY408EtxRSoK3Q==} + hasBin: true + + lru-cache@10.4.3: + resolution: {integrity: sha512-JNAzZcXrCt42VGLuYz0zfAzDfAvJWW6AfYlDBQyDV5DClI2m5sAmK+OIO7s59XfsRsWHp02jAJrRadPRGTt6SQ==} + + lru-cache@5.1.1: + resolution: {integrity: sha512-KpNARQA3Iwv+jTA0utUVVbrh+Jlrr1Fv0e56GGzAFOXN7dk/FviaDW8LHmK52DlcH4WP2n6gI8vN1aesBFgo9w==} + + lz-string@1.5.0: + resolution: {integrity: sha512-h5bgJWpxJNswbU7qCrV0tIKQCaS3blPDrqKWx+QxzuzL1zGUzij9XCWLrSLsJPu5t+eWA/ycetzYAO5IOMcWAQ==} + hasBin: true + + make-dir@4.0.0: + resolution: {integrity: sha512-hXdUTZYIVOt1Ex//jAQi+wTZZpUpwBj/0QsOzqegb3rGMMeJiSEu5xLHnYfBrRV4RH2+OCSOO95Is/7x1WJ4bw==} + engines: {node: '>=10'} + + make-error@1.3.6: + resolution: {integrity: sha512-s8UhlNe7vPKomQhC1qFelMokr/Sc3AgNbso3n74mVPA5LTZwkB9NlXf4XPamLxJE8h0gh73rM94xvwRT2CVInw==} + + makeerror@1.0.12: + resolution: {integrity: sha512-JmqCvUhmt43madlpFzG4BQzG2Z3m6tvQDNKdClZnO3VbIudJYmxsT0FNJMeiB2+JTSlTQTSbU8QdesVmwJcmLg==} + + merge-stream@2.0.0: + resolution: {integrity: sha512-abv/qOcuPfk3URPfDzmZU1LKmuw8kT+0nIHvKrKgFrwifol/doWcdA4ZqsWQ8ENrFKkd67Mfpo/LovbIUsbt3w==} + + merge2@1.4.1: + resolution: {integrity: sha512-8q7VEgMJW4J8tcfVPy8g09NcQwZdbwFEqhe/WZkoIzjn/3TGDwtOCYtXGxA3O8tPzpczCCDgv+P2P5y00ZJOOg==} + engines: {node: '>= 8'} + + micromatch@4.0.8: + resolution: {integrity: sha512-PXwfBhYu0hBCPw8Dn0E+WDYb7af3dSLVWKi3HGv84IdF4TyFoC0ysxFd0Goxw7nSv4T/PzEJQxsYsEiFCKo2BA==} + engines: {node: '>=8.6'} + + mime-db@1.52.0: + resolution: {integrity: sha512-sPU4uV7dYlvtWJxwwxHD0PuihVNiE7TyAbQ5SWxDCB9mUYvOgroQOwYQQOKPJ8CIbE+1ETVlOoK1UC2nU3gYvg==} + engines: {node: '>= 0.6'} + + mime-types@2.1.35: + resolution: {integrity: sha512-ZDY+bPm5zTTF+YpCrAU9nK0UgICYPT0QtT1NZWFv4s++TNkcgVaT0g6+4R2uI4MjQjzysHB1zxuWL50hzaeXiw==} + engines: {node: '>= 0.6'} + + mimic-fn@2.1.0: + resolution: {integrity: sha512-OqbOk5oEQeAZ8WXWydlu9HJjz9WVdEIvamMCcXmuqUYjTknH/sqsWvhQ3vgwKFRR1HpjvNBKQ37nbJgYzGqGcg==} + engines: {node: '>=6'} + + min-indent@1.0.1: + resolution: {integrity: sha512-I9jwMn07Sy/IwOj3zVkVik2JTvgpaykDZEigL6Rx6N9LbMywwUSMtxET+7lVoDLLd3O3IXwJwvuuns8UB/HeAg==} + engines: {node: '>=4'} + + minimatch@3.1.2: + resolution: {integrity: sha512-J7p63hRiAjw1NDEww1W7i37+ByIrOWO5XQQAzZ3VOcL0PNybwpfmV/N05zFAzwQ9USyEcX6t3UO+K5aqBQOIHw==} + + minimatch@9.0.5: + resolution: {integrity: sha512-G6T0ZX48xgozx7587koeX9Ys2NYy6Gmv//P89sEte9V9whIapMNF4idKxnW2QtCcLiTWlb/wfCabAtAFWhhBow==} + engines: {node: '>=16 || 14 >=14.17'} + + minimist@1.2.8: + resolution: {integrity: sha512-2yyAR8qBkN3YuheJanUpWC5U3bb5osDywNB8RzDVlDwDHbocAJveqqj1u8+SVD7jkWT4yvsHCpWqqWqAxb0zCA==} + + minipass@7.1.2: + resolution: {integrity: sha512-qOOzS1cBTWYF4BH8fVePDBOO9iptMnGUEZwNc/cMWnTV2nVLZ7VoNWEPHkYczZA0pdoA7dl6e7FL659nX9S2aw==} + engines: {node: '>=16 || 14 >=14.17'} + + ms@2.1.3: + resolution: {integrity: sha512-6FlzubTLZG3J2a/NVCAleEhjzq5oxgHyaCU9yYXvcLsvoVaHJq/s5xXI6/XXP6tz7R9xAOtHnSO/tXtF3WRTlA==} + + nanoid@3.3.7: + resolution: {integrity: sha512-eSRppjcPIatRIMC1U6UngP8XFcz8MQWGQdt1MTBQ7NaAmvXDfvNxbvWV3x2y6CdEUciCSsDHDQZbhYaB8QEo2g==} + engines: {node: ^10 || ^12 || ^13.7 || ^14 || >=15.0.1} + hasBin: true + + natural-compare@1.4.0: + resolution: {integrity: sha512-OWND8ei3VtNC9h7V60qff3SVobHr996CTwgxubgyQYEpg290h9J0buyECNNJexkFm5sOajh5G116RYA1c8ZMSw==} + + next@14.2.13: + resolution: {integrity: sha512-BseY9YNw8QJSwLYD7hlZzl6QVDoSFHL/URN5K64kVEVpCsSOWeyjbIGK+dZUaRViHTaMQX8aqmnn0PHBbGZezg==} + engines: {node: '>=18.17.0'} + hasBin: true + peerDependencies: + '@opentelemetry/api': ^1.1.0 + '@playwright/test': ^1.41.2 + react: ^18.2.0 + react-dom: ^18.2.0 + sass: ^1.3.0 + peerDependenciesMeta: + '@opentelemetry/api': + optional: true + '@playwright/test': + optional: true + sass: + optional: true + + node-int64@0.4.0: + resolution: {integrity: sha512-O5lz91xSOeoXP6DulyHfllpq+Eg00MWitZIbtPfoSEvqIHdl5gfcY6hYzDWnj0qD5tz52PI08u9qUvSVeUBeHw==} + + node-releases@2.0.18: + resolution: {integrity: sha512-d9VeXT4SJ7ZeOqGX6R5EM022wpL+eWPooLI+5UpWn2jCT1aosUQEhQP214x33Wkwx3JQMvIm+tIoVOdodFS40g==} + + normalize-path@3.0.0: + resolution: {integrity: sha512-6eZs5Ls3WtCisHWp9S2GUy8dqkpGi4BVSz3GaqiE6ezub0512ESztXUwUB6C6IKbQkY2Pnb/mD4WYojCRwcwLA==} + engines: {node: '>=0.10.0'} + + npm-run-path@4.0.1: + resolution: {integrity: sha512-S48WzZW777zhNIrn7gxOlISNAqi9ZC/uQFnRdbeIHhZhCA6UqpkOT8T1G7BvfdgP4Er8gF4sUbaS0i7QvIfCWw==} + engines: {node: '>=8'} + + nwsapi@2.2.13: + resolution: {integrity: sha512-cTGB9ptp9dY9A5VbMSe7fQBcl/tt22Vcqdq8+eN93rblOuE0aCFu4aZ2vMwct/2t+lFnosm8RkQW1I0Omb1UtQ==} + + object-assign@4.1.1: + resolution: {integrity: sha512-rJgTQnkUnH1sFw8yT6VSU3zD3sWmu6sZhIseY8VX+GRu3P6F7Fu+JNDoXfklElbLJSnc3FUQHVe4cU5hj+BcUg==} + engines: {node: '>=0.10.0'} + + object-inspect@1.13.2: + resolution: {integrity: sha512-IRZSRuzJiynemAXPYtPe5BoI/RESNYR7TYm50MC5Mqbd3Jmw5y790sErYw3V6SryFJD64b74qQQs9wn5Bg/k3g==} + engines: {node: '>= 0.4'} + + object-is@1.1.6: + resolution: {integrity: sha512-F8cZ+KfGlSGi09lJT7/Nd6KJZ9ygtvYC0/UYYLI9nmQKLMnydpB9yvbv9K1uSkEu7FU9vYPmVwLg328tX+ot3Q==} + engines: {node: '>= 0.4'} + + object-keys@1.1.1: + resolution: {integrity: sha512-NuAESUOUMrlIXOfHKzD6bpPu3tYt3xvjNdRIQ+FeT0lNb4K8WR70CaDxhuNguS2XG+GjkyMwOzsN5ZktImfhLA==} + engines: {node: '>= 0.4'} + + object.assign@4.1.5: + resolution: {integrity: sha512-byy+U7gp+FVwmyzKPYhW2h5l3crpmGsxl7X2s8y43IgxvG4g3QZ6CffDtsNQy1WsmZpQbO+ybo0AlW7TY6DcBQ==} + engines: {node: '>= 0.4'} + + object.entries@1.1.8: + resolution: {integrity: sha512-cmopxi8VwRIAw/fkijJohSfpef5PdN0pMQJN6VC/ZKvn0LIknWD8KtgY6KlQdEc4tIjcQ3HxSMmnvtzIscdaYQ==} + engines: {node: '>= 0.4'} + + object.fromentries@2.0.8: + resolution: {integrity: sha512-k6E21FzySsSK5a21KRADBd/NGneRegFO5pLHfdQLpRDETUNJueLXs3WCzyQ3tFRDYgbq3KHGXfTbi2bs8WQ6rQ==} + engines: {node: '>= 0.4'} + + object.groupby@1.0.3: + resolution: {integrity: sha512-+Lhy3TQTuzXI5hevh8sBGqbmurHbbIjAi0Z4S63nthVLmLxfbj4T54a4CfZrXIrt9iP4mVAPYMo/v99taj3wjQ==} + engines: {node: '>= 0.4'} + + object.values@1.2.0: + resolution: {integrity: sha512-yBYjY9QX2hnRmZHAjG/f13MzmBzxzYgQhFrke06TTyKY5zSTEqkOeukBzIdVA3j3ulu8Qa3MbVFShV7T2RmGtQ==} + engines: {node: '>= 0.4'} + + once@1.4.0: + resolution: {integrity: sha512-lNaJgI+2Q5URQBkccEKHTQOPaXdUxnZZElQTZY0MFUAuaEqe1E+Nyvgdz/aIyNi6Z9MzO5dv1H8n58/GELp3+w==} + + onetime@5.1.2: + resolution: {integrity: sha512-kbpaSSGJTWdAY5KPVeMOKXSrPtr8C8C7wodJbcsd51jRnmD+GZu8Y0VoU6Dm5Z4vWr0Ig/1NKuWRKf7j5aaYSg==} + engines: {node: '>=6'} + + optionator@0.9.4: + resolution: {integrity: sha512-6IpQ7mKUxRcZNLIObR0hz7lxsapSSIYNZJwXPGeF0mTVqGKFIXj1DQcMoT22S3ROcLyY/rz0PWaWZ9ayWmad9g==} + engines: {node: '>= 0.8.0'} + + p-limit@2.3.0: + resolution: {integrity: sha512-//88mFWSJx8lxCzwdAABTJL2MyWB12+eIY7MDL2SqLmAkeKU9qxRvWuSyTjm3FUmpBEMuFfckAIqEaVGUDxb6w==} + engines: {node: '>=6'} + + p-limit@3.1.0: + resolution: {integrity: sha512-TYOanM3wGwNGsZN2cVTYPArw454xnXj5qmWF1bEoAc4+cU/ol7GVh7odevjp1FNHduHc3KZMcFduxU5Xc6uJRQ==} + engines: {node: '>=10'} + + p-locate@4.1.0: + resolution: {integrity: sha512-R79ZZ/0wAxKGu3oYMlz8jy/kbhsNrS7SKZ7PxEHBgJ5+F2mtFW2fK2cOtBh1cHYkQsbzFV7I+EoRKe6Yt0oK7A==} + engines: {node: '>=8'} + + p-try@2.2.0: + resolution: {integrity: sha512-R4nPAVTAU0B9D35/Gk3uJf/7XYbQcyohSKdvAxIRSNghFl4e71hVoGnBNQz9cWaXxO2I10KTC+3jMdvvoKw6dQ==} + engines: {node: '>=6'} + + pako@1.0.11: + resolution: {integrity: sha512-4hLB8Py4zZce5s4yd9XzopqwVv/yGNhV1Bl8NTmCq1763HeK2+EwVTv+leGeL13Dnh2wfbqowVPXCIO0z4taYw==} + + parent-module@1.0.1: + resolution: {integrity: sha512-GQ2EWRpQV8/o+Aw8YqtfZZPfNRWZYkbidE9k5rpl/hC3vtHHBfGm2Ifi6qWV+coDGkrUKZAxE3Lot5kcsRlh+g==} + engines: {node: '>=6'} + + parse-json@5.2.0: + resolution: {integrity: sha512-ayCKvm/phCGxOkYRSCM82iDwct8/EonSEgCSxWxD7ve6jHggsFl4fZVQBPRNgQoKiuV/odhFrGzQXZwbifC8Rg==} + engines: {node: '>=8'} + + parse5@7.2.1: + resolution: {integrity: sha512-BuBYQYlv1ckiPdQi/ohiivi9Sagc9JG+Ozs0r7b/0iK3sKmrb0b9FdWdBbOdx6hBCM/F9Ir82ofnBhtZOjCRPQ==} + + path-exists@4.0.0: + resolution: {integrity: sha512-ak9Qy5Q7jYb2Wwcey5Fpvg2KoAc/ZIhLSLOSBmRmygPsGwkVVt0fZa0qrtMz+m6tJTAHfZQ8FnmB4MG4LWy7/w==} + engines: {node: '>=8'} + + path-is-absolute@1.0.1: + resolution: {integrity: sha512-AVbw3UJ2e9bq64vSaS9Am0fje1Pa8pbGqTTsmXfaIiMpnr5DlDhfJOuLj9Sf95ZPVDAUerDfEk88MPmPe7UCQg==} + engines: {node: '>=0.10.0'} + + path-key@3.1.1: + resolution: {integrity: sha512-ojmeN0qd+y0jszEtoY48r0Peq5dwMEkIlCOu6Q5f41lfkswXuKtYrhgoTpLnyIcHm24Uhqx+5Tqm2InSwLhE6Q==} + engines: {node: '>=8'} + + path-parse@1.0.7: + resolution: {integrity: sha512-LDJzPVEEEPR+y48z93A0Ed0yXb8pAByGWo/k5YYdYgpY2/2EsOsksJrq7lOHxryrVOn1ejG6oAp8ahvOIQD8sw==} + + path-scurry@1.11.1: + resolution: {integrity: sha512-Xa4Nw17FS9ApQFJ9umLiJS4orGjm7ZzwUrwamcGQuHSzDyth9boKDaycYdDcZDuqYATXw4HFXgaqWTctW/v1HA==} + engines: {node: '>=16 || 14 >=14.18'} + + peerjs-js-binarypack@2.1.0: + resolution: {integrity: sha512-YIwCC+pTzp3Bi8jPI9UFKO0t0SLo6xALnHkiNt/iUFmUUZG0fEEmEyFKvjsDKweiFitzHRyhuh6NvyJZ4nNxMg==} + engines: {node: '>= 14.0.0'} + + peerjs@1.5.4: + resolution: {integrity: sha512-yFsoLMnurJKlQbx6kVSBpOp+AlNldY1JQS2BrSsHLKCZnq6t7saHleuHM5svuLNbQkUJXHLF3sKOJB1K0xulOw==} + engines: {node: '>= 14'} + + picocolors@1.1.0: + resolution: {integrity: sha512-TQ92mBOW0l3LeMeyLV6mzy/kWr8lkd/hp3mTg7wYK7zJhuBStmGMBG0BdeDZS/dZx1IukaX6Bk11zcln25o1Aw==} + + picomatch@2.3.1: + resolution: {integrity: sha512-JU3teHTNjmE2VCGFzuY8EXzCDVwEqB2a8fsIvwaStHhAWJEeVd1o1QD80CU6+ZdEXXSLbSsuLwJjkCBWqRQUVA==} + engines: {node: '>=8.6'} + + pirates@4.0.6: + resolution: {integrity: sha512-saLsH7WeYYPiD25LDuLRRY/i+6HaPYr6G1OUlN39otzkSTxKnubR9RTxS3/Kk50s1g2JTgFwWQDQyplC5/SHZg==} + engines: {node: '>= 6'} + + pkg-dir@4.2.0: + resolution: {integrity: sha512-HRDzbaKjC+AOWVXxAU/x54COGeIv9eb+6CkDSQoNTt4XyWoIJvuPsXizxu/Fr23EiekbtZwmh1IcIG/l/a10GQ==} + engines: {node: '>=8'} + + possible-typed-array-names@1.0.0: + resolution: {integrity: sha512-d7Uw+eZoloe0EHDIYoe+bQ5WXnGMOpmiZFTuMWCwpjzzkL2nTjcKiAk4hh8TjnGye2TwWOk3UXucZ+3rbmBa8Q==} + engines: {node: '>= 0.4'} + + postcss@8.4.31: + resolution: {integrity: sha512-PS08Iboia9mts/2ygV3eLpY5ghnUcfLV/EXTOW1E2qYxJKGGBUtNjN76FYHnMs36RmARn41bC0AZmn+rR0OVpQ==} + engines: {node: ^10 || ^12 || >=14} + + prelude-ls@1.2.1: + resolution: {integrity: sha512-vkcDPrRZo1QZLbn5RLGPpg/WmIQ65qoWWhcGKf/b5eplkkarX0m9z8ppCat4mlOqUsWpyNuYgO3VRyrYHSzX5g==} + engines: {node: '>= 0.8.0'} + + pretty-format@27.5.1: + resolution: {integrity: sha512-Qb1gy5OrP5+zDf2Bvnzdl3jsTf1qXVMazbvCoKhtKqVs4/YK4ozX4gKQJJVyNe+cajNPn0KoC0MC3FUmaHWEmQ==} + engines: {node: ^10.13.0 || ^12.13.0 || ^14.15.0 || >=15.0.0} + + pretty-format@29.7.0: + resolution: {integrity: sha512-Pdlw/oPxN+aXdmM9R00JVC9WVFoCLTKJvDVLgmJ+qAffBMxsV85l/Lu7sNx4zSzPyoL2euImuEwHhOXdEgNFZQ==} + engines: {node: ^14.15.0 || ^16.10.0 || >=18.0.0} + + process-nextick-args@2.0.1: + resolution: {integrity: sha512-3ouUOpQhtgrbOa17J7+uxOTpITYWaGP7/AhoR3+A+/1e9skrzelGi/dXzEYyvbxubEF6Wn2ypscTKiKJFFn1ag==} + + progress@2.0.3: + resolution: {integrity: sha512-7PiHtLll5LdnKIMw100I+8xJXR5gW2QwWYkT6iJva0bXitZKa/XMrSbdmg3r2Xnaidz9Qumd0VPaMrZlF9V9sA==} + engines: {node: '>=0.4.0'} + + prompts@2.4.2: + resolution: {integrity: sha512-NxNv/kLguCA7p3jE8oL2aEBsrJWgAakBpgmgK6lpPWV+WuOmY6r2/zbAVnP+T8bQlA0nzHXSJSJW0Hq7ylaD2Q==} + engines: {node: '>= 6'} + + prop-types@15.8.1: + resolution: {integrity: sha512-oj87CgZICdulUohogVAR7AjlC0327U4el4L6eAvOqCeudMDVU0NThNaV+b9Df4dXgSP1gXMTnPdhfe/2qDH5cg==} + + psl@1.9.0: + resolution: {integrity: sha512-E/ZsdU4HLs/68gYzgGTkMicWTLPdAftJLfJFlLUAAKZGkStNU72sZjT66SnMDVOfOWY/YAoiD7Jxa9iHvngcag==} + + punycode@2.3.1: + resolution: {integrity: sha512-vYt7UD1U9Wg6138shLtLOvdAu+8DsC/ilFtEVHcH+wydcSpNE20AfSOduf6MkRFahL5FY7X1oU7nKVZFtfq8Fg==} + engines: {node: '>=6'} + + pure-rand@6.1.0: + resolution: {integrity: sha512-bVWawvoZoBYpp6yIoQtQXHZjmz35RSVHnUOTefl8Vcjr8snTPY1wnpSPMWekcFwbxI6gtmT7rSYPFvz71ldiOA==} + + querystringify@2.2.0: + resolution: {integrity: sha512-FIqgj2EUvTa7R50u0rGsyTftzjYmv/a3hO345bZNrqabNqjtgiDMgmo4mkUjd+nzU5oF3dClKqFIPUKybUyqoQ==} + + queue-microtask@1.2.3: + resolution: {integrity: sha512-NuaNSa6flKT5JaSYQzJok04JzTL1CA6aGhv5rfLW3PgqA+M2ChpZQnAC8h8i4ZFkBS8X5RqkDBHA7r4hej3K9A==} + + randombytes@2.1.0: + resolution: {integrity: sha512-vYl3iOX+4CKUWuxGi9Ukhie6fsqXqS9FE2Zaic4tNFD2N2QQaXOMFbuKK4QmDHC0JO6B1Zp41J0LpT0oR68amQ==} + + rc-cascader@3.28.1: + resolution: {integrity: sha512-9+8oHIMWVLHxuaapDiqFNmD9KSyKN/P4bo9x/MBuDbyTqP8f2/POmmZxdXWBO3yq/uE3pKyQCXYNUxrNfHRv2A==} + peerDependencies: + react: '>=16.9.0' + react-dom: '>=16.9.0' + + rc-checkbox@3.3.0: + resolution: {integrity: sha512-Ih3ZaAcoAiFKJjifzwsGiT/f/quIkxJoklW4yKGho14Olulwn8gN7hOBve0/WGDg5o/l/5mL0w7ff7/YGvefVw==} + peerDependencies: + react: '>=16.9.0' + react-dom: '>=16.9.0' + + rc-collapse@3.7.3: + resolution: {integrity: sha512-60FJcdTRn0X5sELF18TANwtVi7FtModq649H11mYF1jh83DniMoM4MqY627sEKRCTm4+WXfGDcB7hY5oW6xhyw==} + peerDependencies: + react: '>=16.9.0' + react-dom: '>=16.9.0' + + rc-dialog@9.5.2: + resolution: {integrity: sha512-qVUjc8JukG+j/pNaHVSRa2GO2/KbV2thm7yO4hepQ902eGdYK913sGkwg/fh9yhKYV1ql3BKIN2xnud3rEXAPw==} + peerDependencies: + react: '>=16.9.0' + react-dom: '>=16.9.0' + + rc-drawer@7.2.0: + resolution: {integrity: sha512-9lOQ7kBekEJRdEpScHvtmEtXnAsy+NGDXiRWc2ZVC7QXAazNVbeT4EraQKYwCME8BJLa8Bxqxvs5swwyOepRwg==} + peerDependencies: + react: '>=16.9.0' + react-dom: '>=16.9.0' + + rc-dropdown@4.2.0: + resolution: {integrity: sha512-odM8Ove+gSh0zU27DUj5cG1gNKg7mLWBYzB5E4nNLrLwBmYEgYP43vHKDGOVZcJSVElQBI0+jTQgjnq0NfLjng==} + peerDependencies: + react: '>=16.11.0' + react-dom: '>=16.11.0' + + rc-field-form@2.4.0: + resolution: {integrity: sha512-XZ/lF9iqf9HXApIHQHqzJK5v2w4mkUMsVqAzOyWVzoiwwXEavY6Tpuw7HavgzIoD+huVff4JghSGcgEfX6eycg==} + engines: {node: '>=8.x'} + peerDependencies: + react: '>=16.9.0' + react-dom: '>=16.9.0' + + rc-image@7.9.0: + resolution: {integrity: sha512-l4zqO5E0quuLMCtdKfBgj4Suv8tIS011F5k1zBBlK25iMjjiNHxA0VeTzGFtUZERSA45gvpXDg8/P6qNLjR25g==} + peerDependencies: + react: '>=16.9.0' + react-dom: '>=16.9.0' + + rc-input-number@9.2.0: + resolution: {integrity: sha512-5XZFhBCV5f9UQ62AZ2hFbEY8iZT/dm23Q1kAg0H8EvOgD3UDbYYJAayoVIkM3lQaCqYAW5gV0yV3vjw1XtzWHg==} + peerDependencies: + react: '>=16.9.0' + react-dom: '>=16.9.0' + + rc-input@1.6.3: + resolution: {integrity: sha512-wI4NzuqBS8vvKr8cljsvnTUqItMfG1QbJoxovCgL+DX4eVUcHIjVwharwevIxyy7H/jbLryh+K7ysnJr23aWIA==} + peerDependencies: + react: '>=16.0.0' + react-dom: '>=16.0.0' + + rc-mentions@2.15.0: + resolution: {integrity: sha512-f5v5i7VdqvBDXbphoqcQWmXDif2Msd2arritVoWybrVDuHE6nQ7XCYsybHbV//WylooK52BFDouFvyaRDtXZEw==} + peerDependencies: + react: '>=16.9.0' + react-dom: '>=16.9.0' + + rc-menu@9.14.1: + resolution: {integrity: sha512-5wlRb3M8S4yGlWhSoEYJ7ZVRElyScdcpUHxgiLxkeig1tEdyKrnED3B2fhpN0Rrpdp9jyhnmZR/Lwq2fH5VvDQ==} + peerDependencies: + react: '>=16.9.0' + react-dom: '>=16.9.0' + + rc-motion@2.9.3: + resolution: {integrity: sha512-rkW47ABVkic7WEB0EKJqzySpvDqwl60/tdkY7hWP7dYnh5pm0SzJpo54oW3TDUGXV5wfxXFmMkxrzRRbotQ0+w==} + peerDependencies: + react: '>=16.9.0' + react-dom: '>=16.9.0' + + rc-notification@5.6.2: + resolution: {integrity: sha512-Id4IYMoii3zzrG0lB0gD6dPgJx4Iu95Xu0BQrhHIbp7ZnAZbLqdqQ73aIWH0d0UFcElxwaKjnzNovTjo7kXz7g==} + engines: {node: '>=8.x'} + peerDependencies: + react: '>=16.9.0' + react-dom: '>=16.9.0' + + rc-overflow@1.3.2: + resolution: {integrity: sha512-nsUm78jkYAoPygDAcGZeC2VwIg/IBGSodtOY3pMof4W3M9qRJgqaDYm03ZayHlde3I6ipliAxbN0RUcGf5KOzw==} + peerDependencies: + react: '>=16.9.0' + react-dom: '>=16.9.0' + + rc-pagination@4.2.0: + resolution: {integrity: sha512-V6qeANJsT6tmOcZ4XiUmj8JXjRLbkusuufpuoBw2GiAn94fIixYjFLmbruD1Sbhn8fPLDnWawPp4CN37zQorvw==} + peerDependencies: + react: '>=16.9.0' + react-dom: '>=16.9.0' + + rc-picker@4.6.15: + resolution: {integrity: sha512-OWZ1yrMie+KN2uEUfYCfS4b2Vu6RC1FWwNI0s+qypsc3wRt7g+peuZKVIzXCTaJwyyZruo80+akPg2+GmyiJjw==} + engines: {node: '>=8.x'} + peerDependencies: + date-fns: '>= 2.x' + dayjs: '>= 1.x' + luxon: '>= 3.x' + moment: '>= 2.x' + react: '>=16.9.0' + react-dom: '>=16.9.0' + peerDependenciesMeta: + date-fns: + optional: true + dayjs: + optional: true + luxon: + optional: true + moment: + optional: true + + rc-progress@4.0.0: + resolution: {integrity: sha512-oofVMMafOCokIUIBnZLNcOZFsABaUw8PPrf1/y0ZBvKZNpOiu5h4AO9vv11Sw0p4Hb3D0yGWuEattcQGtNJ/aw==} + peerDependencies: + react: '>=16.9.0' + react-dom: '>=16.9.0' + + rc-rate@2.13.0: + resolution: {integrity: sha512-oxvx1Q5k5wD30sjN5tqAyWTvJfLNNJn7Oq3IeS4HxWfAiC4BOXMITNAsw7u/fzdtO4MS8Ki8uRLOzcnEuoQiAw==} + engines: {node: '>=8.x'} + peerDependencies: + react: '>=16.9.0' + react-dom: '>=16.9.0' + + rc-resize-observer@1.4.0: + resolution: {integrity: sha512-PnMVyRid9JLxFavTjeDXEXo65HCRqbmLBw9xX9gfC4BZiSzbLXKzW3jPz+J0P71pLbD5tBMTT+mkstV5gD0c9Q==} + peerDependencies: + react: '>=16.9.0' + react-dom: '>=16.9.0' + + rc-segmented@2.3.0: + resolution: {integrity: sha512-I3FtM5Smua/ESXutFfb8gJ8ZPcvFR+qUgeeGFQHBOvRiRKyAk4aBE5nfqrxXx+h8/vn60DQjOt6i4RNtrbOobg==} + peerDependencies: + react: '>=16.0.0' + react-dom: '>=16.0.0' + + rc-select@14.15.2: + resolution: {integrity: sha512-oNoXlaFmpqXYcQDzcPVLrEqS2J9c+/+oJuGrlXeVVX/gVgrbHa5YcyiRUXRydFjyuA7GP3elRuLF7Y3Tfwltlw==} + engines: {node: '>=8.x'} + peerDependencies: + react: '*' + react-dom: '*' + + rc-slider@11.1.6: + resolution: {integrity: sha512-LACAaXM0hi+4x4ErDGZLy7weIQwmBIVbIgPE+eDHiHkyzMvKjWHraCG8/B22Y/tCQUPAsP02wBhKhth7mH2PIw==} + engines: {node: '>=8.x'} + peerDependencies: + react: '>=16.9.0' + react-dom: '>=16.9.0' + + rc-steps@6.0.1: + resolution: {integrity: sha512-lKHL+Sny0SeHkQKKDJlAjV5oZ8DwCdS2hFhAkIjuQt1/pB81M0cA0ErVFdHq9+jmPmFw1vJB2F5NBzFXLJxV+g==} + engines: {node: '>=8.x'} + peerDependencies: + react: '>=16.9.0' + react-dom: '>=16.9.0' + + rc-switch@4.1.0: + resolution: {integrity: sha512-TI8ufP2Az9oEbvyCeVE4+90PDSljGyuwix3fV58p7HV2o4wBnVToEyomJRVyTaZeqNPAp+vqeo4Wnj5u0ZZQBg==} + peerDependencies: + react: '>=16.9.0' + react-dom: '>=16.9.0' + + rc-table@7.45.7: + resolution: {integrity: sha512-wi9LetBL1t1csxyGkMB2p3mCiMt+NDexMlPbXHvQFmBBAsMxrgNSAPwUci2zDLUq9m8QdWc1Nh8suvrpy9mXrg==} + engines: {node: '>=8.x'} + peerDependencies: + react: '>=16.9.0' + react-dom: '>=16.9.0' + + rc-tabs@15.1.1: + resolution: {integrity: sha512-Tc7bJvpEdkWIVCUL7yQrMNBJY3j44NcyWS48jF/UKMXuUlzaXK+Z/pEL5LjGcTadtPvVmNqA40yv7hmr+tCOAw==} + engines: {node: '>=8.x'} + peerDependencies: + react: '>=16.9.0' + react-dom: '>=16.9.0' + + rc-textarea@1.8.2: + resolution: {integrity: sha512-UFAezAqltyR00a8Lf0IPAyTd29Jj9ee8wt8DqXyDMal7r/Cg/nDt3e1OOv3Th4W6mKaZijjgwuPXhAfVNTN8sw==} + peerDependencies: + react: '>=16.9.0' + react-dom: '>=16.9.0' + + rc-tooltip@6.2.1: + resolution: {integrity: sha512-rws0duD/3sHHsD905Nex7FvoUGy2UBQRhTkKxeEvr2FB+r21HsOxcDJI0TzyO8NHhnAA8ILr8pfbSBg5Jj5KBg==} + peerDependencies: + react: '>=16.9.0' + react-dom: '>=16.9.0' + + rc-tree-select@5.23.0: + resolution: {integrity: sha512-aQGi2tFSRw1WbXv0UVXPzHm09E0cSvUVZMLxQtMv3rnZZpNmdRXWrnd9QkLNlVH31F+X5rgghmdSFF3yZW0N9A==} + peerDependencies: + react: '*' + react-dom: '*' + + rc-tree@5.9.0: + resolution: {integrity: sha512-CPrgOvm9d/9E+izTONKSngNzQdIEjMox2PBufWjS1wf7vxtvmCWzK1SlpHbRY6IaBfJIeZ+88RkcIevf729cRg==} + engines: {node: '>=10.x'} + peerDependencies: + react: '*' + react-dom: '*' + + rc-upload@4.7.0: + resolution: {integrity: sha512-eUwxYNHlsYe5vYhKFAUGrQG95JrnPzY+BmPi1Daq39fWNl/eOc7v4UODuWrVp2LFkQBuV3cMCG/I68iub6oBrg==} + peerDependencies: + react: '>=16.9.0' + react-dom: '>=16.9.0' + + rc-util@5.43.0: + resolution: {integrity: sha512-AzC7KKOXFqAdIBqdGWepL9Xn7cm3vnAmjlHqUnoQaTMZYhM4VlXGLkkHHxj/BZ7Td0+SOPKB4RGPboBVKT9htw==} + peerDependencies: + react: '>=16.9.0' + react-dom: '>=16.9.0' + + rc-virtual-list@3.14.8: + resolution: {integrity: sha512-8D0KfzpRYi6YZvlOWIxiOm9BGt4Wf2hQyEaM6RXlDDiY2NhLheuYI+RA+7ZaZj1lq+XQqy3KHlaeeXQfzI5fGg==} + engines: {node: '>=8.x'} + peerDependencies: + react: '>=16.9.0' + react-dom: '>=16.9.0' + + react-dom@18.2.0: + resolution: {integrity: sha512-6IMTriUmvsjHUjNtEDudZfuDQUoWXVxKHhlEGSk81n4YFS+r/Kl99wXiwlVXtPBtJenozv2P+hxDsw9eA7Xo6g==} + peerDependencies: + react: ^18.2.0 + + react-is@16.13.1: + resolution: {integrity: sha512-24e6ynE2H+OKt4kqsOvNd8kBpV65zoxbA4BVsEOB3ARVWQki/DHzaUoC5KuON/BiccDaCCTZBuOcfZs70kR8bQ==} + + react-is@17.0.2: + resolution: {integrity: sha512-w2GsyukL62IJnlaff/nRegPQR94C/XXamvMWmSHRJ4y7Ts/4ocGRmTHvOs8PSE6pB3dWOrD/nueuU5sduBsQ4w==} + + react-is@18.3.1: + resolution: {integrity: sha512-/LLMVyas0ljjAtoYiPqYiL8VWXzUUdThrmU5+n20DZv+a+ClRoevUzw5JxU+Ieh5/c87ytoTBV9G1FiKfNJdmg==} + + react-timer-hook@3.0.7: + resolution: {integrity: sha512-ATpNcU+PQRxxfNBPVqce2+REtjGAlwmfoNQfcEBMZFxPj0r3GYdKhyPHdStvqrejejEi0QvqaJZjy2lBlFvAsA==} + peerDependencies: + react: '>=16.8.0' + + react-use-websocket@4.9.0: + resolution: {integrity: sha512-/6OaCMggQCTnryCAsw/N+/wfH7bBfIXk5WXTMPdyf0x9HWJXLGUVttAT5hqAimRytD1dkHEJCUrFHAGzOAg1eg==} + + react@18.2.0: + resolution: {integrity: sha512-/3IjMdb2L9QbBdWiW5e3P2/npwMBaU9mHCSCUzNln0ZCYbcfTsGbTJrU/kGemdH2IWmB2ioZ+zkxtmq6g09fGQ==} + engines: {node: '>=0.10.0'} + + readable-stream@2.3.8: + resolution: {integrity: sha512-8p0AUk4XODgIewSi0l8Epjs+EVnWiK7NoDIEGU0HhE7+ZyY8D1IMY7odu5lRrFXGg71L15KG8QrPmum45RTtdA==} + + readable-stream@3.6.2: + resolution: {integrity: sha512-9u/sniCrY3D5WdsERHzHE4G2YCXqoG5FTHUiCC4SIbr6XcLZBY05ya9EKjYek9O5xOAwjGq+1JdGBAS7Q9ScoA==} + engines: {node: '>= 6'} + + readdirp@4.0.1: + resolution: {integrity: sha512-GkMg9uOTpIWWKbSsgwb5fA4EavTR+SG/PMPoAY8hkhHfEEY0/vqljY+XHqtDf2cr2IJtoNRDbrrEpZUiZCkYRw==} + engines: {node: '>= 14.16.0'} + + redent@3.0.0: + resolution: {integrity: sha512-6tDA8g98We0zd0GvVeMT9arEOnTw9qM03L9cJXaCjrip1OO764RDBLBfrB4cwzNGDj5OA5ioymC9GkizgWJDUg==} + engines: {node: '>=8'} + + reflect.getprototypeof@1.0.6: + resolution: {integrity: sha512-fmfw4XgoDke3kdI6h4xcUz1dG8uaiv5q9gcEwLS4Pnth2kxT+GZ7YehS1JTMGBQmtV7Y4GFGbs2re2NqhdozUg==} + engines: {node: '>= 0.4'} + + regenerator-runtime@0.14.1: + resolution: {integrity: sha512-dYnhHh0nJoMfnkZs6GmmhFknAGRrLznOu5nc9ML+EJxGvrx6H7teuevqVqCuPcPK//3eDrrjQhehXVx9cnkGdw==} + + regexp.prototype.flags@1.5.3: + resolution: {integrity: sha512-vqlC04+RQoFalODCbCumG2xIOvapzVMHwsyIGM/SIE8fRhFFsXeH8/QQ+s0T0kDAhKc4k30s73/0ydkHQz6HlQ==} + engines: {node: '>= 0.4'} + + regexpp@3.2.0: + resolution: {integrity: sha512-pq2bWo9mVD43nbts2wGv17XLiNLya+GklZ8kaDLV2Z08gDCsGpnKn9BFMepvWuHCbyVvY7J5o5+BVvoQbmlJLg==} + engines: {node: '>=8'} + + require-directory@2.1.1: + resolution: {integrity: sha512-fGxEI7+wsG9xrvdjsrlmL22OMTTiHRwAMroiEeMgq8gzoLC/PQr7RsRDSTLUg/bZAZtF+TVIkHc6/4RIKrui+Q==} + engines: {node: '>=0.10.0'} + + requires-port@1.0.0: + resolution: {integrity: sha512-KigOCHcocU3XODJxsu8i/j8T9tzT4adHiecwORRQ0ZZFcp7ahwXuRU1m+yuO90C5ZUyGeGfocHDI14M3L3yDAQ==} + + resize-observer-polyfill@1.5.1: + resolution: {integrity: sha512-LwZrotdHOo12nQuZlHEmtuXdqGoOD0OhaxopaNFxWzInpEgaLWoVuAMbTzixuosCx2nEG58ngzW3vxdWoxIgdg==} + + resolve-cwd@3.0.0: + resolution: {integrity: sha512-OrZaX2Mb+rJCpH/6CpSqt9xFVpN++x01XnN2ie9g6P5/3xelLAkXWVADpdz1IHD/KFfEXyE6V0U01OQ3UO2rEg==} + engines: {node: '>=8'} + + resolve-from@4.0.0: + resolution: {integrity: sha512-pb/MYmXstAkysRFx8piNI1tGFNQIFA3vkE3Gq4EuA1dF6gHp/+vgZqsCGJapvy8N3Q+4o7FwvquPJcnZ7RYy4g==} + engines: {node: '>=4'} + + resolve-from@5.0.0: + resolution: {integrity: sha512-qYg9KP24dD5qka9J47d0aVky0N+b4fTU89LN9iDnjB5waksiC49rvMB0PrUJQGoTmH50XPiqOvAjDfaijGxYZw==} + engines: {node: '>=8'} + + resolve-pkg-maps@1.0.0: + resolution: {integrity: sha512-seS2Tj26TBVOC2NIc2rOe2y2ZO7efxITtLZcGSOnHHNOQ7CkiUBfw0Iw2ck6xkIhPwLhKNLS8BO+hEpngQlqzw==} + + resolve.exports@2.0.2: + resolution: {integrity: sha512-X2UW6Nw3n/aMgDVy+0rSqgHlv39WZAlZrXCdnbyEiKm17DSqHX4MmQMaST3FbeWR5FTuRcUwYAziZajji0Y7mg==} + engines: {node: '>=10'} + + resolve@1.22.8: + resolution: {integrity: sha512-oKWePCxqpd6FlLvGV1VU0x7bkPmmCNolxzjMf4NczoDnQcIWrAF+cPtZn5i6n+RfD2d9i0tzpKnG6Yk168yIyw==} + hasBin: true + + resolve@2.0.0-next.5: + resolution: {integrity: sha512-U7WjGVG9sH8tvjW5SmGbQuui75FiyjAX72HX15DwBBwF9dNiQZRQAg9nnPhYy+TUnE0+VcrttuvNI8oSxZcocA==} + hasBin: true + + reusify@1.0.4: + resolution: {integrity: sha512-U9nH88a3fc/ekCF1l0/UP1IosiuIjyTh7hBvXVMHYgVcfGvt897Xguj2UOLDeI5BG2m7/uwyaLVT6fbtCwTyzw==} + engines: {iojs: '>=1.0.0', node: '>=0.10.0'} + + rimraf@3.0.2: + resolution: {integrity: sha512-JZkJMZkAGFFPP2YqXZXPbMlMBgsxzE8ILs4lMIX/2o0L9UBw9O/Y3o6wFw/i9YLapcUJWwqbi3kdxIPdC62TIA==} + deprecated: Rimraf versions prior to v4 are no longer supported + hasBin: true + + run-parallel@1.2.0: + resolution: {integrity: sha512-5l4VyZR86LZ/lDxZTR6jqL8AFE2S0IFLMP26AbjsLVADxHdhB/c0GUsH+y39UfCi3dzz8OlQuPmnaJOMoDHQBA==} + + safe-array-concat@1.1.2: + resolution: {integrity: sha512-vj6RsCsWBCf19jIeHEfkRMw8DPiBb+DMXklQ/1SGDHOMlHdPUkZXFQ2YdplS23zESTijAcurb1aSgJA3AgMu1Q==} + engines: {node: '>=0.4'} + + safe-buffer@5.1.2: + resolution: {integrity: sha512-Gd2UZBJDkXlY7GbJxfsE8/nvKkUEU1G38c1siN6QP6a9PT9MmHB8GnpscSmMJSoF8LOIrt8ud/wPtojys4G6+g==} + + safe-buffer@5.2.1: + resolution: {integrity: sha512-rp3So07KcdmmKbGvgaNxQSJr7bGVSVk5S9Eq1F+ppbRo70+YeaDxkw5Dd8NPN+GD6bjnYm2VuPuCXmpuYvmCXQ==} + + safe-regex-test@1.0.3: + resolution: {integrity: sha512-CdASjNJPvRa7roO6Ra/gLYBTzYzzPyyBXxIMdGW3USQLyjWEls2RgW5UBTXaQVp+OrpeCK3bLem8smtmheoRuw==} + engines: {node: '>= 0.4'} + + safer-buffer@2.1.2: + resolution: {integrity: sha512-YZo3K82SD7Riyi0E1EQPojLz7kpepnSQI9IyPbHHg1XXXevb5dJI7tpyN2ADxGcQbHG7vcyRHk0cbwqcQriUtg==} + + sass@1.79.2: + resolution: {integrity: sha512-YmT1aoF1MwHsZEu/eXhbAJNsPGAhNP4UixW9ckEwWCvPcVdVF0/C104OGDVEqtoctKq0N+wM20O/rj+sSPsWeg==} + engines: {node: '>=14.0.0'} + hasBin: true + + saxes@6.0.0: + resolution: {integrity: sha512-xAg7SOnEhrm5zI3puOOKyy1OMcMlIJZYNJY7xLBwSze0UjhPLnWfj2GF2EpT0jmzaJKIWKHLsaSSajf35bcYnA==} + engines: {node: '>=v12.22.7'} + + scheduler@0.23.2: + resolution: {integrity: sha512-UOShsPwz7NrMUqhR6t0hWjFduvOzbtv7toDH1/hIrfRNIDBnnBWd0CwJTGvTpngVlmwGCdP9/Zl/tVrDqcuYzQ==} + + scroll-into-view-if-needed@3.1.0: + resolution: {integrity: sha512-49oNpRjWRvnU8NyGVmUaYG4jtTkNonFZI86MmGRDqBphEK2EXT9gdEUoQPZhuBM8yWHxCWbobltqYO5M4XrUvQ==} + + sdp@3.2.0: + resolution: {integrity: sha512-d7wDPgDV3DDiqulJjKiV2865wKsJ34YI+NDREbm+FySq6WuKOikwyNQcm+doLAZ1O6ltdO0SeKle2xMpN3Brgw==} + + selenium-webdriver@4.26.0: + resolution: {integrity: sha512-nA7jMRIPV17mJmAiTDBWN96Sy0Uxrz5CCLb7bLVV6PpL417SyBMPc2Zo/uoREc2EOHlzHwHwAlFtgmSngSY4WQ==} + engines: {node: '>= 14.21.0'} + + semver@6.3.1: + resolution: {integrity: sha512-BR7VvDCVHO+q2xBEWskxS6DJE1qRnb7DxzUrogb71CWoSficBxYsiAGd+Kl0mmq/MprG9yArRkyrQxTO6XjMzA==} + hasBin: true + + semver@7.6.3: + resolution: {integrity: sha512-oVekP1cKtI+CTDvHWYFUcMtsK/00wmAEfyqKfNdARm8u1wNVhSgaX7A8d4UuIlUI5e84iEwOhs7ZPYRmzU9U6A==} + engines: {node: '>=10'} + hasBin: true + + set-function-length@1.2.2: + resolution: {integrity: sha512-pgRc4hJ4/sNjWCSS9AmnS40x3bNMDTknHgL5UaMBTMyJnU90EgWh1Rz+MC9eFu4BuN/UwZjKQuY/1v3rM7HMfg==} + engines: {node: '>= 0.4'} + + set-function-name@2.0.2: + resolution: {integrity: sha512-7PGFlmtwsEADb0WYyvCMa1t+yke6daIG4Wirafur5kcf+MhUnPms1UeR0CKQdTZD81yESwMHbtn+TR+dMviakQ==} + engines: {node: '>= 0.4'} + + setimmediate@1.0.5: + resolution: {integrity: sha512-MATJdZp8sLqDl/68LfQmbP8zKPLQNV6BIZoIgrscFDQ+RsvK/BxeDQOgyxKKoh0y/8h3BqVFnCqQ/gd+reiIXA==} + + shebang-command@2.0.0: + resolution: {integrity: sha512-kHxr2zZpYtdmrN1qDjrrX/Z1rR1kG8Dx+gkpK1G4eXmvXswmcE1hTWBWYUzlraYw1/yZp6YuDY77YtvbN0dmDA==} + engines: {node: '>=8'} + + shebang-regex@3.0.0: + resolution: {integrity: sha512-7++dFhtcx3353uBaq8DDR4NuxBetBzC7ZQOhmTQInHEd6bSrXdiEyzCvG07Z44UYdLShWUyXt5M/yhz8ekcb1A==} + engines: {node: '>=8'} + + side-channel@1.0.6: + resolution: {integrity: sha512-fDW/EZ6Q9RiO8eFG8Hj+7u/oW+XrPTIChwCOM2+th2A6OblDtYYIpve9m+KvI9Z4C9qSEXlaGR6bTEYHReuglA==} + engines: {node: '>= 0.4'} + + signal-exit@3.0.7: + resolution: {integrity: sha512-wnD2ZE+l+SPC/uoS0vXeE9L1+0wuaMqKlfz9AMUo38JsyLSBWSFcHR1Rri62LZc12vLr1gb3jl7iwQhgwpAbGQ==} + + signal-exit@4.1.0: + resolution: {integrity: sha512-bzyZ1e88w9O1iNJbKnOlvYTrWPDl46O1bG0D3XInv+9tkPrxrN8jUUTiFlDkkmKWgn1M6CfIA13SuGqOa9Korw==} + engines: {node: '>=14'} + + simple-peer@9.11.1: + resolution: {integrity: sha512-D1SaWpOW8afq1CZGWB8xTfrT3FekjQmPValrqncJMX7QFl8YwhrPTZvMCANLtgBwwdS+7zURyqxDDEmY558tTw==} + + sisteransi@1.0.5: + resolution: {integrity: sha512-bLGGlR1QxBcynn2d5YmDX4MGjlZvy2MRBDRNHLJ8VI6l6+9FUiyTFNJ0IveOSP0bcXgVDPRcfGqA0pjaqUpfVg==} + + slash@3.0.0: + resolution: {integrity: sha512-g9Q1haeby36OSStwb4ntCGGGaKsaVSjQ68fBxoQcutl5fS1vuY18H3wSt3jFyFtrkx+Kz0V1G85A4MyAdDMi2Q==} + engines: {node: '>=8'} + + source-map-js@1.2.1: + resolution: {integrity: sha512-UXWMKhLOwVKb728IUtQPXxfYU+usdybtUrK/8uGE8CQMvrhOpwvzDBwj0QhSL7MQc7vIsISBG8VQ8+IDQxpfQA==} + engines: {node: '>=0.10.0'} + + source-map-support@0.5.13: + resolution: {integrity: sha512-SHSKFHadjVA5oR4PPqhtAVdcBWwRYVd6g6cAXnIbRiIwc2EhPrTuKUBdSLvlEKyIP3GCf89fltvcZiP9MMFA1w==} + + source-map@0.6.1: + resolution: {integrity: sha512-UjgapumWlbMhkBgzT7Ykc5YXUT46F0iKu8SGXq0bcwP5dz/h0Plj6enJqjz1Zbq2l5WaqYnrVbwWOWMyF3F47g==} + engines: {node: '>=0.10.0'} + + sprintf-js@1.0.3: + resolution: {integrity: sha512-D9cPgkvLlV3t3IzL0D0YLvGA9Ahk4PcvVwUbN0dSGr1aP0Nrt4AEnTUbuGvquEC0mA64Gqt1fzirlRs5ibXx8g==} + + stack-utils@2.0.6: + resolution: {integrity: sha512-XlkWvfIm6RmsWtNJx+uqtKLS8eqFbxUg0ZzLXqY0caEy9l7hruX8IpiDnjsLavoBgqCCR71TqWO8MaXYheJ3RQ==} + engines: {node: '>=10'} + + stop-iteration-iterator@1.0.0: + resolution: {integrity: sha512-iCGQj+0l0HOdZ2AEeBADlsRC+vsnDsZsbdSiH1yNSjcfKM7fdpCMfqAL/dwF5BLiw/XhRft/Wax6zQbhq2BcjQ==} + engines: {node: '>= 0.4'} + + streamsearch@1.1.0: + resolution: {integrity: sha512-Mcc5wHehp9aXz1ax6bZUyY5afg9u2rv5cqQI3mRrYkGC8rW2hM02jWuwjtL++LS5qinSyhj2QfLyNsuc+VsExg==} + engines: {node: '>=10.0.0'} + + string-convert@0.2.1: + resolution: {integrity: sha512-u/1tdPl4yQnPBjnVrmdLo9gtuLvELKsAoRapekWggdiQNvvvum+jYF329d84NAa660KQw7pB2n36KrIKVoXa3A==} + + string-length@4.0.2: + resolution: {integrity: sha512-+l6rNN5fYHNhZZy41RXsYptCjA2Igmq4EG7kZAYFQI1E1VTXarr6ZPXBg6eq7Y6eK4FEhY6AJlyuFIb/v/S0VQ==} + engines: {node: '>=10'} + + string-width@4.2.3: + resolution: {integrity: sha512-wKyQRQpjJ0sIp62ErSZdGsjMJWsap5oRNihHhu6G7JVO/9jIB6UyevL+tXuOqrng8j/cxKTWyWUwvSTriiZz/g==} + engines: {node: '>=8'} + + string-width@5.1.2: + resolution: {integrity: sha512-HnLOCR3vjcY8beoNLtcjZ5/nxn2afmME6lhrDrebokqMap+XbeW8n9TXpPDOqdGK5qcI3oT0GKTW6wC7EMiVqA==} + engines: {node: '>=12'} + + string.prototype.includes@2.0.0: + resolution: {integrity: sha512-E34CkBgyeqNDcrbU76cDjL5JLcVrtSdYq0MEh/B10r17pRP4ciHLwTgnuLV8Ay6cgEMLkcBkFCKyFZ43YldYzg==} + + string.prototype.matchall@4.0.11: + resolution: {integrity: sha512-NUdh0aDavY2og7IbBPenWqR9exH+E26Sv8e0/eTe1tltDGZL+GtBkDAnnyBtmekfK6/Dq3MkcGtzXFEd1LQrtg==} + engines: {node: '>= 0.4'} + + string.prototype.repeat@1.0.0: + resolution: {integrity: sha512-0u/TldDbKD8bFCQ/4f5+mNRrXwZ8hg2w7ZR8wa16e8z9XpePWl3eGEcUD0OXpEH/VJH/2G3gjUtR3ZOiBe2S/w==} + + string.prototype.trim@1.2.9: + resolution: {integrity: sha512-klHuCNxiMZ8MlsOihJhJEBJAiMVqU3Z2nEXWfWnIqjN0gEFS9J9+IxKozWWtQGcgoa1WUZzLjKPTr4ZHNFTFxw==} + engines: {node: '>= 0.4'} + + string.prototype.trimend@1.0.8: + resolution: {integrity: sha512-p73uL5VCHCO2BZZ6krwwQE3kCzM7NKmis8S//xEC6fQonchbum4eP6kR4DLEjQFO3Wnj3Fuo8NM0kOSjVdHjZQ==} + + string.prototype.trimstart@1.0.8: + resolution: {integrity: sha512-UXSH262CSZY1tfu3G3Secr6uGLCFVPMhIqHjlgCUtCCcgihYc/xKs9djMTMUOb2j1mVSeU8EU6NWc/iQKU6Gfg==} + engines: {node: '>= 0.4'} + + string_decoder@1.1.1: + resolution: {integrity: sha512-n/ShnvDi6FHbbVfviro+WojiFzv+s8MPMHBczVePfUpDJLwoLT0ht1l4YwBCbi8pJAveEEdnkHyPyTP/mzRfwg==} + + string_decoder@1.3.0: + resolution: {integrity: sha512-hkRX8U1WjJFd8LsDJ2yQ/wWWxaopEsABU1XfkM8A+j0+85JAGppt16cr1Whg6KIbb4okU6Mql6BOj+uup/wKeA==} + + strip-ansi@6.0.1: + resolution: {integrity: sha512-Y38VPSHcqkFrCpFnQ9vuSXmquuv5oXOKpGeT6aGrr3o3Gc9AlVa6JBfUSOCnbxGGZF+/0ooI7KrPuUSztUdU5A==} + engines: {node: '>=8'} + + strip-ansi@7.1.0: + resolution: {integrity: sha512-iq6eVVI64nQQTRYq2KtEg2d2uU7LElhTJwsH4YzIHZshxlgZms/wIc4VoDQTlG/IvVIrBKG06CrZnp0qv7hkcQ==} + engines: {node: '>=12'} + + strip-bom@3.0.0: + resolution: {integrity: sha512-vavAMRXOgBVNF6nyEEmL3DBK19iRpDcoIwW+swQ+CbGiu7lju6t+JklA1MHweoWtadgt4ISVUsXLyDq34ddcwA==} + engines: {node: '>=4'} + + strip-bom@4.0.0: + resolution: {integrity: sha512-3xurFv5tEgii33Zi8Jtp55wEIILR9eh34FAW00PZf+JnSsTmV/ioewSgQl97JHvgjoRGwPShsWm+IdrxB35d0w==} + engines: {node: '>=8'} + + strip-final-newline@2.0.0: + resolution: {integrity: sha512-BrpvfNAE3dcvq7ll3xVumzjKjZQ5tI1sEUIKr3Uoks0XUl45St3FlatVqef9prk4jRDzhW6WZg+3bk93y6pLjA==} + engines: {node: '>=6'} + + strip-indent@3.0.0: + resolution: {integrity: sha512-laJTa3Jb+VQpaC6DseHhF7dXVqHTfJPCRDaEbid/drOhgitgYku/letMUqOXFoWV0zIIUbjpdH2t+tYj4bQMRQ==} + engines: {node: '>=8'} + + strip-json-comments@3.1.1: + resolution: {integrity: sha512-6fPc+R4ihwqP6N/aIv2f1gMH8lOVtWQHoqC4yK6oSDVVocumAsfCqjkXnqiYMhmMwS/mEHLp7Vehlt3ql6lEig==} + engines: {node: '>=8'} + + style-mod@4.1.2: + resolution: {integrity: sha512-wnD1HyVqpJUI2+eKZ+eo1UwghftP6yuFheBqqe+bWCotBjC2K1YnteJILRMs3SM4V/0dLEW1SC27MWP5y+mwmw==} + + styled-jsx@5.1.1: + resolution: {integrity: sha512-pW7uC1l4mBZ8ugbiZrcIsiIvVx1UmTfw7UkC3Um2tmfUq9Bhk8IiyEIPl6F8agHgjzku6j0xQEZbfA5uSgSaCw==} + engines: {node: '>= 12.0.0'} + peerDependencies: + '@babel/core': '*' + babel-plugin-macros: '*' + react: '>= 16.8.0 || 17.x.x || ^18.0.0-0' + peerDependenciesMeta: + '@babel/core': + optional: true + babel-plugin-macros: + optional: true + + stylis@4.3.4: + resolution: {integrity: sha512-osIBl6BGUmSfDkyH2mB7EFvCJntXDrLhKjHTRj/rK6xLH0yuPrHULDRQzKokSOD4VoorhtKpfcfW1GAntu8now==} + + supports-color@7.2.0: + resolution: {integrity: sha512-qpCAvRl9stuOHveKsn7HncJRvv501qIacKzQlO/+Lwxc9+0q2wLyv4Dfvt80/DPn2pqOBsJdDiogXGR9+OvwRw==} + engines: {node: '>=8'} + + supports-color@8.1.1: + resolution: {integrity: sha512-MpUEN2OodtUzxvKQl72cUF7RQ5EiHsGvSsVG0ia9c5RbWGL2CI4C7EpPS8UTBIplnlzZiNuV56w+FuNxy3ty2Q==} + engines: {node: '>=10'} + + supports-preserve-symlinks-flag@1.0.0: + resolution: {integrity: sha512-ot0WnXS9fgdkgIcePe6RHNk1WA8+muPa6cSjeR3V8K27q9BB1rTE3R1p7Hv0z1ZyAc8s6Vvv8DIyWf681MAt0w==} + engines: {node: '>= 0.4'} + + symbol-tree@3.2.4: + resolution: {integrity: sha512-9QNk5KwDF+Bvz+PyObkmSYjI5ksVUYtjW7AU22r2NKcfLJcXp96hkDWU3+XndOsUb+AQ9QhfzfCT2O+CNWT5Tw==} + + tapable@2.2.1: + resolution: {integrity: sha512-GNzQvQTOIP6RyTfE2Qxb8ZVlNmw0n88vp1szwWRimP02mnTsx3Wtn5qRdqY9w2XduFNUgvOwhNnQsjwCp+kqaQ==} + engines: {node: '>=6'} + + test-exclude@6.0.0: + resolution: {integrity: sha512-cAGWPIyOHU6zlmg88jwm7VRyXnMN7iV68OGAbYDk/Mh/xC/pzVPlQtY6ngoIH/5/tciuhGfvESU8GrHrcxD56w==} + engines: {node: '>=8'} + + text-table@0.2.0: + resolution: {integrity: sha512-N+8UisAXDGk8PFXP4HAzVR9nbfmVJ3zYLAWiTIoqC5v5isinhr+r5uaO8+7r3BMfuNIufIsA7RdpVgacC2cSpw==} + + throttle-debounce@5.0.2: + resolution: {integrity: sha512-B71/4oyj61iNH0KeCamLuE2rmKuTO5byTOSVwECM5FA7TiAiAW+UqTKZ9ERueC4qvgSttUhdmq1mXC3kJqGX7A==} + engines: {node: '>=12.22'} + + tmp@0.2.3: + resolution: {integrity: sha512-nZD7m9iCPC5g0pYmcaxogYKggSfLsdxl8of3Q/oIbqCqLLIO9IAF0GWjX1z9NZRHPiXv8Wex4yDCaZsgEw0Y8w==} + engines: {node: '>=14.14'} + + tmpl@1.0.5: + resolution: {integrity: sha512-3f0uOEAQwIqGuWW2MVzYg8fV/QNnc/IpuJNG837rLuczAaLVHslWHZQj4IGiEl5Hs3kkbhwL9Ab7Hrsmuj+Smw==} + + to-regex-range@5.0.1: + resolution: {integrity: sha512-65P7iz6X5yEr1cwcgvQxbbIw7Uk3gOy5dIdtZ4rDveLqhrdJP+Li/Hx6tyK0NEb+2GCyneCMJiGqrADCSNk8sQ==} + engines: {node: '>=8.0'} + + toggle-selection@1.0.6: + resolution: {integrity: sha512-BiZS+C1OS8g/q2RRbJmy59xpyghNBqrr6k5L/uKBGRsTfxmu3ffiRnd8mlGPUVayg8pvfi5urfnu8TU7DVOkLQ==} + + tough-cookie@4.1.4: + resolution: {integrity: sha512-Loo5UUvLD9ScZ6jh8beX1T6sO1w2/MpCRpEP7V280GKMVUQ0Jzar2U3UJPsrdbziLEMMhu3Ujnq//rhiFuIeag==} + engines: {node: '>=6'} + + tr46@3.0.0: + resolution: {integrity: sha512-l7FvfAHlcmulp8kr+flpQZmVwtu7nfRV7NZujtN0OqES8EL4O4e0qqzL0DC5gAvx/ZC/9lk6rhcUwYvkBnBnYA==} + engines: {node: '>=12'} + + ts-api-utils@1.3.0: + resolution: {integrity: sha512-UQMIo7pb8WRomKR1/+MFVLTroIvDVtMX3K6OUir8ynLyzB8Jeriont2bTAtmNPa1ekAgN7YPDyf6V+ygrdU+eQ==} + engines: {node: '>=16'} + peerDependencies: + typescript: '>=4.2.0' + + ts-node@10.9.2: + resolution: {integrity: sha512-f0FFpIdcHgn8zcPSbf1dRevwt047YMnaiJM3u2w2RewrB+fob/zePZcrOyQoLMMO7aBIddLcQIEK5dYjkLnGrQ==} + hasBin: true + peerDependencies: + '@swc/core': '>=1.2.50' + '@swc/wasm': '>=1.2.50' + '@types/node': '*' + typescript: '>=2.7' + peerDependenciesMeta: + '@swc/core': + optional: true + '@swc/wasm': + optional: true + + tsconfig-paths@3.15.0: + resolution: {integrity: sha512-2Ac2RgzDe/cn48GvOe3M+o82pEFewD3UPbyoUHHdKasHwJKjds4fLXWf/Ux5kATBKN20oaFGu+jbElp1pos0mg==} + + tslib@2.7.0: + resolution: {integrity: sha512-gLXCKdN1/j47AiHiOkJN69hJmcbGTHI0ImLmbYLHykhgeN0jVGola9yVjFgzCUklsZQMW55o+dW7IXv3RCXDzA==} + + type-check@0.4.0: + resolution: {integrity: sha512-XleUoc9uwGXqjWwXaUTZAmzMcFZ5858QA2vvx1Ur5xIcixXIP+8LnFDgRplU30us6teqdlskFfu+ae4K79Ooew==} + engines: {node: '>= 0.8.0'} + + type-detect@4.0.8: + resolution: {integrity: sha512-0fr/mIH1dlO+x7TlcMy+bIDqKPsw/70tVyeHW787goQjhmqaZe10uwLujubK9q9Lg6Fiho1KUKDYz0Z7k7g5/g==} + engines: {node: '>=4'} + + type-fest@0.20.2: + resolution: {integrity: sha512-Ne+eE4r0/iWnpAxD852z3A+N0Bt5RN//NjJwRd2VFHEmrywxf5vsZlh4R6lixl6B+wz/8d+maTSAkN1FIkI3LQ==} + engines: {node: '>=10'} + + type-fest@0.21.3: + resolution: {integrity: sha512-t0rzBq87m3fVcduHDUFhKmyyX+9eo6WQjZvf51Ea/M0Q7+T374Jp1aUiyUl0GKxp8M/OETVHSDvmkyPgvX+X2w==} + engines: {node: '>=10'} + + typed-array-buffer@1.0.2: + resolution: {integrity: sha512-gEymJYKZtKXzzBzM4jqa9w6Q1Jjm7x2d+sh19AdsD4wqnMPDYyvwpsIc2Q/835kHuo3BEQ7CjelGhfTsoBb2MQ==} + engines: {node: '>= 0.4'} + + typed-array-byte-length@1.0.1: + resolution: {integrity: sha512-3iMJ9q0ao7WE9tWcaYKIptkNBuOIcZCCT0d4MRvuuH88fEoEH62IuQe0OtraD3ebQEoTRk8XCBoknUNc1Y67pw==} + engines: {node: '>= 0.4'} + + typed-array-byte-offset@1.0.2: + resolution: {integrity: sha512-Ous0vodHa56FviZucS2E63zkgtgrACj7omjwd/8lTEMEPFFyjfixMZ1ZXenpgCFBBt4EC1J2XsyVS2gkG0eTFA==} + engines: {node: '>= 0.4'} + + typed-array-length@1.0.6: + resolution: {integrity: sha512-/OxDN6OtAk5KBpGb28T+HZc2M+ADtvRxXrKKbUwtsLgdoxgX13hyy7ek6bFRl5+aBs2yZzB0c4CnQfAtVypW/g==} + engines: {node: '>= 0.4'} + + typeface-montserrat@1.1.13: + resolution: {integrity: sha512-Pklkyj0e+K+6I/t0M6JBDBphpfJkF1k+3qd8qDnp9aVtCC7oGBQWTAcL6+5eArfGe7h73uPwyal73hEkf9YCUA==} + + typescript@5.0.2: + resolution: {integrity: sha512-wVORMBGO/FAs/++blGNeAVdbNKtIh1rbBL2EyQ1+J9lClJ93KiiKe8PmFIVdXhHcyv44SL9oglmfeSsndo0jRw==} + engines: {node: '>=12.20'} + hasBin: true + + unbox-primitive@1.0.2: + resolution: {integrity: sha512-61pPlCD9h51VoreyJ0BReideM3MDKMKnh6+V9L08331ipq6Q8OFXZYiqP6n/tbHx4s5I9uRhcye6BrbkizkBDw==} + + universalify@0.2.0: + resolution: {integrity: sha512-CJ1QgKmNg3CwvAv/kOFmtnEN05f0D/cn9QntgNOQlQF9dgvVTHj3t+8JPdjqawCHk7V/KA+fbUqzZ9XWhcqPUg==} + engines: {node: '>= 4.0.0'} + + update-browserslist-db@1.1.1: + resolution: {integrity: sha512-R8UzCaa9Az+38REPiJ1tXlImTJXlVfgHZsglwBD/k6nj76ctsH1E3q4doGrukiLQd3sGQYu56r5+lo5r94l29A==} + hasBin: true + peerDependencies: + browserslist: '>= 4.21.0' + + uri-js@4.4.1: + resolution: {integrity: sha512-7rKUyy33Q1yc98pQ1DAmLtwX109F7TIfWlW1Ydo8Wl1ii1SeHieeh0HHfPeL2fMXK6z0s8ecKs9frCuLJvndBg==} + + url-parse@1.5.10: + resolution: {integrity: sha512-WypcfiRhfeUP9vvF0j6rw0J3hrWrw6iZv3+22h6iRMJ/8z1Tj6XfLP4DsUix5MhMPnXpiHDoKyoZ/bdCkwBCiQ==} + + util-deprecate@1.0.2: + resolution: {integrity: sha512-EPD5q1uXyFxJpCrLnCc1nHnq3gOa6DZBocAIiI2TaSCA7VCJ1UJDMagCzIkXNsUYfD1daK//LTEQ8xiIbrHtcw==} + + v8-compile-cache-lib@3.0.1: + resolution: {integrity: sha512-wa7YjyUGfNZngI/vtK0UHAN+lgDCxBPCylVXGp0zu59Fz5aiGtNXaq3DhIov063MorB+VfufLh3JlF2KdTK3xg==} + + v8-compile-cache@2.4.0: + resolution: {integrity: sha512-ocyWc3bAHBB/guyqJQVI5o4BZkPhznPYUG2ea80Gond/BgNWpap8TOmLSeeQG7bnh2KMISxskdADG59j7zruhw==} + + v8-to-istanbul@9.3.0: + resolution: {integrity: sha512-kiGUalWN+rgBJ/1OHZsBtU4rXZOfj/7rKQxULKlIzwzQSvMJUUNgPwJEEh7gU6xEVxC0ahoOBvN2YI8GH6FNgA==} + engines: {node: '>=10.12.0'} + + w3c-keyname@2.2.8: + resolution: {integrity: sha512-dpojBhNsCNN7T82Tm7k26A6G9ML3NkhDsnw9n/eoxSRlVBB4CEtIQ/KTCLI2Fwf3ataSXRhYFkQi3SlnFwPvPQ==} + + w3c-xmlserializer@4.0.0: + resolution: {integrity: sha512-d+BFHzbiCx6zGfz0HyQ6Rg69w9k19nviJspaj4yNscGjrHu94sVP+aRm75yEbCh+r2/yR+7q6hux9LVtbuTGBw==} + engines: {node: '>=14'} + + walker@1.0.8: + resolution: {integrity: sha512-ts/8E8l5b7kY0vlWLewOkDXMmPdLcVV4GmOQLyxuSswIJsweeFZtAsMF7k1Nszz+TYBQrlYRmzOnr398y1JemQ==} + + webidl-conversions@7.0.0: + resolution: {integrity: sha512-VwddBukDzu71offAQR975unBIGqfKZpM+8ZX6ySk8nYhVoo5CYaZyzt3YBvYtRtO+aoGlqxPg/B87NGVZ/fu6g==} + engines: {node: '>=12'} + + webrtc-adapter@9.0.1: + resolution: {integrity: sha512-1AQO+d4ElfVSXyzNVTOewgGT/tAomwwztX/6e3totvyyzXPvXIIuUUjAmyZGbKBKbZOXauuJooZm3g6IuFuiNQ==} + engines: {node: '>=6.0.0', npm: '>=3.10.0'} + + whatwg-encoding@2.0.0: + resolution: {integrity: sha512-p41ogyeMUrw3jWclHWTQg1k05DSVXPLcVxRTYsXUk+ZooOCZLcoYgPZ/HL/D/N+uQPOtcp1me1WhBEaX02mhWg==} + engines: {node: '>=12'} + + whatwg-mimetype@3.0.0: + resolution: {integrity: sha512-nt+N2dzIutVRxARx1nghPKGv1xHikU7HKdfafKkLNLindmPU/ch3U31NOCGGA/dmPcmb1VlofO0vnKAcsm0o/Q==} + engines: {node: '>=12'} + + whatwg-url@11.0.0: + resolution: {integrity: sha512-RKT8HExMpoYx4igMiVMY83lN6UeITKJlBQ+vR/8ZJ8OCdSiN3RwCq+9gH0+Xzj0+5IrM6i4j/6LuvzbZIQgEcQ==} + engines: {node: '>=12'} + + which-boxed-primitive@1.0.2: + resolution: {integrity: sha512-bwZdv0AKLpplFY2KZRX6TvyuN7ojjr7lwkg6ml0roIy9YeuSr7JS372qlNW18UQYzgYK9ziGcerWqZOmEn9VNg==} + + which-builtin-type@1.1.4: + resolution: {integrity: sha512-bppkmBSsHFmIMSl8BO9TbsyzsvGjVoppt8xUiGzwiu/bhDCGxnpOKCxgqj6GuyHE0mINMDecBFPlOm2hzY084w==} + engines: {node: '>= 0.4'} + + which-collection@1.0.2: + resolution: {integrity: sha512-K4jVyjnBdgvc86Y6BkaLZEN933SwYOuBFkdmBu9ZfkcAbdVbpITnDmjvZ/aQjRXQrv5EPkTnD1s39GiiqbngCw==} + engines: {node: '>= 0.4'} + + which-typed-array@1.1.15: + resolution: {integrity: sha512-oV0jmFtUky6CXfkqehVvBP/LSWJ2sy4vWMioiENyJLePrBO/yKyV9OyJySfAKosh+RYkIl5zJCNZ8/4JncrpdA==} + engines: {node: '>= 0.4'} + + which@2.0.2: + resolution: {integrity: sha512-BLI3Tl1TW3Pvl70l3yq3Y64i+awpwXqsGBYWkkqMtnbXgrMD+yj7rhW0kuEDxzJaYXGjEW5ogapKNMEKNMjibA==} + engines: {node: '>= 8'} + hasBin: true + + word-wrap@1.2.5: + resolution: {integrity: sha512-BN22B5eaMMI9UMtjrGd5g5eCYPpCPDUy0FJXbYsaT5zYxjFOckS53SQDE3pWkVoWpHXVb3BrYcEN4Twa55B5cA==} + engines: {node: '>=0.10.0'} + + wrap-ansi@7.0.0: + resolution: {integrity: sha512-YVGIj2kamLSTxw6NsZjoBxfSwsn0ycdesmc4p+Q21c5zPuZ1pl+NfxVdxPtdHvmNVOQ6XSYG4AUtyt/Fi7D16Q==} + engines: {node: '>=10'} + + wrap-ansi@8.1.0: + resolution: {integrity: sha512-si7QWI6zUMq56bESFvagtmzMdGOtoxfR+Sez11Mobfc7tm+VkUckk9bW2UeffTGVUbOksxmSw0AA2gs8g71NCQ==} + engines: {node: '>=12'} + + wrappy@1.0.2: + resolution: {integrity: sha512-l4Sp/DRseor9wL6EvV2+TuQn63dMkPjZ/sp9XkghTEbV9KlPS1xUsZ3u7/IQO4wxtcFB4bgpQPRcR3QCvezPcQ==} + + write-file-atomic@4.0.2: + resolution: {integrity: sha512-7KxauUdBmSdWnmpaGFg+ppNjKF8uNLry8LyzjauQDOVONfFLNKrKvQOxZ/VuTIcS/gge/YNahf5RIIQWTSarlg==} + engines: {node: ^12.13.0 || ^14.15.0 || >=16.0.0} + + ws@8.18.0: + resolution: {integrity: sha512-8VbfWfHLbbwu3+N6OKsOMpBdT4kXPDDB9cJk2bJ6mh9ucxdlnNvH1e+roYkKmN9Nxw2yjz7VzeO9oOz2zJ04Pw==} + engines: {node: '>=10.0.0'} + peerDependencies: + bufferutil: ^4.0.1 + utf-8-validate: '>=5.0.2' + peerDependenciesMeta: + bufferutil: + optional: true + utf-8-validate: + optional: true + + xml-name-validator@4.0.0: + resolution: {integrity: sha512-ICP2e+jsHvAj2E2lIHxa5tjXRlKDJo4IdvPvCXbXQGdzSfmSpNVyIKMvoZHjDY9DP0zV17iI85o90vRFXNccRw==} + engines: {node: '>=12'} + + xmlchars@2.2.0: + resolution: {integrity: sha512-JZnDKK8B0RCDw84FNdDAIpZK+JuJw+s7Lz8nksI7SIuU3UXJJslUthsi+uWBUYOwPFwW7W7PRLRfUKpxjtjFCw==} + + y-codemirror.next@0.3.5: + resolution: {integrity: sha512-VluNu3e5HfEXybnypnsGwKAj+fKLd4iAnR7JuX1Sfyydmn1jCBS5wwEL/uS04Ch2ib0DnMAOF6ZRR/8kK3wyGw==} + peerDependencies: + '@codemirror/state': ^6.0.0 + '@codemirror/view': ^6.0.0 + yjs: ^13.5.6 + + y-protocols@1.0.6: + resolution: {integrity: sha512-vHRF2L6iT3rwj1jub/K5tYcTT/mEYDUppgNPXwp8fmLpui9f7Yeq3OEtTLVF012j39QnV+KEQpNqoN7CWU7Y9Q==} + engines: {node: '>=16.0.0', npm: '>=8.0.0'} + peerDependencies: + yjs: ^13.0.0 + + y-webrtc@10.3.0: + resolution: {integrity: sha512-KalJr7dCgUgyVFxoG3CQYbpS0O2qybegD0vI4bYnYHI0MOwoVbucED3RZ5f2o1a5HZb1qEssUKS0H/Upc6p1lA==} + engines: {node: '>=12'} + hasBin: true + peerDependencies: + yjs: ^13.6.8 + + y18n@5.0.8: + resolution: {integrity: sha512-0pfFzegeDWJHJIAmTLRP2DwHjdF5s7jo9tuztdQxAhINCdvS+3nGINqPd00AphqJR/0LhANUS6/+7SCb98YOfA==} + engines: {node: '>=10'} + + yallist@3.1.1: + resolution: {integrity: sha512-a4UGQaWPH59mOXUYnAG2ewncQS4i4F43Tv3JoAM+s2VDAmS9NsK8GpDMLrCHPksFT7h3K6TOoUNn2pb7RoXx4g==} + + yargs-parser@21.1.1: + resolution: {integrity: sha512-tVpsJW7DdjecAiFpbIB1e3qxIQsE6NoPc5/eTdrbbIC4h0LVsWhnoa3g+m2HclBIujHzsxZ4VJVA+GUuc2/LBw==} + engines: {node: '>=12'} + + yargs@17.7.2: + resolution: {integrity: sha512-7dSzzRQ++CKnNI/krKnYRV7JKKPUXMEh61soaHKg9mrWEhzFWhFnxPxGl+69cD1Ou63C13NUPCnmIcrvqCuM6w==} + engines: {node: '>=12'} + + yjs@13.6.20: + resolution: {integrity: sha512-Z2YZI+SYqK7XdWlloI3lhMiKnCdFCVC4PchpdO+mCYwtiTwncjUbnRK9R1JmkNfdmHyDXuWN3ibJAt0wsqTbLQ==} + engines: {node: '>=16.0.0', npm: '>=8.0.0'} + + yn@3.1.1: + resolution: {integrity: sha512-Ux4ygGWsu2c7isFWe8Yu1YluJmqVhxqK2cLXNQA5AcC3QfbGNpM7fu0Y8b/z16pXLnFxZYvWhd3fhBY9DLmC6Q==} + engines: {node: '>=6'} + + yocto-queue@0.1.0: + resolution: {integrity: sha512-rVksvsnNCdJ/ohGc6xgPwyN8eheCxsiLM8mxuE/t/mOVqJewPuO1miLpTHQiRgTKCLexL4MeAFVagts7HmNZ2Q==} + engines: {node: '>=10'} + +snapshots: + + '@adobe/css-tools@4.4.0': {} + + '@ampproject/remapping@2.3.0': + dependencies: + '@jridgewell/gen-mapping': 0.3.5 + '@jridgewell/trace-mapping': 0.3.25 + + '@ant-design/colors@7.1.0': + dependencies: + '@ctrl/tinycolor': 3.6.1 + + '@ant-design/cssinjs-utils@1.1.0(react-dom@18.2.0(react@18.2.0))(react@18.2.0)': + dependencies: + '@ant-design/cssinjs': 1.21.1(react-dom@18.2.0(react@18.2.0))(react@18.2.0) + '@babel/runtime': 7.25.7 + rc-util: 5.43.0(react-dom@18.2.0(react@18.2.0))(react@18.2.0) + react: 18.2.0 + react-dom: 18.2.0(react@18.2.0) + + '@ant-design/cssinjs@1.21.1(react-dom@18.2.0(react@18.2.0))(react@18.2.0)': + dependencies: + '@babel/runtime': 7.25.7 + '@emotion/hash': 0.8.0 + '@emotion/unitless': 0.7.5 + classnames: 2.5.1 + csstype: 3.1.3 + rc-util: 5.43.0(react-dom@18.2.0(react@18.2.0))(react@18.2.0) + react: 18.2.0 + react-dom: 18.2.0(react@18.2.0) + stylis: 4.3.4 + + '@ant-design/fast-color@2.0.6': + dependencies: + '@babel/runtime': 7.25.7 + + '@ant-design/icons-svg@4.4.2': {} + + '@ant-design/icons@5.5.1(react-dom@18.2.0(react@18.2.0))(react@18.2.0)': + dependencies: + '@ant-design/colors': 7.1.0 + '@ant-design/icons-svg': 4.4.2 + '@babel/runtime': 7.25.7 + classnames: 2.5.1 + rc-util: 5.43.0(react-dom@18.2.0(react@18.2.0))(react@18.2.0) + react: 18.2.0 + react-dom: 18.2.0(react@18.2.0) + + '@ant-design/nextjs-registry@1.0.1(@ant-design/cssinjs@1.21.1(react-dom@18.2.0(react@18.2.0))(react@18.2.0))(antd@5.20.6(react-dom@18.2.0(react@18.2.0))(react@18.2.0))(next@14.2.13(@babel/core@7.26.0)(react-dom@18.2.0(react@18.2.0))(react@18.2.0)(sass@1.79.2))(react-dom@18.2.0(react@18.2.0))(react@18.2.0)': + dependencies: + '@ant-design/cssinjs': 1.21.1(react-dom@18.2.0(react@18.2.0))(react@18.2.0) + antd: 5.20.6(react-dom@18.2.0(react@18.2.0))(react@18.2.0) + next: 14.2.13(@babel/core@7.26.0)(react-dom@18.2.0(react@18.2.0))(react@18.2.0)(sass@1.79.2) + react: 18.2.0 + react-dom: 18.2.0(react@18.2.0) + + '@ant-design/react-slick@1.1.2(react@18.2.0)': + dependencies: + '@babel/runtime': 7.25.7 + classnames: 2.5.1 + json2mq: 0.2.0 + react: 18.2.0 + resize-observer-polyfill: 1.5.1 + throttle-debounce: 5.0.2 + + '@babel/code-frame@7.26.2': + dependencies: + '@babel/helper-validator-identifier': 7.25.9 + js-tokens: 4.0.0 + picocolors: 1.1.0 + + '@babel/compat-data@7.26.2': {} + + '@babel/core@7.26.0': + dependencies: + '@ampproject/remapping': 2.3.0 + '@babel/code-frame': 7.26.2 + '@babel/generator': 7.26.2 + '@babel/helper-compilation-targets': 7.25.9 + '@babel/helper-module-transforms': 7.26.0(@babel/core@7.26.0) + '@babel/helpers': 7.26.0 + '@babel/parser': 7.26.2 + '@babel/template': 7.25.9 + '@babel/traverse': 7.25.9 + '@babel/types': 7.26.0 + convert-source-map: 2.0.0 + debug: 4.3.7 + gensync: 1.0.0-beta.2 + json5: 2.2.3 + semver: 6.3.1 + transitivePeerDependencies: + - supports-color + + '@babel/generator@7.26.2': + dependencies: + '@babel/parser': 7.26.2 + '@babel/types': 7.26.0 + '@jridgewell/gen-mapping': 0.3.5 + '@jridgewell/trace-mapping': 0.3.25 + jsesc: 3.0.2 + + '@babel/helper-compilation-targets@7.25.9': + dependencies: + '@babel/compat-data': 7.26.2 + '@babel/helper-validator-option': 7.25.9 + browserslist: 4.24.2 + lru-cache: 5.1.1 + semver: 6.3.1 + + '@babel/helper-module-imports@7.25.9': + dependencies: + '@babel/traverse': 7.25.9 + '@babel/types': 7.26.0 + transitivePeerDependencies: + - supports-color + + '@babel/helper-module-transforms@7.26.0(@babel/core@7.26.0)': + dependencies: + '@babel/core': 7.26.0 + '@babel/helper-module-imports': 7.25.9 + '@babel/helper-validator-identifier': 7.25.9 + '@babel/traverse': 7.25.9 + transitivePeerDependencies: + - supports-color + + '@babel/helper-plugin-utils@7.25.9': {} + + '@babel/helper-string-parser@7.25.9': {} + + '@babel/helper-validator-identifier@7.25.9': {} + + '@babel/helper-validator-option@7.25.9': {} + + '@babel/helpers@7.26.0': + dependencies: + '@babel/template': 7.25.9 + '@babel/types': 7.26.0 + + '@babel/parser@7.26.2': + dependencies: + '@babel/types': 7.26.0 + + '@babel/plugin-syntax-async-generators@7.8.4(@babel/core@7.26.0)': + dependencies: + '@babel/core': 7.26.0 + '@babel/helper-plugin-utils': 7.25.9 + + '@babel/plugin-syntax-bigint@7.8.3(@babel/core@7.26.0)': + dependencies: + '@babel/core': 7.26.0 + '@babel/helper-plugin-utils': 7.25.9 + + '@babel/plugin-syntax-class-properties@7.12.13(@babel/core@7.26.0)': + dependencies: + '@babel/core': 7.26.0 + '@babel/helper-plugin-utils': 7.25.9 + + '@babel/plugin-syntax-class-static-block@7.14.5(@babel/core@7.26.0)': + dependencies: + '@babel/core': 7.26.0 + '@babel/helper-plugin-utils': 7.25.9 + + '@babel/plugin-syntax-import-attributes@7.26.0(@babel/core@7.26.0)': + dependencies: + '@babel/core': 7.26.0 + '@babel/helper-plugin-utils': 7.25.9 + + '@babel/plugin-syntax-import-meta@7.10.4(@babel/core@7.26.0)': + dependencies: + '@babel/core': 7.26.0 + '@babel/helper-plugin-utils': 7.25.9 + + '@babel/plugin-syntax-json-strings@7.8.3(@babel/core@7.26.0)': + dependencies: + '@babel/core': 7.26.0 + '@babel/helper-plugin-utils': 7.25.9 + + '@babel/plugin-syntax-jsx@7.25.9(@babel/core@7.26.0)': + dependencies: + '@babel/core': 7.26.0 + '@babel/helper-plugin-utils': 7.25.9 + + '@babel/plugin-syntax-logical-assignment-operators@7.10.4(@babel/core@7.26.0)': + dependencies: + '@babel/core': 7.26.0 + '@babel/helper-plugin-utils': 7.25.9 + + '@babel/plugin-syntax-nullish-coalescing-operator@7.8.3(@babel/core@7.26.0)': + dependencies: + '@babel/core': 7.26.0 + '@babel/helper-plugin-utils': 7.25.9 + + '@babel/plugin-syntax-numeric-separator@7.10.4(@babel/core@7.26.0)': + dependencies: + '@babel/core': 7.26.0 + '@babel/helper-plugin-utils': 7.25.9 + + '@babel/plugin-syntax-object-rest-spread@7.8.3(@babel/core@7.26.0)': + dependencies: + '@babel/core': 7.26.0 + '@babel/helper-plugin-utils': 7.25.9 + + '@babel/plugin-syntax-optional-catch-binding@7.8.3(@babel/core@7.26.0)': + dependencies: + '@babel/core': 7.26.0 + '@babel/helper-plugin-utils': 7.25.9 + + '@babel/plugin-syntax-optional-chaining@7.8.3(@babel/core@7.26.0)': + dependencies: + '@babel/core': 7.26.0 + '@babel/helper-plugin-utils': 7.25.9 + + '@babel/plugin-syntax-private-property-in-object@7.14.5(@babel/core@7.26.0)': + dependencies: + '@babel/core': 7.26.0 + '@babel/helper-plugin-utils': 7.25.9 + + '@babel/plugin-syntax-top-level-await@7.14.5(@babel/core@7.26.0)': + dependencies: + '@babel/core': 7.26.0 + '@babel/helper-plugin-utils': 7.25.9 + + '@babel/plugin-syntax-typescript@7.25.9(@babel/core@7.26.0)': + dependencies: + '@babel/core': 7.26.0 + '@babel/helper-plugin-utils': 7.25.9 + + '@babel/runtime@7.25.7': + dependencies: + regenerator-runtime: 0.14.1 + + '@babel/template@7.25.9': + dependencies: + '@babel/code-frame': 7.26.2 + '@babel/parser': 7.26.2 + '@babel/types': 7.26.0 + + '@babel/traverse@7.25.9': + dependencies: + '@babel/code-frame': 7.26.2 + '@babel/generator': 7.26.2 + '@babel/parser': 7.26.2 + '@babel/template': 7.25.9 + '@babel/types': 7.26.0 + debug: 4.3.7 + globals: 11.12.0 + transitivePeerDependencies: + - supports-color + + '@babel/types@7.26.0': + dependencies: + '@babel/helper-string-parser': 7.25.9 + '@babel/helper-validator-identifier': 7.25.9 + + '@bazel/runfiles@6.3.1': {} + + '@bcoe/v8-coverage@0.2.3': {} + + '@codemirror/autocomplete@6.18.1(@codemirror/language@6.10.3)(@codemirror/state@6.4.1)(@codemirror/view@6.34.1)(@lezer/common@1.2.3)': + dependencies: + '@codemirror/language': 6.10.3 + '@codemirror/state': 6.4.1 + '@codemirror/view': 6.34.1 + '@lezer/common': 1.2.3 + + '@codemirror/commands@6.7.1': + dependencies: + '@codemirror/language': 6.10.3 + '@codemirror/state': 6.4.1 + '@codemirror/view': 6.34.1 + '@lezer/common': 1.2.3 + + '@codemirror/lang-cpp@6.0.2': + dependencies: + '@codemirror/language': 6.10.3 + '@lezer/cpp': 1.1.2 + + '@codemirror/lang-go@6.0.1(@codemirror/view@6.34.1)': + dependencies: + '@codemirror/autocomplete': 6.18.1(@codemirror/language@6.10.3)(@codemirror/state@6.4.1)(@codemirror/view@6.34.1)(@lezer/common@1.2.3) + '@codemirror/language': 6.10.3 + '@codemirror/state': 6.4.1 + '@lezer/common': 1.2.3 + '@lezer/go': 1.0.0 + transitivePeerDependencies: + - '@codemirror/view' + + '@codemirror/lang-java@6.0.1': + dependencies: + '@codemirror/language': 6.10.3 + '@lezer/java': 1.1.3 + + '@codemirror/lang-javascript@6.2.2': + dependencies: + '@codemirror/autocomplete': 6.18.1(@codemirror/language@6.10.3)(@codemirror/state@6.4.1)(@codemirror/view@6.34.1)(@lezer/common@1.2.3) + '@codemirror/language': 6.10.3 + '@codemirror/lint': 6.8.2 + '@codemirror/state': 6.4.1 + '@codemirror/view': 6.34.1 + '@lezer/common': 1.2.3 + '@lezer/javascript': 1.4.19 + + '@codemirror/lang-python@6.1.6(@codemirror/view@6.34.1)': + dependencies: + '@codemirror/autocomplete': 6.18.1(@codemirror/language@6.10.3)(@codemirror/state@6.4.1)(@codemirror/view@6.34.1)(@lezer/common@1.2.3) + '@codemirror/language': 6.10.3 + '@codemirror/state': 6.4.1 + '@lezer/common': 1.2.3 + '@lezer/python': 1.1.14 + transitivePeerDependencies: + - '@codemirror/view' + + '@codemirror/language@6.10.3': + dependencies: + '@codemirror/state': 6.4.1 + '@codemirror/view': 6.34.1 + '@lezer/common': 1.2.3 + '@lezer/highlight': 1.2.1 + '@lezer/lr': 1.4.2 + style-mod: 4.1.2 + + '@codemirror/lint@6.8.2': + dependencies: + '@codemirror/state': 6.4.1 + '@codemirror/view': 6.34.1 + crelt: 1.0.6 + + '@codemirror/search@6.5.6': + dependencies: + '@codemirror/state': 6.4.1 + '@codemirror/view': 6.34.1 + crelt: 1.0.6 + + '@codemirror/state@6.4.1': {} + + '@codemirror/view@6.34.1': + dependencies: + '@codemirror/state': 6.4.1 + style-mod: 4.1.2 + w3c-keyname: 2.2.8 + + '@cspotcode/source-map-support@0.8.1': + dependencies: + '@jridgewell/trace-mapping': 0.3.9 + + '@ctrl/tinycolor@3.6.1': {} + + '@emotion/hash@0.8.0': {} + + '@emotion/unitless@0.7.5': {} + + '@eslint-community/eslint-utils@4.4.0(eslint@8.0.0)': + dependencies: + eslint: 8.0.0 + eslint-visitor-keys: 3.4.3 + + '@eslint-community/regexpp@4.11.1': {} + + '@eslint/eslintrc@1.4.1': + dependencies: + ajv: 6.12.6 + debug: 4.3.7 + espree: 9.6.1 + globals: 13.24.0 + ignore: 5.3.2 + import-fresh: 3.3.0 + js-yaml: 4.1.0 + minimatch: 3.1.2 + strip-json-comments: 3.1.1 + transitivePeerDependencies: + - supports-color + + '@humanwhocodes/config-array@0.6.0': + dependencies: + '@humanwhocodes/object-schema': 1.2.1 + debug: 4.3.7 + minimatch: 3.1.2 + transitivePeerDependencies: + - supports-color + + '@humanwhocodes/object-schema@1.2.1': {} + + '@isaacs/cliui@8.0.2': + dependencies: + string-width: 5.1.2 + string-width-cjs: string-width@4.2.3 + strip-ansi: 7.1.0 + strip-ansi-cjs: strip-ansi@6.0.1 + wrap-ansi: 8.1.0 + wrap-ansi-cjs: wrap-ansi@7.0.0 + + '@istanbuljs/load-nyc-config@1.1.0': + dependencies: + camelcase: 5.3.1 + find-up: 4.1.0 + get-package-type: 0.1.0 + js-yaml: 3.14.1 + resolve-from: 5.0.0 + + '@istanbuljs/schema@0.1.3': {} + + '@jest/console@29.7.0': + dependencies: + '@jest/types': 29.6.3 + '@types/node': 20.0.0 + chalk: 4.1.2 + jest-message-util: 29.7.0 + jest-util: 29.7.0 + slash: 3.0.0 + + '@jest/core@29.7.0(ts-node@10.9.2(@types/node@20.0.0)(typescript@5.0.2))': + dependencies: + '@jest/console': 29.7.0 + '@jest/reporters': 29.7.0 + '@jest/test-result': 29.7.0 + '@jest/transform': 29.7.0 + '@jest/types': 29.6.3 + '@types/node': 20.0.0 + ansi-escapes: 4.3.2 + chalk: 4.1.2 + ci-info: 3.9.0 + exit: 0.1.2 + graceful-fs: 4.2.11 + jest-changed-files: 29.7.0 + jest-config: 29.7.0(@types/node@20.0.0)(ts-node@10.9.2(@types/node@20.0.0)(typescript@5.0.2)) + jest-haste-map: 29.7.0 + jest-message-util: 29.7.0 + jest-regex-util: 29.6.3 + jest-resolve: 29.7.0 + jest-resolve-dependencies: 29.7.0 + jest-runner: 29.7.0 + jest-runtime: 29.7.0 + jest-snapshot: 29.7.0 + jest-util: 29.7.0 + jest-validate: 29.7.0 + jest-watcher: 29.7.0 + micromatch: 4.0.8 + pretty-format: 29.7.0 + slash: 3.0.0 + strip-ansi: 6.0.1 + transitivePeerDependencies: + - babel-plugin-macros + - supports-color + - ts-node + + '@jest/environment@29.7.0': + dependencies: + '@jest/fake-timers': 29.7.0 + '@jest/types': 29.6.3 + '@types/node': 20.0.0 + jest-mock: 29.7.0 + + '@jest/expect-utils@29.7.0': + dependencies: + jest-get-type: 29.6.3 + + '@jest/expect@29.7.0': + dependencies: + expect: 29.7.0 + jest-snapshot: 29.7.0 + transitivePeerDependencies: + - supports-color + + '@jest/fake-timers@29.7.0': + dependencies: + '@jest/types': 29.6.3 + '@sinonjs/fake-timers': 10.3.0 + '@types/node': 20.0.0 + jest-message-util: 29.7.0 + jest-mock: 29.7.0 + jest-util: 29.7.0 + + '@jest/globals@29.7.0': + dependencies: + '@jest/environment': 29.7.0 + '@jest/expect': 29.7.0 + '@jest/types': 29.6.3 + jest-mock: 29.7.0 + transitivePeerDependencies: + - supports-color + + '@jest/reporters@29.7.0': + dependencies: + '@bcoe/v8-coverage': 0.2.3 + '@jest/console': 29.7.0 + '@jest/test-result': 29.7.0 + '@jest/transform': 29.7.0 + '@jest/types': 29.6.3 + '@jridgewell/trace-mapping': 0.3.25 + '@types/node': 20.0.0 + chalk: 4.1.2 + collect-v8-coverage: 1.0.2 + exit: 0.1.2 + glob: 7.2.3 + graceful-fs: 4.2.11 + istanbul-lib-coverage: 3.2.2 + istanbul-lib-instrument: 6.0.3 + istanbul-lib-report: 3.0.1 + istanbul-lib-source-maps: 4.0.1 + istanbul-reports: 3.1.7 + jest-message-util: 29.7.0 + jest-util: 29.7.0 + jest-worker: 29.7.0 + slash: 3.0.0 + string-length: 4.0.2 + strip-ansi: 6.0.1 + v8-to-istanbul: 9.3.0 + transitivePeerDependencies: + - supports-color + + '@jest/schemas@29.6.3': + dependencies: + '@sinclair/typebox': 0.27.8 + + '@jest/source-map@29.6.3': + dependencies: + '@jridgewell/trace-mapping': 0.3.25 + callsites: 3.1.0 + graceful-fs: 4.2.11 + + '@jest/test-result@29.7.0': + dependencies: + '@jest/console': 29.7.0 + '@jest/types': 29.6.3 + '@types/istanbul-lib-coverage': 2.0.6 + collect-v8-coverage: 1.0.2 + + '@jest/test-sequencer@29.7.0': + dependencies: + '@jest/test-result': 29.7.0 + graceful-fs: 4.2.11 + jest-haste-map: 29.7.0 + slash: 3.0.0 + + '@jest/transform@29.7.0': + dependencies: + '@babel/core': 7.26.0 + '@jest/types': 29.6.3 + '@jridgewell/trace-mapping': 0.3.25 + babel-plugin-istanbul: 6.1.1 + chalk: 4.1.2 + convert-source-map: 2.0.0 + fast-json-stable-stringify: 2.1.0 + graceful-fs: 4.2.11 + jest-haste-map: 29.7.0 + jest-regex-util: 29.6.3 + jest-util: 29.7.0 + micromatch: 4.0.8 + pirates: 4.0.6 + slash: 3.0.0 + write-file-atomic: 4.0.2 + transitivePeerDependencies: + - supports-color + + '@jest/types@29.6.3': + dependencies: + '@jest/schemas': 29.6.3 + '@types/istanbul-lib-coverage': 2.0.6 + '@types/istanbul-reports': 3.0.4 + '@types/node': 20.0.0 + '@types/yargs': 17.0.33 + chalk: 4.1.2 + + '@jridgewell/gen-mapping@0.3.5': + dependencies: + '@jridgewell/set-array': 1.2.1 + '@jridgewell/sourcemap-codec': 1.5.0 + '@jridgewell/trace-mapping': 0.3.25 + + '@jridgewell/resolve-uri@3.1.2': {} + + '@jridgewell/set-array@1.2.1': {} + + '@jridgewell/sourcemap-codec@1.5.0': {} + + '@jridgewell/trace-mapping@0.3.25': + dependencies: + '@jridgewell/resolve-uri': 3.1.2 + '@jridgewell/sourcemap-codec': 1.5.0 + + '@jridgewell/trace-mapping@0.3.9': + dependencies: + '@jridgewell/resolve-uri': 3.1.2 + '@jridgewell/sourcemap-codec': 1.5.0 + + '@lezer/common@1.2.3': {} + + '@lezer/cpp@1.1.2': + dependencies: + '@lezer/common': 1.2.3 + '@lezer/highlight': 1.2.1 + '@lezer/lr': 1.4.2 + + '@lezer/go@1.0.0': + dependencies: + '@lezer/common': 1.2.3 + '@lezer/highlight': 1.2.1 + '@lezer/lr': 1.4.2 + + '@lezer/highlight@1.2.1': + dependencies: + '@lezer/common': 1.2.3 + + '@lezer/java@1.1.3': + dependencies: + '@lezer/common': 1.2.3 + '@lezer/highlight': 1.2.1 + '@lezer/lr': 1.4.2 + + '@lezer/javascript@1.4.19': + dependencies: + '@lezer/common': 1.2.3 + '@lezer/highlight': 1.2.1 + '@lezer/lr': 1.4.2 + + '@lezer/lr@1.4.2': + dependencies: + '@lezer/common': 1.2.3 + + '@lezer/python@1.1.14': + dependencies: + '@lezer/common': 1.2.3 + '@lezer/highlight': 1.2.1 + '@lezer/lr': 1.4.2 + + '@msgpack/msgpack@2.8.0': {} + + '@next/env@14.2.13': {} + + '@next/eslint-plugin-next@14.2.13': + dependencies: + glob: 10.3.10 + + '@next/swc-darwin-arm64@14.2.13': + optional: true + + '@next/swc-darwin-x64@14.2.13': + optional: true + + '@next/swc-linux-arm64-gnu@14.2.13': + optional: true + + '@next/swc-linux-arm64-musl@14.2.13': + optional: true + + '@next/swc-linux-x64-gnu@14.2.13': + optional: true + + '@next/swc-linux-x64-musl@14.2.13': + optional: true + + '@next/swc-win32-arm64-msvc@14.2.13': + optional: true + + '@next/swc-win32-ia32-msvc@14.2.13': + optional: true + + '@next/swc-win32-x64-msvc@14.2.13': + optional: true + + '@nodelib/fs.scandir@2.1.5': + dependencies: + '@nodelib/fs.stat': 2.0.5 + run-parallel: 1.2.0 + + '@nodelib/fs.stat@2.0.5': {} + + '@nodelib/fs.walk@1.2.8': + dependencies: + '@nodelib/fs.scandir': 2.1.5 + fastq: 1.17.1 + + '@nolyfill/is-core-module@1.0.39': {} + + '@pkgjs/parseargs@0.11.0': + optional: true + + '@rc-component/async-validator@5.0.4': + dependencies: + '@babel/runtime': 7.25.7 + + '@rc-component/color-picker@2.0.1(react-dom@18.2.0(react@18.2.0))(react@18.2.0)': + dependencies: + '@ant-design/fast-color': 2.0.6 + '@babel/runtime': 7.25.7 + classnames: 2.5.1 + rc-util: 5.43.0(react-dom@18.2.0(react@18.2.0))(react@18.2.0) + react: 18.2.0 + react-dom: 18.2.0(react@18.2.0) + + '@rc-component/context@1.4.0(react-dom@18.2.0(react@18.2.0))(react@18.2.0)': + dependencies: + '@babel/runtime': 7.25.7 + rc-util: 5.43.0(react-dom@18.2.0(react@18.2.0))(react@18.2.0) + react: 18.2.0 + react-dom: 18.2.0(react@18.2.0) + + '@rc-component/mini-decimal@1.1.0': + dependencies: + '@babel/runtime': 7.25.7 + + '@rc-component/mutate-observer@1.1.0(react-dom@18.2.0(react@18.2.0))(react@18.2.0)': + dependencies: + '@babel/runtime': 7.25.7 + classnames: 2.5.1 + rc-util: 5.43.0(react-dom@18.2.0(react@18.2.0))(react@18.2.0) + react: 18.2.0 + react-dom: 18.2.0(react@18.2.0) + + '@rc-component/portal@1.1.2(react-dom@18.2.0(react@18.2.0))(react@18.2.0)': + dependencies: + '@babel/runtime': 7.25.7 + classnames: 2.5.1 + rc-util: 5.43.0(react-dom@18.2.0(react@18.2.0))(react@18.2.0) + react: 18.2.0 + react-dom: 18.2.0(react@18.2.0) + + '@rc-component/qrcode@1.0.0(react-dom@18.2.0(react@18.2.0))(react@18.2.0)': + dependencies: + '@babel/runtime': 7.25.7 + classnames: 2.5.1 + rc-util: 5.43.0(react-dom@18.2.0(react@18.2.0))(react@18.2.0) + react: 18.2.0 + react-dom: 18.2.0(react@18.2.0) + + '@rc-component/tour@1.15.1(react-dom@18.2.0(react@18.2.0))(react@18.2.0)': + dependencies: + '@babel/runtime': 7.25.7 + '@rc-component/portal': 1.1.2(react-dom@18.2.0(react@18.2.0))(react@18.2.0) + '@rc-component/trigger': 2.2.3(react-dom@18.2.0(react@18.2.0))(react@18.2.0) + classnames: 2.5.1 + rc-util: 5.43.0(react-dom@18.2.0(react@18.2.0))(react@18.2.0) + react: 18.2.0 + react-dom: 18.2.0(react@18.2.0) + + '@rc-component/trigger@2.2.3(react-dom@18.2.0(react@18.2.0))(react@18.2.0)': + dependencies: + '@babel/runtime': 7.25.7 + '@rc-component/portal': 1.1.2(react-dom@18.2.0(react@18.2.0))(react@18.2.0) + classnames: 2.5.1 + rc-motion: 2.9.3(react-dom@18.2.0(react@18.2.0))(react@18.2.0) + rc-resize-observer: 1.4.0(react-dom@18.2.0(react@18.2.0))(react@18.2.0) + rc-util: 5.43.0(react-dom@18.2.0(react@18.2.0))(react@18.2.0) + react: 18.2.0 + react-dom: 18.2.0(react@18.2.0) + + '@rtsao/scc@1.1.0': {} + + '@rushstack/eslint-patch@1.10.4': {} + + '@sinclair/typebox@0.27.8': {} + + '@sinonjs/commons@3.0.1': + dependencies: + type-detect: 4.0.8 + + '@sinonjs/fake-timers@10.3.0': + dependencies: + '@sinonjs/commons': 3.0.1 + + '@swc/counter@0.1.3': {} + + '@swc/helpers@0.5.5': + dependencies: + '@swc/counter': 0.1.3 + tslib: 2.7.0 + + '@testing-library/dom@10.4.0': + dependencies: + '@babel/code-frame': 7.26.2 + '@babel/runtime': 7.25.7 + '@types/aria-query': 5.0.4 + aria-query: 5.3.0 + chalk: 4.1.2 + dom-accessibility-api: 0.5.16 + lz-string: 1.5.0 + pretty-format: 27.5.1 + + '@testing-library/jest-dom@6.6.3': + dependencies: + '@adobe/css-tools': 4.4.0 + aria-query: 5.1.3 + chalk: 3.0.0 + css.escape: 1.5.1 + dom-accessibility-api: 0.6.3 + lodash: 4.17.21 + redent: 3.0.0 + + '@testing-library/react@16.0.1(@testing-library/dom@10.4.0)(@types/react-dom@18.3.0)(@types/react@18.3.8)(react-dom@18.2.0(react@18.2.0))(react@18.2.0)': + dependencies: + '@babel/runtime': 7.25.7 + '@testing-library/dom': 10.4.0 + react: 18.2.0 + react-dom: 18.2.0(react@18.2.0) + optionalDependencies: + '@types/react': 18.3.8 + '@types/react-dom': 18.3.0 + + '@tootallnate/once@2.0.0': {} + + '@tsconfig/node10@1.0.11': {} + + '@tsconfig/node12@1.0.11': {} + + '@tsconfig/node14@1.0.3': {} + + '@tsconfig/node16@1.0.4': {} + + '@types/aria-query@5.0.4': {} + + '@types/babel__core@7.20.5': + dependencies: + '@babel/parser': 7.26.2 + '@babel/types': 7.26.0 + '@types/babel__generator': 7.6.8 + '@types/babel__template': 7.4.4 + '@types/babel__traverse': 7.20.6 + + '@types/babel__generator@7.6.8': + dependencies: + '@babel/types': 7.26.0 + + '@types/babel__template@7.4.4': + dependencies: + '@babel/parser': 7.26.2 + '@babel/types': 7.26.0 + + '@types/babel__traverse@7.20.6': + dependencies: + '@babel/types': 7.26.0 + + '@types/chromedriver@81.0.5': + dependencies: + '@types/node': 20.0.0 + + '@types/codemirror@5.60.15': + dependencies: + '@types/tern': 0.23.9 + + '@types/estree@1.0.6': {} + + '@types/graceful-fs@4.1.9': + dependencies: + '@types/node': 20.0.0 + + '@types/istanbul-lib-coverage@2.0.6': {} + + '@types/istanbul-lib-report@3.0.3': + dependencies: + '@types/istanbul-lib-coverage': 2.0.6 + + '@types/istanbul-reports@3.0.4': + dependencies: + '@types/istanbul-lib-report': 3.0.3 + + '@types/jest@29.5.14': + dependencies: + expect: 29.7.0 + pretty-format: 29.7.0 + + '@types/jsdom@20.0.1': + dependencies: + '@types/node': 20.0.0 + '@types/tough-cookie': 4.0.5 + parse5: 7.2.1 + + '@types/json5@0.0.29': {} + + '@types/node@20.0.0': {} + + '@types/peerjs@1.1.0': + dependencies: + peerjs: 1.5.4 + + '@types/prop-types@15.7.13': {} + + '@types/react-dom@18.3.0': + dependencies: + '@types/react': 18.3.8 + + '@types/react@18.3.8': + dependencies: + '@types/prop-types': 15.7.13 + csstype: 3.1.3 + + '@types/selenium-webdriver@4.1.27': + dependencies: + '@types/node': 20.0.0 + '@types/ws': 8.5.13 + + '@types/stack-utils@2.0.3': {} + + '@types/tern@0.23.9': + dependencies: + '@types/estree': 1.0.6 + + '@types/tough-cookie@4.0.5': {} + + '@types/ws@8.5.13': + dependencies: + '@types/node': 20.0.0 + + '@types/yargs-parser@21.0.3': {} + + '@types/yargs@17.0.33': + dependencies: + '@types/yargs-parser': 21.0.3 + + '@typescript-eslint/eslint-plugin@8.8.0(@typescript-eslint/parser@8.8.0(eslint@8.0.0)(typescript@5.0.2))(eslint@8.0.0)(typescript@5.0.2)': + dependencies: + '@eslint-community/regexpp': 4.11.1 + '@typescript-eslint/parser': 8.8.0(eslint@8.0.0)(typescript@5.0.2) + '@typescript-eslint/scope-manager': 8.8.0 + '@typescript-eslint/type-utils': 8.8.0(eslint@8.0.0)(typescript@5.0.2) + '@typescript-eslint/utils': 8.8.0(eslint@8.0.0)(typescript@5.0.2) + '@typescript-eslint/visitor-keys': 8.8.0 + eslint: 8.0.0 + graphemer: 1.4.0 + ignore: 5.3.2 + natural-compare: 1.4.0 + ts-api-utils: 1.3.0(typescript@5.0.2) + optionalDependencies: + typescript: 5.0.2 + transitivePeerDependencies: + - supports-color + + '@typescript-eslint/parser@8.8.0(eslint@8.0.0)(typescript@5.0.2)': + dependencies: + '@typescript-eslint/scope-manager': 8.8.0 + '@typescript-eslint/types': 8.8.0 + '@typescript-eslint/typescript-estree': 8.8.0(typescript@5.0.2) + '@typescript-eslint/visitor-keys': 8.8.0 + debug: 4.3.7 + eslint: 8.0.0 + optionalDependencies: + typescript: 5.0.2 + transitivePeerDependencies: + - supports-color + + '@typescript-eslint/scope-manager@8.8.0': + dependencies: + '@typescript-eslint/types': 8.8.0 + '@typescript-eslint/visitor-keys': 8.8.0 + + '@typescript-eslint/type-utils@8.8.0(eslint@8.0.0)(typescript@5.0.2)': + dependencies: + '@typescript-eslint/typescript-estree': 8.8.0(typescript@5.0.2) + '@typescript-eslint/utils': 8.8.0(eslint@8.0.0)(typescript@5.0.2) + debug: 4.3.7 + ts-api-utils: 1.3.0(typescript@5.0.2) + optionalDependencies: + typescript: 5.0.2 + transitivePeerDependencies: + - eslint + - supports-color + + '@typescript-eslint/types@8.8.0': {} + + '@typescript-eslint/typescript-estree@8.8.0(typescript@5.0.2)': + dependencies: + '@typescript-eslint/types': 8.8.0 + '@typescript-eslint/visitor-keys': 8.8.0 + debug: 4.3.7 + fast-glob: 3.3.2 + is-glob: 4.0.3 + minimatch: 9.0.5 + semver: 7.6.3 + ts-api-utils: 1.3.0(typescript@5.0.2) + optionalDependencies: + typescript: 5.0.2 + transitivePeerDependencies: + - supports-color + + '@typescript-eslint/utils@8.8.0(eslint@8.0.0)(typescript@5.0.2)': + dependencies: + '@eslint-community/eslint-utils': 4.4.0(eslint@8.0.0) + '@typescript-eslint/scope-manager': 8.8.0 + '@typescript-eslint/types': 8.8.0 + '@typescript-eslint/typescript-estree': 8.8.0(typescript@5.0.2) + eslint: 8.0.0 + transitivePeerDependencies: + - supports-color + - typescript + + '@typescript-eslint/visitor-keys@8.8.0': + dependencies: + '@typescript-eslint/types': 8.8.0 + eslint-visitor-keys: 3.4.3 + + abab@2.0.6: {} + + acorn-globals@7.0.1: + dependencies: + acorn: 8.12.1 + acorn-walk: 8.3.4 + + acorn-jsx@5.3.2(acorn@8.12.1): + dependencies: + acorn: 8.12.1 + + acorn-walk@8.3.4: + dependencies: + acorn: 8.12.1 + + acorn@8.12.1: {} + + agent-base@6.0.2: + dependencies: + debug: 4.3.7 + transitivePeerDependencies: + - supports-color + + ajv@6.12.6: + dependencies: + fast-deep-equal: 3.1.3 + fast-json-stable-stringify: 2.1.0 + json-schema-traverse: 0.4.1 + uri-js: 4.4.1 + + ansi-colors@4.1.3: {} + + ansi-escapes@4.3.2: + dependencies: + type-fest: 0.21.3 + + ansi-regex@5.0.1: {} + + ansi-regex@6.1.0: {} + + ansi-styles@4.3.0: + dependencies: + color-convert: 2.0.1 + + ansi-styles@5.2.0: {} + + ansi-styles@6.2.1: {} + + antd@5.20.6(react-dom@18.2.0(react@18.2.0))(react@18.2.0): + dependencies: + '@ant-design/colors': 7.1.0 + '@ant-design/cssinjs': 1.21.1(react-dom@18.2.0(react@18.2.0))(react@18.2.0) + '@ant-design/cssinjs-utils': 1.1.0(react-dom@18.2.0(react@18.2.0))(react@18.2.0) + '@ant-design/icons': 5.5.1(react-dom@18.2.0(react@18.2.0))(react@18.2.0) + '@ant-design/react-slick': 1.1.2(react@18.2.0) + '@babel/runtime': 7.25.7 + '@ctrl/tinycolor': 3.6.1 + '@rc-component/color-picker': 2.0.1(react-dom@18.2.0(react@18.2.0))(react@18.2.0) + '@rc-component/mutate-observer': 1.1.0(react-dom@18.2.0(react@18.2.0))(react@18.2.0) + '@rc-component/qrcode': 1.0.0(react-dom@18.2.0(react@18.2.0))(react@18.2.0) + '@rc-component/tour': 1.15.1(react-dom@18.2.0(react@18.2.0))(react@18.2.0) + '@rc-component/trigger': 2.2.3(react-dom@18.2.0(react@18.2.0))(react@18.2.0) + classnames: 2.5.1 + copy-to-clipboard: 3.3.3 + dayjs: 1.11.13 + rc-cascader: 3.28.1(react-dom@18.2.0(react@18.2.0))(react@18.2.0) + rc-checkbox: 3.3.0(react-dom@18.2.0(react@18.2.0))(react@18.2.0) + rc-collapse: 3.7.3(react-dom@18.2.0(react@18.2.0))(react@18.2.0) + rc-dialog: 9.5.2(react-dom@18.2.0(react@18.2.0))(react@18.2.0) + rc-drawer: 7.2.0(react-dom@18.2.0(react@18.2.0))(react@18.2.0) + rc-dropdown: 4.2.0(react-dom@18.2.0(react@18.2.0))(react@18.2.0) + rc-field-form: 2.4.0(react-dom@18.2.0(react@18.2.0))(react@18.2.0) + rc-image: 7.9.0(react-dom@18.2.0(react@18.2.0))(react@18.2.0) + rc-input: 1.6.3(react-dom@18.2.0(react@18.2.0))(react@18.2.0) + rc-input-number: 9.2.0(react-dom@18.2.0(react@18.2.0))(react@18.2.0) + rc-mentions: 2.15.0(react-dom@18.2.0(react@18.2.0))(react@18.2.0) + rc-menu: 9.14.1(react-dom@18.2.0(react@18.2.0))(react@18.2.0) + rc-motion: 2.9.3(react-dom@18.2.0(react@18.2.0))(react@18.2.0) + rc-notification: 5.6.2(react-dom@18.2.0(react@18.2.0))(react@18.2.0) + rc-pagination: 4.2.0(react-dom@18.2.0(react@18.2.0))(react@18.2.0) + rc-picker: 4.6.15(dayjs@1.11.13)(react-dom@18.2.0(react@18.2.0))(react@18.2.0) + rc-progress: 4.0.0(react-dom@18.2.0(react@18.2.0))(react@18.2.0) + rc-rate: 2.13.0(react-dom@18.2.0(react@18.2.0))(react@18.2.0) + rc-resize-observer: 1.4.0(react-dom@18.2.0(react@18.2.0))(react@18.2.0) + rc-segmented: 2.3.0(react-dom@18.2.0(react@18.2.0))(react@18.2.0) + rc-select: 14.15.2(react-dom@18.2.0(react@18.2.0))(react@18.2.0) + rc-slider: 11.1.6(react-dom@18.2.0(react@18.2.0))(react@18.2.0) + rc-steps: 6.0.1(react-dom@18.2.0(react@18.2.0))(react@18.2.0) + rc-switch: 4.1.0(react-dom@18.2.0(react@18.2.0))(react@18.2.0) + rc-table: 7.45.7(react-dom@18.2.0(react@18.2.0))(react@18.2.0) + rc-tabs: 15.1.1(react-dom@18.2.0(react@18.2.0))(react@18.2.0) + rc-textarea: 1.8.2(react-dom@18.2.0(react@18.2.0))(react@18.2.0) + rc-tooltip: 6.2.1(react-dom@18.2.0(react@18.2.0))(react@18.2.0) + rc-tree: 5.9.0(react-dom@18.2.0(react@18.2.0))(react@18.2.0) + rc-tree-select: 5.23.0(react-dom@18.2.0(react@18.2.0))(react@18.2.0) + rc-upload: 4.7.0(react-dom@18.2.0(react@18.2.0))(react@18.2.0) + rc-util: 5.43.0(react-dom@18.2.0(react@18.2.0))(react@18.2.0) + react: 18.2.0 + react-dom: 18.2.0(react@18.2.0) + scroll-into-view-if-needed: 3.1.0 + throttle-debounce: 5.0.2 + transitivePeerDependencies: + - date-fns + - luxon + - moment + + anymatch@3.1.3: + dependencies: + normalize-path: 3.0.0 + picomatch: 2.3.1 + + arg@4.1.3: {} + + argparse@1.0.10: + dependencies: + sprintf-js: 1.0.3 + + argparse@2.0.1: {} + + aria-query@5.1.3: + dependencies: + deep-equal: 2.2.3 + + aria-query@5.3.0: + dependencies: + dequal: 2.0.3 + + array-buffer-byte-length@1.0.1: + dependencies: + call-bind: 1.0.7 + is-array-buffer: 3.0.4 + + array-includes@3.1.8: + dependencies: + call-bind: 1.0.7 + define-properties: 1.2.1 + es-abstract: 1.23.3 + es-object-atoms: 1.0.0 + get-intrinsic: 1.2.4 + is-string: 1.0.7 + + array-tree-filter@2.1.0: {} + + array.prototype.findlast@1.2.5: + dependencies: + call-bind: 1.0.7 + define-properties: 1.2.1 + es-abstract: 1.23.3 + es-errors: 1.3.0 + es-object-atoms: 1.0.0 + es-shim-unscopables: 1.0.2 + + array.prototype.findlastindex@1.2.5: + dependencies: + call-bind: 1.0.7 + define-properties: 1.2.1 + es-abstract: 1.23.3 + es-errors: 1.3.0 + es-object-atoms: 1.0.0 + es-shim-unscopables: 1.0.2 + + array.prototype.flat@1.3.2: + dependencies: + call-bind: 1.0.7 + define-properties: 1.2.1 + es-abstract: 1.23.3 + es-shim-unscopables: 1.0.2 + + array.prototype.flatmap@1.3.2: + dependencies: + call-bind: 1.0.7 + define-properties: 1.2.1 + es-abstract: 1.23.3 + es-shim-unscopables: 1.0.2 + + array.prototype.tosorted@1.1.4: + dependencies: + call-bind: 1.0.7 + define-properties: 1.2.1 + es-abstract: 1.23.3 + es-errors: 1.3.0 + es-shim-unscopables: 1.0.2 + + arraybuffer.prototype.slice@1.0.3: + dependencies: + array-buffer-byte-length: 1.0.1 + call-bind: 1.0.7 + define-properties: 1.2.1 + es-abstract: 1.23.3 + es-errors: 1.3.0 + get-intrinsic: 1.2.4 + is-array-buffer: 3.0.4 + is-shared-array-buffer: 1.0.3 + + ast-types-flow@0.0.8: {} + + asynckit@0.4.0: {} + + available-typed-arrays@1.0.7: + dependencies: + possible-typed-array-names: 1.0.0 + + axe-core@4.10.0: {} + + axobject-query@4.1.0: {} + + babel-jest@29.7.0(@babel/core@7.26.0): + dependencies: + '@babel/core': 7.26.0 + '@jest/transform': 29.7.0 + '@types/babel__core': 7.20.5 + babel-plugin-istanbul: 6.1.1 + babel-preset-jest: 29.6.3(@babel/core@7.26.0) + chalk: 4.1.2 + graceful-fs: 4.2.11 + slash: 3.0.0 + transitivePeerDependencies: + - supports-color + + babel-plugin-istanbul@6.1.1: + dependencies: + '@babel/helper-plugin-utils': 7.25.9 + '@istanbuljs/load-nyc-config': 1.1.0 + '@istanbuljs/schema': 0.1.3 + istanbul-lib-instrument: 5.2.1 + test-exclude: 6.0.0 + transitivePeerDependencies: + - supports-color + + babel-plugin-jest-hoist@29.6.3: + dependencies: + '@babel/template': 7.25.9 + '@babel/types': 7.26.0 + '@types/babel__core': 7.20.5 + '@types/babel__traverse': 7.20.6 + + babel-preset-current-node-syntax@1.1.0(@babel/core@7.26.0): + dependencies: + '@babel/core': 7.26.0 + '@babel/plugin-syntax-async-generators': 7.8.4(@babel/core@7.26.0) + '@babel/plugin-syntax-bigint': 7.8.3(@babel/core@7.26.0) + '@babel/plugin-syntax-class-properties': 7.12.13(@babel/core@7.26.0) + '@babel/plugin-syntax-class-static-block': 7.14.5(@babel/core@7.26.0) + '@babel/plugin-syntax-import-attributes': 7.26.0(@babel/core@7.26.0) + '@babel/plugin-syntax-import-meta': 7.10.4(@babel/core@7.26.0) + '@babel/plugin-syntax-json-strings': 7.8.3(@babel/core@7.26.0) + '@babel/plugin-syntax-logical-assignment-operators': 7.10.4(@babel/core@7.26.0) + '@babel/plugin-syntax-nullish-coalescing-operator': 7.8.3(@babel/core@7.26.0) + '@babel/plugin-syntax-numeric-separator': 7.10.4(@babel/core@7.26.0) + '@babel/plugin-syntax-object-rest-spread': 7.8.3(@babel/core@7.26.0) + '@babel/plugin-syntax-optional-catch-binding': 7.8.3(@babel/core@7.26.0) + '@babel/plugin-syntax-optional-chaining': 7.8.3(@babel/core@7.26.0) + '@babel/plugin-syntax-private-property-in-object': 7.14.5(@babel/core@7.26.0) + '@babel/plugin-syntax-top-level-await': 7.14.5(@babel/core@7.26.0) + + babel-preset-jest@29.6.3(@babel/core@7.26.0): + dependencies: + '@babel/core': 7.26.0 + babel-plugin-jest-hoist: 29.6.3 + babel-preset-current-node-syntax: 1.1.0(@babel/core@7.26.0) + + balanced-match@1.0.2: {} + + base64-js@1.5.1: {} + + brace-expansion@1.1.11: + dependencies: + balanced-match: 1.0.2 + concat-map: 0.0.1 + + brace-expansion@2.0.1: + dependencies: + balanced-match: 1.0.2 + + braces@3.0.3: + dependencies: + fill-range: 7.1.1 + + browserslist@4.24.2: + dependencies: + caniuse-lite: 1.0.30001677 + electron-to-chromium: 1.5.50 + node-releases: 2.0.18 + update-browserslist-db: 1.1.1(browserslist@4.24.2) + + bser@2.1.1: + dependencies: + node-int64: 0.4.0 + + buffer-from@1.1.2: {} + + buffer@6.0.3: + dependencies: + base64-js: 1.5.1 + ieee754: 1.2.1 + + busboy@1.6.0: + dependencies: + streamsearch: 1.1.0 + + call-bind@1.0.7: + dependencies: + es-define-property: 1.0.0 + es-errors: 1.3.0 + function-bind: 1.1.2 + get-intrinsic: 1.2.4 + set-function-length: 1.2.2 + + callsites@3.1.0: {} + + camelcase@5.3.1: {} + + camelcase@6.3.0: {} + + caniuse-lite@1.0.30001666: {} + + caniuse-lite@1.0.30001677: {} + + chalk@3.0.0: + dependencies: + ansi-styles: 4.3.0 + supports-color: 7.2.0 + + chalk@4.1.2: + dependencies: + ansi-styles: 4.3.0 + supports-color: 7.2.0 + + char-regex@1.0.2: {} + + chokidar@4.0.1: + dependencies: + readdirp: 4.0.1 + + ci-info@3.9.0: {} + + cjs-module-lexer@1.4.1: {} + + classnames@2.5.1: {} + + client-only@0.0.1: {} + + cliui@8.0.1: + dependencies: + string-width: 4.2.3 + strip-ansi: 6.0.1 + wrap-ansi: 7.0.0 + + co@4.6.0: {} + + codemirror@6.0.1(@lezer/common@1.2.3): + dependencies: + '@codemirror/autocomplete': 6.18.1(@codemirror/language@6.10.3)(@codemirror/state@6.4.1)(@codemirror/view@6.34.1)(@lezer/common@1.2.3) + '@codemirror/commands': 6.7.1 + '@codemirror/language': 6.10.3 + '@codemirror/lint': 6.8.2 + '@codemirror/search': 6.5.6 + '@codemirror/state': 6.4.1 + '@codemirror/view': 6.34.1 + transitivePeerDependencies: + - '@lezer/common' + + collect-v8-coverage@1.0.2: {} + + color-convert@2.0.1: + dependencies: + color-name: 1.1.4 + + color-name@1.1.4: {} + + combined-stream@1.0.8: + dependencies: + delayed-stream: 1.0.0 + + compute-scroll-into-view@3.1.0: {} + + concat-map@0.0.1: {} + + convert-source-map@2.0.0: {} + + copy-to-clipboard@3.3.3: + dependencies: + toggle-selection: 1.0.6 + + core-util-is@1.0.3: {} + + create-jest@29.7.0(@types/node@20.0.0)(ts-node@10.9.2(@types/node@20.0.0)(typescript@5.0.2)): + dependencies: + '@jest/types': 29.6.3 + chalk: 4.1.2 + exit: 0.1.2 + graceful-fs: 4.2.11 + jest-config: 29.7.0(@types/node@20.0.0)(ts-node@10.9.2(@types/node@20.0.0)(typescript@5.0.2)) + jest-util: 29.7.0 + prompts: 2.4.2 + transitivePeerDependencies: + - '@types/node' + - babel-plugin-macros + - supports-color + - ts-node + + create-require@1.1.1: {} + + crelt@1.0.6: {} + + cross-spawn@7.0.3: + dependencies: + path-key: 3.1.1 + shebang-command: 2.0.0 + which: 2.0.2 + + css.escape@1.5.1: {} + + cssom@0.3.8: {} + + cssom@0.5.0: {} + + cssstyle@2.3.0: + dependencies: + cssom: 0.3.8 + + csstype@3.1.3: {} + + damerau-levenshtein@1.0.8: {} + + data-urls@3.0.2: + dependencies: + abab: 2.0.6 + whatwg-mimetype: 3.0.0 + whatwg-url: 11.0.0 + + data-view-buffer@1.0.1: + dependencies: + call-bind: 1.0.7 + es-errors: 1.3.0 + is-data-view: 1.0.1 + + data-view-byte-length@1.0.1: + dependencies: + call-bind: 1.0.7 + es-errors: 1.3.0 + is-data-view: 1.0.1 + + data-view-byte-offset@1.0.0: + dependencies: + call-bind: 1.0.7 + es-errors: 1.3.0 + is-data-view: 1.0.1 + + dayjs@1.11.13: {} + + debug@3.2.7: + dependencies: + ms: 2.1.3 + + debug@4.3.7: + dependencies: + ms: 2.1.3 + + decimal.js@10.4.3: {} + + dedent@1.5.3: {} + + deep-equal@2.2.3: + dependencies: + array-buffer-byte-length: 1.0.1 + call-bind: 1.0.7 + es-get-iterator: 1.1.3 + get-intrinsic: 1.2.4 + is-arguments: 1.1.1 + is-array-buffer: 3.0.4 + is-date-object: 1.0.5 + is-regex: 1.1.4 + is-shared-array-buffer: 1.0.3 + isarray: 2.0.5 + object-is: 1.1.6 + object-keys: 1.1.1 + object.assign: 4.1.5 + regexp.prototype.flags: 1.5.3 + side-channel: 1.0.6 + which-boxed-primitive: 1.0.2 + which-collection: 1.0.2 + which-typed-array: 1.1.15 + + deep-is@0.1.4: {} + + deepmerge@4.3.1: {} + + define-data-property@1.1.4: + dependencies: + es-define-property: 1.0.0 + es-errors: 1.3.0 + gopd: 1.0.1 + + define-properties@1.2.1: + dependencies: + define-data-property: 1.1.4 + has-property-descriptors: 1.0.2 + object-keys: 1.1.1 + + delayed-stream@1.0.0: {} + + dequal@2.0.3: {} + + detect-newline@3.1.0: {} + + diff-sequences@29.6.3: {} + + diff@4.0.2: {} + + doctrine@2.1.0: + dependencies: + esutils: 2.0.3 + + doctrine@3.0.0: + dependencies: + esutils: 2.0.3 + + dom-accessibility-api@0.5.16: {} + + dom-accessibility-api@0.6.3: {} + + domexception@4.0.0: + dependencies: + webidl-conversions: 7.0.0 + + eastasianwidth@0.2.0: {} + + electron-to-chromium@1.5.50: {} + + emittery@0.13.1: {} + + emoji-regex@8.0.0: {} + + emoji-regex@9.2.2: {} + + enhanced-resolve@5.17.1: + dependencies: + graceful-fs: 4.2.11 + tapable: 2.2.1 + + enquirer@2.4.1: + dependencies: + ansi-colors: 4.1.3 + strip-ansi: 6.0.1 + + entities@4.5.0: {} + + err-code@3.0.1: {} + + error-ex@1.3.2: + dependencies: + is-arrayish: 0.2.1 + + es-abstract@1.23.3: + dependencies: + array-buffer-byte-length: 1.0.1 + arraybuffer.prototype.slice: 1.0.3 + available-typed-arrays: 1.0.7 + call-bind: 1.0.7 + data-view-buffer: 1.0.1 + data-view-byte-length: 1.0.1 + data-view-byte-offset: 1.0.0 + es-define-property: 1.0.0 + es-errors: 1.3.0 + es-object-atoms: 1.0.0 + es-set-tostringtag: 2.0.3 + es-to-primitive: 1.2.1 + function.prototype.name: 1.1.6 + get-intrinsic: 1.2.4 + get-symbol-description: 1.0.2 + globalthis: 1.0.4 + gopd: 1.0.1 + has-property-descriptors: 1.0.2 + has-proto: 1.0.3 + has-symbols: 1.0.3 + hasown: 2.0.2 + internal-slot: 1.0.7 + is-array-buffer: 3.0.4 + is-callable: 1.2.7 + is-data-view: 1.0.1 + is-negative-zero: 2.0.3 + is-regex: 1.1.4 + is-shared-array-buffer: 1.0.3 + is-string: 1.0.7 + is-typed-array: 1.1.13 + is-weakref: 1.0.2 + object-inspect: 1.13.2 + object-keys: 1.1.1 + object.assign: 4.1.5 + regexp.prototype.flags: 1.5.3 + safe-array-concat: 1.1.2 + safe-regex-test: 1.0.3 + string.prototype.trim: 1.2.9 + string.prototype.trimend: 1.0.8 + string.prototype.trimstart: 1.0.8 + typed-array-buffer: 1.0.2 + typed-array-byte-length: 1.0.1 + typed-array-byte-offset: 1.0.2 + typed-array-length: 1.0.6 + unbox-primitive: 1.0.2 + which-typed-array: 1.1.15 + + es-define-property@1.0.0: + dependencies: + get-intrinsic: 1.2.4 + + es-errors@1.3.0: {} + + es-get-iterator@1.1.3: + dependencies: + call-bind: 1.0.7 + get-intrinsic: 1.2.4 + has-symbols: 1.0.3 + is-arguments: 1.1.1 + is-map: 2.0.3 + is-set: 2.0.3 + is-string: 1.0.7 + isarray: 2.0.5 + stop-iteration-iterator: 1.0.0 + + es-iterator-helpers@1.0.19: + dependencies: + call-bind: 1.0.7 + define-properties: 1.2.1 + es-abstract: 1.23.3 + es-errors: 1.3.0 + es-set-tostringtag: 2.0.3 + function-bind: 1.1.2 + get-intrinsic: 1.2.4 + globalthis: 1.0.4 + has-property-descriptors: 1.0.2 + has-proto: 1.0.3 + has-symbols: 1.0.3 + internal-slot: 1.0.7 + iterator.prototype: 1.1.2 + safe-array-concat: 1.1.2 + + es-object-atoms@1.0.0: + dependencies: + es-errors: 1.3.0 + + es-set-tostringtag@2.0.3: + dependencies: + get-intrinsic: 1.2.4 + has-tostringtag: 1.0.2 + hasown: 2.0.2 + + es-shim-unscopables@1.0.2: + dependencies: + hasown: 2.0.2 + + es-to-primitive@1.2.1: + dependencies: + is-callable: 1.2.7 + is-date-object: 1.0.5 + is-symbol: 1.0.4 + + escalade@3.2.0: {} + + escape-string-regexp@2.0.0: {} + + escape-string-regexp@4.0.0: {} + + escodegen@2.1.0: + dependencies: + esprima: 4.0.1 + estraverse: 5.3.0 + esutils: 2.0.3 + optionalDependencies: + source-map: 0.6.1 + + eslint-config-next@14.2.13(eslint@8.0.0)(typescript@5.0.2): + dependencies: + '@next/eslint-plugin-next': 14.2.13 + '@rushstack/eslint-patch': 1.10.4 + '@typescript-eslint/eslint-plugin': 8.8.0(@typescript-eslint/parser@8.8.0(eslint@8.0.0)(typescript@5.0.2))(eslint@8.0.0)(typescript@5.0.2) + '@typescript-eslint/parser': 8.8.0(eslint@8.0.0)(typescript@5.0.2) + eslint: 8.0.0 + eslint-import-resolver-node: 0.3.9 + eslint-import-resolver-typescript: 3.6.3(@typescript-eslint/parser@8.8.0(eslint@8.0.0)(typescript@5.0.2))(eslint-import-resolver-node@0.3.9)(eslint-plugin-import@2.30.0)(eslint@8.0.0) + eslint-plugin-import: 2.30.0(@typescript-eslint/parser@8.8.0(eslint@8.0.0)(typescript@5.0.2))(eslint-import-resolver-typescript@3.6.3)(eslint@8.0.0) + eslint-plugin-jsx-a11y: 6.10.0(eslint@8.0.0) + eslint-plugin-react: 7.37.1(eslint@8.0.0) + eslint-plugin-react-hooks: 4.6.2(eslint@8.0.0) + optionalDependencies: + typescript: 5.0.2 + transitivePeerDependencies: + - eslint-import-resolver-webpack + - eslint-plugin-import-x + - supports-color + + eslint-import-resolver-node@0.3.9: + dependencies: + debug: 3.2.7 + is-core-module: 2.15.1 + resolve: 1.22.8 + transitivePeerDependencies: + - supports-color + + eslint-import-resolver-typescript@3.6.3(@typescript-eslint/parser@8.8.0(eslint@8.0.0)(typescript@5.0.2))(eslint-import-resolver-node@0.3.9)(eslint-plugin-import@2.30.0)(eslint@8.0.0): + dependencies: + '@nolyfill/is-core-module': 1.0.39 + debug: 4.3.7 + enhanced-resolve: 5.17.1 + eslint: 8.0.0 + eslint-module-utils: 2.12.0(@typescript-eslint/parser@8.8.0(eslint@8.0.0)(typescript@5.0.2))(eslint-import-resolver-node@0.3.9)(eslint-import-resolver-typescript@3.6.3(@typescript-eslint/parser@8.8.0(eslint@8.0.0)(typescript@5.0.2))(eslint-import-resolver-node@0.3.9)(eslint-plugin-import@2.30.0)(eslint@8.0.0))(eslint@8.0.0) + fast-glob: 3.3.2 + get-tsconfig: 4.8.1 + is-bun-module: 1.2.1 + is-glob: 4.0.3 + optionalDependencies: + eslint-plugin-import: 2.30.0(@typescript-eslint/parser@8.8.0(eslint@8.0.0)(typescript@5.0.2))(eslint-import-resolver-typescript@3.6.3)(eslint@8.0.0) + transitivePeerDependencies: + - '@typescript-eslint/parser' + - eslint-import-resolver-node + - eslint-import-resolver-webpack + - supports-color + + eslint-module-utils@2.12.0(@typescript-eslint/parser@8.8.0(eslint@8.0.0)(typescript@5.0.2))(eslint-import-resolver-node@0.3.9)(eslint-import-resolver-typescript@3.6.3(@typescript-eslint/parser@8.8.0(eslint@8.0.0)(typescript@5.0.2))(eslint-import-resolver-node@0.3.9)(eslint-plugin-import@2.30.0)(eslint@8.0.0))(eslint@8.0.0): + dependencies: + debug: 3.2.7 + optionalDependencies: + '@typescript-eslint/parser': 8.8.0(eslint@8.0.0)(typescript@5.0.2) + eslint: 8.0.0 + eslint-import-resolver-node: 0.3.9 + eslint-import-resolver-typescript: 3.6.3(@typescript-eslint/parser@8.8.0(eslint@8.0.0)(typescript@5.0.2))(eslint-import-resolver-node@0.3.9)(eslint-plugin-import@2.30.0)(eslint@8.0.0) + transitivePeerDependencies: + - supports-color + + eslint-plugin-import@2.30.0(@typescript-eslint/parser@8.8.0(eslint@8.0.0)(typescript@5.0.2))(eslint-import-resolver-typescript@3.6.3)(eslint@8.0.0): + dependencies: + '@rtsao/scc': 1.1.0 + array-includes: 3.1.8 + array.prototype.findlastindex: 1.2.5 + array.prototype.flat: 1.3.2 + array.prototype.flatmap: 1.3.2 + debug: 3.2.7 + doctrine: 2.1.0 + eslint: 8.0.0 + eslint-import-resolver-node: 0.3.9 + eslint-module-utils: 2.12.0(@typescript-eslint/parser@8.8.0(eslint@8.0.0)(typescript@5.0.2))(eslint-import-resolver-node@0.3.9)(eslint-import-resolver-typescript@3.6.3(@typescript-eslint/parser@8.8.0(eslint@8.0.0)(typescript@5.0.2))(eslint-import-resolver-node@0.3.9)(eslint-plugin-import@2.30.0)(eslint@8.0.0))(eslint@8.0.0) + hasown: 2.0.2 + is-core-module: 2.15.1 + is-glob: 4.0.3 + minimatch: 3.1.2 + object.fromentries: 2.0.8 + object.groupby: 1.0.3 + object.values: 1.2.0 + semver: 6.3.1 + tsconfig-paths: 3.15.0 + optionalDependencies: + '@typescript-eslint/parser': 8.8.0(eslint@8.0.0)(typescript@5.0.2) + transitivePeerDependencies: + - eslint-import-resolver-typescript + - eslint-import-resolver-webpack + - supports-color + + eslint-plugin-jsx-a11y@6.10.0(eslint@8.0.0): + dependencies: + aria-query: 5.1.3 + array-includes: 3.1.8 + array.prototype.flatmap: 1.3.2 + ast-types-flow: 0.0.8 + axe-core: 4.10.0 + axobject-query: 4.1.0 + damerau-levenshtein: 1.0.8 + emoji-regex: 9.2.2 + es-iterator-helpers: 1.0.19 + eslint: 8.0.0 + hasown: 2.0.2 + jsx-ast-utils: 3.3.5 + language-tags: 1.0.9 + minimatch: 3.1.2 + object.fromentries: 2.0.8 + safe-regex-test: 1.0.3 + string.prototype.includes: 2.0.0 + + eslint-plugin-react-hooks@4.6.2(eslint@8.0.0): + dependencies: + eslint: 8.0.0 + + eslint-plugin-react@7.37.1(eslint@8.0.0): + dependencies: + array-includes: 3.1.8 + array.prototype.findlast: 1.2.5 + array.prototype.flatmap: 1.3.2 + array.prototype.tosorted: 1.1.4 + doctrine: 2.1.0 + es-iterator-helpers: 1.0.19 + eslint: 8.0.0 + estraverse: 5.3.0 + hasown: 2.0.2 + jsx-ast-utils: 3.3.5 + minimatch: 3.1.2 + object.entries: 1.1.8 + object.fromentries: 2.0.8 + object.values: 1.2.0 + prop-types: 15.8.1 + resolve: 2.0.0-next.5 + semver: 6.3.1 + string.prototype.matchall: 4.0.11 + string.prototype.repeat: 1.0.0 + + eslint-scope@6.0.0: + dependencies: + esrecurse: 4.3.0 + estraverse: 5.3.0 + + eslint-utils@3.0.0(eslint@8.0.0): + dependencies: + eslint: 8.0.0 + eslint-visitor-keys: 2.1.0 + + eslint-visitor-keys@2.1.0: {} + + eslint-visitor-keys@3.4.3: {} + + eslint@8.0.0: + dependencies: + '@eslint/eslintrc': 1.4.1 + '@humanwhocodes/config-array': 0.6.0 + ajv: 6.12.6 + chalk: 4.1.2 + cross-spawn: 7.0.3 + debug: 4.3.7 + doctrine: 3.0.0 + enquirer: 2.4.1 + escape-string-regexp: 4.0.0 + eslint-scope: 6.0.0 + eslint-utils: 3.0.0(eslint@8.0.0) + eslint-visitor-keys: 3.4.3 + espree: 9.6.1 + esquery: 1.6.0 + esutils: 2.0.3 + fast-deep-equal: 3.1.3 + file-entry-cache: 6.0.1 + functional-red-black-tree: 1.0.1 + glob-parent: 6.0.2 + globals: 13.24.0 + ignore: 4.0.6 + import-fresh: 3.3.0 + imurmurhash: 0.1.4 + is-glob: 4.0.3 + js-yaml: 4.1.0 + json-stable-stringify-without-jsonify: 1.0.1 + levn: 0.4.1 + lodash.merge: 4.6.2 + minimatch: 3.1.2 + natural-compare: 1.4.0 + optionator: 0.9.4 + progress: 2.0.3 + regexpp: 3.2.0 + semver: 7.6.3 + strip-ansi: 6.0.1 + strip-json-comments: 3.1.1 + text-table: 0.2.0 + v8-compile-cache: 2.4.0 + transitivePeerDependencies: + - supports-color + + espree@9.6.1: + dependencies: + acorn: 8.12.1 + acorn-jsx: 5.3.2(acorn@8.12.1) + eslint-visitor-keys: 3.4.3 + + esprima@4.0.1: {} + + esquery@1.6.0: + dependencies: + estraverse: 5.3.0 + + esrecurse@4.3.0: + dependencies: + estraverse: 5.3.0 + + estraverse@5.3.0: {} + + esutils@2.0.3: {} + + eventemitter3@4.0.7: {} + + execa@5.1.1: + dependencies: + cross-spawn: 7.0.3 + get-stream: 6.0.1 + human-signals: 2.1.0 + is-stream: 2.0.1 + merge-stream: 2.0.0 + npm-run-path: 4.0.1 + onetime: 5.1.2 + signal-exit: 3.0.7 + strip-final-newline: 2.0.0 + + exit@0.1.2: {} + + expect@29.7.0: + dependencies: + '@jest/expect-utils': 29.7.0 + jest-get-type: 29.6.3 + jest-matcher-utils: 29.7.0 + jest-message-util: 29.7.0 + jest-util: 29.7.0 + + fast-deep-equal@3.1.3: {} + + fast-glob@3.3.2: + dependencies: + '@nodelib/fs.stat': 2.0.5 + '@nodelib/fs.walk': 1.2.8 + glob-parent: 5.1.2 + merge2: 1.4.1 + micromatch: 4.0.8 + + fast-json-stable-stringify@2.1.0: {} + + fast-levenshtein@2.0.6: {} + + fastq@1.17.1: + dependencies: + reusify: 1.0.4 + + fb-watchman@2.0.2: + dependencies: + bser: 2.1.1 + + file-entry-cache@6.0.1: + dependencies: + flat-cache: 3.2.0 + + fill-range@7.1.1: + dependencies: + to-regex-range: 5.0.1 + + find-up@4.1.0: + dependencies: + locate-path: 5.0.0 + path-exists: 4.0.0 + + flat-cache@3.2.0: + dependencies: + flatted: 3.3.1 + keyv: 4.5.4 + rimraf: 3.0.2 + + flatted@3.3.1: {} + + for-each@0.3.3: + dependencies: + is-callable: 1.2.7 + + foreground-child@3.3.0: + dependencies: + cross-spawn: 7.0.3 + signal-exit: 4.1.0 + + form-data@4.0.1: + dependencies: + asynckit: 0.4.0 + combined-stream: 1.0.8 + mime-types: 2.1.35 + + fs.realpath@1.0.0: {} + + fsevents@2.3.3: + optional: true + + function-bind@1.1.2: {} + + function.prototype.name@1.1.6: + dependencies: + call-bind: 1.0.7 + define-properties: 1.2.1 + es-abstract: 1.23.3 + functions-have-names: 1.2.3 + + functional-red-black-tree@1.0.1: {} + + functions-have-names@1.2.3: {} + + gensync@1.0.0-beta.2: {} + + get-browser-rtc@1.1.0: {} + + get-caller-file@2.0.5: {} + + get-intrinsic@1.2.4: + dependencies: + es-errors: 1.3.0 + function-bind: 1.1.2 + has-proto: 1.0.3 + has-symbols: 1.0.3 + hasown: 2.0.2 + + get-package-type@0.1.0: {} + + get-stream@6.0.1: {} + + get-symbol-description@1.0.2: + dependencies: + call-bind: 1.0.7 + es-errors: 1.3.0 + get-intrinsic: 1.2.4 + + get-tsconfig@4.8.1: + dependencies: + resolve-pkg-maps: 1.0.0 + + glob-parent@5.1.2: + dependencies: + is-glob: 4.0.3 + + glob-parent@6.0.2: + dependencies: + is-glob: 4.0.3 + + glob@10.3.10: + dependencies: + foreground-child: 3.3.0 + jackspeak: 2.3.6 + minimatch: 9.0.5 + minipass: 7.1.2 + path-scurry: 1.11.1 + + glob@7.2.3: + dependencies: + fs.realpath: 1.0.0 + inflight: 1.0.6 + inherits: 2.0.4 + minimatch: 3.1.2 + once: 1.4.0 + path-is-absolute: 1.0.1 + + globals@11.12.0: {} + + globals@13.24.0: + dependencies: + type-fest: 0.20.2 + + globalthis@1.0.4: + dependencies: + define-properties: 1.2.1 + gopd: 1.0.1 + + gopd@1.0.1: + dependencies: + get-intrinsic: 1.2.4 + + graceful-fs@4.2.11: {} + + graphemer@1.4.0: {} + + has-bigints@1.0.2: {} + + has-flag@4.0.0: {} + + has-property-descriptors@1.0.2: + dependencies: + es-define-property: 1.0.0 + + has-proto@1.0.3: {} + + has-symbols@1.0.3: {} + + has-tostringtag@1.0.2: + dependencies: + has-symbols: 1.0.3 + + hasown@2.0.2: + dependencies: + function-bind: 1.1.2 + + html-encoding-sniffer@3.0.0: + dependencies: + whatwg-encoding: 2.0.0 + + html-escaper@2.0.2: {} + + http-proxy-agent@5.0.0: + dependencies: + '@tootallnate/once': 2.0.0 + agent-base: 6.0.2 + debug: 4.3.7 + transitivePeerDependencies: + - supports-color + + https-proxy-agent@5.0.1: + dependencies: + agent-base: 6.0.2 + debug: 4.3.7 + transitivePeerDependencies: + - supports-color + + human-signals@2.1.0: {} + + iconv-lite@0.6.3: + dependencies: + safer-buffer: 2.1.2 + + ieee754@1.2.1: {} + + ignore@4.0.6: {} + + ignore@5.3.2: {} + + immediate@3.0.6: {} + + immutable@4.3.7: {} + + import-fresh@3.3.0: + dependencies: + parent-module: 1.0.1 + resolve-from: 4.0.0 + + import-local@3.2.0: + dependencies: + pkg-dir: 4.2.0 + resolve-cwd: 3.0.0 + + imurmurhash@0.1.4: {} + + indent-string@4.0.0: {} + + inflight@1.0.6: + dependencies: + once: 1.4.0 + wrappy: 1.0.2 + + inherits@2.0.4: {} + + internal-slot@1.0.7: + dependencies: + es-errors: 1.3.0 + hasown: 2.0.2 + side-channel: 1.0.6 + + is-arguments@1.1.1: + dependencies: + call-bind: 1.0.7 + has-tostringtag: 1.0.2 + + is-array-buffer@3.0.4: + dependencies: + call-bind: 1.0.7 + get-intrinsic: 1.2.4 + + is-arrayish@0.2.1: {} + + is-async-function@2.0.0: + dependencies: + has-tostringtag: 1.0.2 + + is-bigint@1.0.4: + dependencies: + has-bigints: 1.0.2 + + is-boolean-object@1.1.2: + dependencies: + call-bind: 1.0.7 + has-tostringtag: 1.0.2 + + is-bun-module@1.2.1: + dependencies: + semver: 7.6.3 + + is-callable@1.2.7: {} + + is-core-module@2.15.1: + dependencies: + hasown: 2.0.2 + + is-data-view@1.0.1: + dependencies: + is-typed-array: 1.1.13 + + is-date-object@1.0.5: + dependencies: + has-tostringtag: 1.0.2 + + is-extglob@2.1.1: {} + + is-finalizationregistry@1.0.2: + dependencies: + call-bind: 1.0.7 + + is-fullwidth-code-point@3.0.0: {} + + is-generator-fn@2.1.0: {} + + is-generator-function@1.0.10: + dependencies: + has-tostringtag: 1.0.2 + + is-glob@4.0.3: + dependencies: + is-extglob: 2.1.1 + + is-map@2.0.3: {} + + is-negative-zero@2.0.3: {} + + is-number-object@1.0.7: + dependencies: + has-tostringtag: 1.0.2 + + is-number@7.0.0: {} + + is-potential-custom-element-name@1.0.1: {} + + is-regex@1.1.4: + dependencies: + call-bind: 1.0.7 + has-tostringtag: 1.0.2 + + is-set@2.0.3: {} + + is-shared-array-buffer@1.0.3: + dependencies: + call-bind: 1.0.7 + + is-stream@2.0.1: {} + + is-string@1.0.7: + dependencies: + has-tostringtag: 1.0.2 + + is-symbol@1.0.4: + dependencies: + has-symbols: 1.0.3 + + is-typed-array@1.1.13: + dependencies: + which-typed-array: 1.1.15 + + is-weakmap@2.0.2: {} + + is-weakref@1.0.2: + dependencies: + call-bind: 1.0.7 + + is-weakset@2.0.3: + dependencies: + call-bind: 1.0.7 + get-intrinsic: 1.2.4 + + isarray@1.0.0: {} + + isarray@2.0.5: {} + + isexe@2.0.0: {} + + isomorphic.js@0.2.5: {} + + istanbul-lib-coverage@3.2.2: {} + + istanbul-lib-instrument@5.2.1: + dependencies: + '@babel/core': 7.26.0 + '@babel/parser': 7.26.2 + '@istanbuljs/schema': 0.1.3 + istanbul-lib-coverage: 3.2.2 + semver: 6.3.1 + transitivePeerDependencies: + - supports-color + + istanbul-lib-instrument@6.0.3: + dependencies: + '@babel/core': 7.26.0 + '@babel/parser': 7.26.2 + '@istanbuljs/schema': 0.1.3 + istanbul-lib-coverage: 3.2.2 + semver: 7.6.3 + transitivePeerDependencies: + - supports-color + + istanbul-lib-report@3.0.1: + dependencies: + istanbul-lib-coverage: 3.2.2 + make-dir: 4.0.0 + supports-color: 7.2.0 + + istanbul-lib-source-maps@4.0.1: + dependencies: + debug: 4.3.7 + istanbul-lib-coverage: 3.2.2 + source-map: 0.6.1 + transitivePeerDependencies: + - supports-color + + istanbul-reports@3.1.7: + dependencies: + html-escaper: 2.0.2 + istanbul-lib-report: 3.0.1 + + iterator.prototype@1.1.2: + dependencies: + define-properties: 1.2.1 + get-intrinsic: 1.2.4 + has-symbols: 1.0.3 + reflect.getprototypeof: 1.0.6 + set-function-name: 2.0.2 + + jackspeak@2.3.6: + dependencies: + '@isaacs/cliui': 8.0.2 + optionalDependencies: + '@pkgjs/parseargs': 0.11.0 + + jest-changed-files@29.7.0: + dependencies: + execa: 5.1.1 + jest-util: 29.7.0 + p-limit: 3.1.0 + + jest-circus@29.7.0: + dependencies: + '@jest/environment': 29.7.0 + '@jest/expect': 29.7.0 + '@jest/test-result': 29.7.0 + '@jest/types': 29.6.3 + '@types/node': 20.0.0 + chalk: 4.1.2 + co: 4.6.0 + dedent: 1.5.3 + is-generator-fn: 2.1.0 + jest-each: 29.7.0 + jest-matcher-utils: 29.7.0 + jest-message-util: 29.7.0 + jest-runtime: 29.7.0 + jest-snapshot: 29.7.0 + jest-util: 29.7.0 + p-limit: 3.1.0 + pretty-format: 29.7.0 + pure-rand: 6.1.0 + slash: 3.0.0 + stack-utils: 2.0.6 + transitivePeerDependencies: + - babel-plugin-macros + - supports-color + + jest-cli@29.7.0(@types/node@20.0.0)(ts-node@10.9.2(@types/node@20.0.0)(typescript@5.0.2)): + dependencies: + '@jest/core': 29.7.0(ts-node@10.9.2(@types/node@20.0.0)(typescript@5.0.2)) + '@jest/test-result': 29.7.0 + '@jest/types': 29.6.3 + chalk: 4.1.2 + create-jest: 29.7.0(@types/node@20.0.0)(ts-node@10.9.2(@types/node@20.0.0)(typescript@5.0.2)) + exit: 0.1.2 + import-local: 3.2.0 + jest-config: 29.7.0(@types/node@20.0.0)(ts-node@10.9.2(@types/node@20.0.0)(typescript@5.0.2)) + jest-util: 29.7.0 + jest-validate: 29.7.0 + yargs: 17.7.2 + transitivePeerDependencies: + - '@types/node' + - babel-plugin-macros + - supports-color + - ts-node + + jest-config@29.7.0(@types/node@20.0.0)(ts-node@10.9.2(@types/node@20.0.0)(typescript@5.0.2)): + dependencies: + '@babel/core': 7.26.0 + '@jest/test-sequencer': 29.7.0 + '@jest/types': 29.6.3 + babel-jest: 29.7.0(@babel/core@7.26.0) + chalk: 4.1.2 + ci-info: 3.9.0 + deepmerge: 4.3.1 + glob: 7.2.3 + graceful-fs: 4.2.11 + jest-circus: 29.7.0 + jest-environment-node: 29.7.0 + jest-get-type: 29.6.3 + jest-regex-util: 29.6.3 + jest-resolve: 29.7.0 + jest-runner: 29.7.0 + jest-util: 29.7.0 + jest-validate: 29.7.0 + micromatch: 4.0.8 + parse-json: 5.2.0 + pretty-format: 29.7.0 + slash: 3.0.0 + strip-json-comments: 3.1.1 + optionalDependencies: + '@types/node': 20.0.0 + ts-node: 10.9.2(@types/node@20.0.0)(typescript@5.0.2) + transitivePeerDependencies: + - babel-plugin-macros + - supports-color + + jest-diff@29.7.0: + dependencies: + chalk: 4.1.2 + diff-sequences: 29.6.3 + jest-get-type: 29.6.3 + pretty-format: 29.7.0 + + jest-docblock@29.7.0: + dependencies: + detect-newline: 3.1.0 + + jest-each@29.7.0: + dependencies: + '@jest/types': 29.6.3 + chalk: 4.1.2 + jest-get-type: 29.6.3 + jest-util: 29.7.0 + pretty-format: 29.7.0 + + jest-environment-jsdom@29.7.0: + dependencies: + '@jest/environment': 29.7.0 + '@jest/fake-timers': 29.7.0 + '@jest/types': 29.6.3 + '@types/jsdom': 20.0.1 + '@types/node': 20.0.0 + jest-mock: 29.7.0 + jest-util: 29.7.0 + jsdom: 20.0.3 + transitivePeerDependencies: + - bufferutil + - supports-color + - utf-8-validate + + jest-environment-node@29.7.0: + dependencies: + '@jest/environment': 29.7.0 + '@jest/fake-timers': 29.7.0 + '@jest/types': 29.6.3 + '@types/node': 20.0.0 + jest-mock: 29.7.0 + jest-util: 29.7.0 + + jest-get-type@29.6.3: {} + + jest-haste-map@29.7.0: + dependencies: + '@jest/types': 29.6.3 + '@types/graceful-fs': 4.1.9 + '@types/node': 20.0.0 + anymatch: 3.1.3 + fb-watchman: 2.0.2 + graceful-fs: 4.2.11 + jest-regex-util: 29.6.3 + jest-util: 29.7.0 + jest-worker: 29.7.0 + micromatch: 4.0.8 + walker: 1.0.8 + optionalDependencies: + fsevents: 2.3.3 + + jest-leak-detector@29.7.0: + dependencies: + jest-get-type: 29.6.3 + pretty-format: 29.7.0 + + jest-matcher-utils@29.7.0: + dependencies: + chalk: 4.1.2 + jest-diff: 29.7.0 + jest-get-type: 29.6.3 + pretty-format: 29.7.0 + + jest-message-util@29.7.0: + dependencies: + '@babel/code-frame': 7.26.2 + '@jest/types': 29.6.3 + '@types/stack-utils': 2.0.3 + chalk: 4.1.2 + graceful-fs: 4.2.11 + micromatch: 4.0.8 + pretty-format: 29.7.0 + slash: 3.0.0 + stack-utils: 2.0.6 + + jest-mock@29.7.0: + dependencies: + '@jest/types': 29.6.3 + '@types/node': 20.0.0 + jest-util: 29.7.0 + + jest-pnp-resolver@1.2.3(jest-resolve@29.7.0): + optionalDependencies: + jest-resolve: 29.7.0 + + jest-regex-util@29.6.3: {} + + jest-resolve-dependencies@29.7.0: + dependencies: + jest-regex-util: 29.6.3 + jest-snapshot: 29.7.0 + transitivePeerDependencies: + - supports-color + + jest-resolve@29.7.0: + dependencies: + chalk: 4.1.2 + graceful-fs: 4.2.11 + jest-haste-map: 29.7.0 + jest-pnp-resolver: 1.2.3(jest-resolve@29.7.0) + jest-util: 29.7.0 + jest-validate: 29.7.0 + resolve: 1.22.8 + resolve.exports: 2.0.2 + slash: 3.0.0 + + jest-runner@29.7.0: + dependencies: + '@jest/console': 29.7.0 + '@jest/environment': 29.7.0 + '@jest/test-result': 29.7.0 + '@jest/transform': 29.7.0 + '@jest/types': 29.6.3 + '@types/node': 20.0.0 + chalk: 4.1.2 + emittery: 0.13.1 + graceful-fs: 4.2.11 + jest-docblock: 29.7.0 + jest-environment-node: 29.7.0 + jest-haste-map: 29.7.0 + jest-leak-detector: 29.7.0 + jest-message-util: 29.7.0 + jest-resolve: 29.7.0 + jest-runtime: 29.7.0 + jest-util: 29.7.0 + jest-watcher: 29.7.0 + jest-worker: 29.7.0 + p-limit: 3.1.0 + source-map-support: 0.5.13 + transitivePeerDependencies: + - supports-color + + jest-runtime@29.7.0: + dependencies: + '@jest/environment': 29.7.0 + '@jest/fake-timers': 29.7.0 + '@jest/globals': 29.7.0 + '@jest/source-map': 29.6.3 + '@jest/test-result': 29.7.0 + '@jest/transform': 29.7.0 + '@jest/types': 29.6.3 + '@types/node': 20.0.0 + chalk: 4.1.2 + cjs-module-lexer: 1.4.1 + collect-v8-coverage: 1.0.2 + glob: 7.2.3 + graceful-fs: 4.2.11 + jest-haste-map: 29.7.0 + jest-message-util: 29.7.0 + jest-mock: 29.7.0 + jest-regex-util: 29.6.3 + jest-resolve: 29.7.0 + jest-snapshot: 29.7.0 + jest-util: 29.7.0 + slash: 3.0.0 + strip-bom: 4.0.0 + transitivePeerDependencies: + - supports-color + + jest-snapshot@29.7.0: + dependencies: + '@babel/core': 7.26.0 + '@babel/generator': 7.26.2 + '@babel/plugin-syntax-jsx': 7.25.9(@babel/core@7.26.0) + '@babel/plugin-syntax-typescript': 7.25.9(@babel/core@7.26.0) + '@babel/types': 7.26.0 + '@jest/expect-utils': 29.7.0 + '@jest/transform': 29.7.0 + '@jest/types': 29.6.3 + babel-preset-current-node-syntax: 1.1.0(@babel/core@7.26.0) + chalk: 4.1.2 + expect: 29.7.0 + graceful-fs: 4.2.11 + jest-diff: 29.7.0 + jest-get-type: 29.6.3 + jest-matcher-utils: 29.7.0 + jest-message-util: 29.7.0 + jest-util: 29.7.0 + natural-compare: 1.4.0 + pretty-format: 29.7.0 + semver: 7.6.3 + transitivePeerDependencies: + - supports-color + + jest-util@29.7.0: + dependencies: + '@jest/types': 29.6.3 + '@types/node': 20.0.0 + chalk: 4.1.2 + ci-info: 3.9.0 + graceful-fs: 4.2.11 + picomatch: 2.3.1 + + jest-validate@29.7.0: + dependencies: + '@jest/types': 29.6.3 + camelcase: 6.3.0 + chalk: 4.1.2 + jest-get-type: 29.6.3 + leven: 3.1.0 + pretty-format: 29.7.0 + + jest-watcher@29.7.0: + dependencies: + '@jest/test-result': 29.7.0 + '@jest/types': 29.6.3 + '@types/node': 20.0.0 + ansi-escapes: 4.3.2 + chalk: 4.1.2 + emittery: 0.13.1 + jest-util: 29.7.0 + string-length: 4.0.2 + + jest-worker@29.7.0: + dependencies: + '@types/node': 20.0.0 + jest-util: 29.7.0 + merge-stream: 2.0.0 + supports-color: 8.1.1 + + jest@29.7.0(@types/node@20.0.0)(ts-node@10.9.2(@types/node@20.0.0)(typescript@5.0.2)): + dependencies: + '@jest/core': 29.7.0(ts-node@10.9.2(@types/node@20.0.0)(typescript@5.0.2)) + '@jest/types': 29.6.3 + import-local: 3.2.0 + jest-cli: 29.7.0(@types/node@20.0.0)(ts-node@10.9.2(@types/node@20.0.0)(typescript@5.0.2)) + transitivePeerDependencies: + - '@types/node' + - babel-plugin-macros + - supports-color + - ts-node + + js-tokens@4.0.0: {} + + js-yaml@3.14.1: + dependencies: + argparse: 1.0.10 + esprima: 4.0.1 + + js-yaml@4.1.0: + dependencies: + argparse: 2.0.1 + + jsdom@20.0.3: + dependencies: + abab: 2.0.6 + acorn: 8.12.1 + acorn-globals: 7.0.1 + cssom: 0.5.0 + cssstyle: 2.3.0 + data-urls: 3.0.2 + decimal.js: 10.4.3 + domexception: 4.0.0 + escodegen: 2.1.0 + form-data: 4.0.1 + html-encoding-sniffer: 3.0.0 + http-proxy-agent: 5.0.0 + https-proxy-agent: 5.0.1 + is-potential-custom-element-name: 1.0.1 + nwsapi: 2.2.13 + parse5: 7.2.1 + saxes: 6.0.0 + symbol-tree: 3.2.4 + tough-cookie: 4.1.4 + w3c-xmlserializer: 4.0.0 + webidl-conversions: 7.0.0 + whatwg-encoding: 2.0.0 + whatwg-mimetype: 3.0.0 + whatwg-url: 11.0.0 + ws: 8.18.0 + xml-name-validator: 4.0.0 + transitivePeerDependencies: + - bufferutil + - supports-color + - utf-8-validate + + jsesc@3.0.2: {} + + json-buffer@3.0.1: {} + + json-parse-even-better-errors@2.3.1: {} + + json-schema-traverse@0.4.1: {} + + json-stable-stringify-without-jsonify@1.0.1: {} + + json2mq@0.2.0: + dependencies: + string-convert: 0.2.1 + + json5@1.0.2: + dependencies: + minimist: 1.2.8 + + json5@2.2.3: {} + + jsx-ast-utils@3.3.5: + dependencies: + array-includes: 3.1.8 + array.prototype.flat: 1.3.2 + object.assign: 4.1.5 + object.values: 1.2.0 + + jszip@3.10.1: + dependencies: + lie: 3.3.0 + pako: 1.0.11 + readable-stream: 2.3.8 + setimmediate: 1.0.5 + + jwt-decode@4.0.0: {} + + keyv@4.5.4: + dependencies: + json-buffer: 3.0.1 + + kleur@3.0.3: {} + + language-subtag-registry@0.3.23: {} + + language-tags@1.0.9: + dependencies: + language-subtag-registry: 0.3.23 + + leven@3.1.0: {} + + levn@0.4.1: + dependencies: + prelude-ls: 1.2.1 + type-check: 0.4.0 + + lib0@0.2.98: + dependencies: + isomorphic.js: 0.2.5 + + lie@3.3.0: + dependencies: + immediate: 3.0.6 + + lines-and-columns@1.2.4: {} + + locate-path@5.0.0: + dependencies: + p-locate: 4.1.0 + + lodash.merge@4.6.2: {} + + lodash@4.17.21: {} + + loose-envify@1.4.0: + dependencies: + js-tokens: 4.0.0 + + lru-cache@10.4.3: {} + + lru-cache@5.1.1: + dependencies: + yallist: 3.1.1 + + lz-string@1.5.0: {} + + make-dir@4.0.0: + dependencies: + semver: 7.6.3 + + make-error@1.3.6: {} + + makeerror@1.0.12: + dependencies: + tmpl: 1.0.5 + + merge-stream@2.0.0: {} + + merge2@1.4.1: {} + + micromatch@4.0.8: + dependencies: + braces: 3.0.3 + picomatch: 2.3.1 + + mime-db@1.52.0: {} + + mime-types@2.1.35: + dependencies: + mime-db: 1.52.0 + + mimic-fn@2.1.0: {} + + min-indent@1.0.1: {} + + minimatch@3.1.2: + dependencies: + brace-expansion: 1.1.11 + + minimatch@9.0.5: + dependencies: + brace-expansion: 2.0.1 + + minimist@1.2.8: {} + + minipass@7.1.2: {} + + ms@2.1.3: {} + + nanoid@3.3.7: {} + + natural-compare@1.4.0: {} + + next@14.2.13(@babel/core@7.26.0)(react-dom@18.2.0(react@18.2.0))(react@18.2.0)(sass@1.79.2): + dependencies: + '@next/env': 14.2.13 + '@swc/helpers': 0.5.5 + busboy: 1.6.0 + caniuse-lite: 1.0.30001666 + graceful-fs: 4.2.11 + postcss: 8.4.31 + react: 18.2.0 + react-dom: 18.2.0(react@18.2.0) + styled-jsx: 5.1.1(@babel/core@7.26.0)(react@18.2.0) + optionalDependencies: + '@next/swc-darwin-arm64': 14.2.13 + '@next/swc-darwin-x64': 14.2.13 + '@next/swc-linux-arm64-gnu': 14.2.13 + '@next/swc-linux-arm64-musl': 14.2.13 + '@next/swc-linux-x64-gnu': 14.2.13 + '@next/swc-linux-x64-musl': 14.2.13 + '@next/swc-win32-arm64-msvc': 14.2.13 + '@next/swc-win32-ia32-msvc': 14.2.13 + '@next/swc-win32-x64-msvc': 14.2.13 + sass: 1.79.2 + transitivePeerDependencies: + - '@babel/core' + - babel-plugin-macros + + node-int64@0.4.0: {} + + node-releases@2.0.18: {} + + normalize-path@3.0.0: {} + + npm-run-path@4.0.1: + dependencies: + path-key: 3.1.1 + + nwsapi@2.2.13: {} + + object-assign@4.1.1: {} + + object-inspect@1.13.2: {} + + object-is@1.1.6: + dependencies: + call-bind: 1.0.7 + define-properties: 1.2.1 + + object-keys@1.1.1: {} + + object.assign@4.1.5: + dependencies: + call-bind: 1.0.7 + define-properties: 1.2.1 + has-symbols: 1.0.3 + object-keys: 1.1.1 + + object.entries@1.1.8: + dependencies: + call-bind: 1.0.7 + define-properties: 1.2.1 + es-object-atoms: 1.0.0 + + object.fromentries@2.0.8: + dependencies: + call-bind: 1.0.7 + define-properties: 1.2.1 + es-abstract: 1.23.3 + es-object-atoms: 1.0.0 + + object.groupby@1.0.3: + dependencies: + call-bind: 1.0.7 + define-properties: 1.2.1 + es-abstract: 1.23.3 + + object.values@1.2.0: + dependencies: + call-bind: 1.0.7 + define-properties: 1.2.1 + es-object-atoms: 1.0.0 + + once@1.4.0: + dependencies: + wrappy: 1.0.2 + + onetime@5.1.2: + dependencies: + mimic-fn: 2.1.0 + + optionator@0.9.4: + dependencies: + deep-is: 0.1.4 + fast-levenshtein: 2.0.6 + levn: 0.4.1 + prelude-ls: 1.2.1 + type-check: 0.4.0 + word-wrap: 1.2.5 + + p-limit@2.3.0: + dependencies: + p-try: 2.2.0 + + p-limit@3.1.0: + dependencies: + yocto-queue: 0.1.0 + + p-locate@4.1.0: + dependencies: + p-limit: 2.3.0 + + p-try@2.2.0: {} + + pako@1.0.11: {} + + parent-module@1.0.1: + dependencies: + callsites: 3.1.0 + + parse-json@5.2.0: + dependencies: + '@babel/code-frame': 7.26.2 + error-ex: 1.3.2 + json-parse-even-better-errors: 2.3.1 + lines-and-columns: 1.2.4 + + parse5@7.2.1: + dependencies: + entities: 4.5.0 + + path-exists@4.0.0: {} + + path-is-absolute@1.0.1: {} + + path-key@3.1.1: {} + + path-parse@1.0.7: {} + + path-scurry@1.11.1: + dependencies: + lru-cache: 10.4.3 + minipass: 7.1.2 + + peerjs-js-binarypack@2.1.0: {} + + peerjs@1.5.4: + dependencies: + '@msgpack/msgpack': 2.8.0 + eventemitter3: 4.0.7 + peerjs-js-binarypack: 2.1.0 + webrtc-adapter: 9.0.1 + + picocolors@1.1.0: {} + + picomatch@2.3.1: {} + + pirates@4.0.6: {} + + pkg-dir@4.2.0: + dependencies: + find-up: 4.1.0 + + possible-typed-array-names@1.0.0: {} + + postcss@8.4.31: + dependencies: + nanoid: 3.3.7 + picocolors: 1.1.0 + source-map-js: 1.2.1 + + prelude-ls@1.2.1: {} + + pretty-format@27.5.1: + dependencies: + ansi-regex: 5.0.1 + ansi-styles: 5.2.0 + react-is: 17.0.2 + + pretty-format@29.7.0: + dependencies: + '@jest/schemas': 29.6.3 + ansi-styles: 5.2.0 + react-is: 18.3.1 + + process-nextick-args@2.0.1: {} + + progress@2.0.3: {} + + prompts@2.4.2: + dependencies: + kleur: 3.0.3 + sisteransi: 1.0.5 + + prop-types@15.8.1: + dependencies: + loose-envify: 1.4.0 + object-assign: 4.1.1 + react-is: 16.13.1 + + psl@1.9.0: {} + + punycode@2.3.1: {} + + pure-rand@6.1.0: {} + + querystringify@2.2.0: {} + + queue-microtask@1.2.3: {} + + randombytes@2.1.0: + dependencies: + safe-buffer: 5.2.1 + + rc-cascader@3.28.1(react-dom@18.2.0(react@18.2.0))(react@18.2.0): + dependencies: + '@babel/runtime': 7.25.7 + array-tree-filter: 2.1.0 + classnames: 2.5.1 + rc-select: 14.15.2(react-dom@18.2.0(react@18.2.0))(react@18.2.0) + rc-tree: 5.9.0(react-dom@18.2.0(react@18.2.0))(react@18.2.0) + rc-util: 5.43.0(react-dom@18.2.0(react@18.2.0))(react@18.2.0) + react: 18.2.0 + react-dom: 18.2.0(react@18.2.0) + + rc-checkbox@3.3.0(react-dom@18.2.0(react@18.2.0))(react@18.2.0): + dependencies: + '@babel/runtime': 7.25.7 + classnames: 2.5.1 + rc-util: 5.43.0(react-dom@18.2.0(react@18.2.0))(react@18.2.0) + react: 18.2.0 + react-dom: 18.2.0(react@18.2.0) + + rc-collapse@3.7.3(react-dom@18.2.0(react@18.2.0))(react@18.2.0): + dependencies: + '@babel/runtime': 7.25.7 + classnames: 2.5.1 + rc-motion: 2.9.3(react-dom@18.2.0(react@18.2.0))(react@18.2.0) + rc-util: 5.43.0(react-dom@18.2.0(react@18.2.0))(react@18.2.0) + react: 18.2.0 + react-dom: 18.2.0(react@18.2.0) + + rc-dialog@9.5.2(react-dom@18.2.0(react@18.2.0))(react@18.2.0): + dependencies: + '@babel/runtime': 7.25.7 + '@rc-component/portal': 1.1.2(react-dom@18.2.0(react@18.2.0))(react@18.2.0) + classnames: 2.5.1 + rc-motion: 2.9.3(react-dom@18.2.0(react@18.2.0))(react@18.2.0) + rc-util: 5.43.0(react-dom@18.2.0(react@18.2.0))(react@18.2.0) + react: 18.2.0 + react-dom: 18.2.0(react@18.2.0) + + rc-drawer@7.2.0(react-dom@18.2.0(react@18.2.0))(react@18.2.0): + dependencies: + '@babel/runtime': 7.25.7 + '@rc-component/portal': 1.1.2(react-dom@18.2.0(react@18.2.0))(react@18.2.0) + classnames: 2.5.1 + rc-motion: 2.9.3(react-dom@18.2.0(react@18.2.0))(react@18.2.0) + rc-util: 5.43.0(react-dom@18.2.0(react@18.2.0))(react@18.2.0) + react: 18.2.0 + react-dom: 18.2.0(react@18.2.0) + + rc-dropdown@4.2.0(react-dom@18.2.0(react@18.2.0))(react@18.2.0): + dependencies: + '@babel/runtime': 7.25.7 + '@rc-component/trigger': 2.2.3(react-dom@18.2.0(react@18.2.0))(react@18.2.0) + classnames: 2.5.1 + rc-util: 5.43.0(react-dom@18.2.0(react@18.2.0))(react@18.2.0) + react: 18.2.0 + react-dom: 18.2.0(react@18.2.0) + + rc-field-form@2.4.0(react-dom@18.2.0(react@18.2.0))(react@18.2.0): + dependencies: + '@babel/runtime': 7.25.7 + '@rc-component/async-validator': 5.0.4 + rc-util: 5.43.0(react-dom@18.2.0(react@18.2.0))(react@18.2.0) + react: 18.2.0 + react-dom: 18.2.0(react@18.2.0) + + rc-image@7.9.0(react-dom@18.2.0(react@18.2.0))(react@18.2.0): + dependencies: + '@babel/runtime': 7.25.7 + '@rc-component/portal': 1.1.2(react-dom@18.2.0(react@18.2.0))(react@18.2.0) + classnames: 2.5.1 + rc-dialog: 9.5.2(react-dom@18.2.0(react@18.2.0))(react@18.2.0) + rc-motion: 2.9.3(react-dom@18.2.0(react@18.2.0))(react@18.2.0) + rc-util: 5.43.0(react-dom@18.2.0(react@18.2.0))(react@18.2.0) + react: 18.2.0 + react-dom: 18.2.0(react@18.2.0) + + rc-input-number@9.2.0(react-dom@18.2.0(react@18.2.0))(react@18.2.0): + dependencies: + '@babel/runtime': 7.25.7 + '@rc-component/mini-decimal': 1.1.0 + classnames: 2.5.1 + rc-input: 1.6.3(react-dom@18.2.0(react@18.2.0))(react@18.2.0) + rc-util: 5.43.0(react-dom@18.2.0(react@18.2.0))(react@18.2.0) + react: 18.2.0 + react-dom: 18.2.0(react@18.2.0) + + rc-input@1.6.3(react-dom@18.2.0(react@18.2.0))(react@18.2.0): + dependencies: + '@babel/runtime': 7.25.7 + classnames: 2.5.1 + rc-util: 5.43.0(react-dom@18.2.0(react@18.2.0))(react@18.2.0) + react: 18.2.0 + react-dom: 18.2.0(react@18.2.0) + + rc-mentions@2.15.0(react-dom@18.2.0(react@18.2.0))(react@18.2.0): + dependencies: + '@babel/runtime': 7.25.7 + '@rc-component/trigger': 2.2.3(react-dom@18.2.0(react@18.2.0))(react@18.2.0) + classnames: 2.5.1 + rc-input: 1.6.3(react-dom@18.2.0(react@18.2.0))(react@18.2.0) + rc-menu: 9.14.1(react-dom@18.2.0(react@18.2.0))(react@18.2.0) + rc-textarea: 1.8.2(react-dom@18.2.0(react@18.2.0))(react@18.2.0) + rc-util: 5.43.0(react-dom@18.2.0(react@18.2.0))(react@18.2.0) + react: 18.2.0 + react-dom: 18.2.0(react@18.2.0) + + rc-menu@9.14.1(react-dom@18.2.0(react@18.2.0))(react@18.2.0): + dependencies: + '@babel/runtime': 7.25.7 + '@rc-component/trigger': 2.2.3(react-dom@18.2.0(react@18.2.0))(react@18.2.0) + classnames: 2.5.1 + rc-motion: 2.9.3(react-dom@18.2.0(react@18.2.0))(react@18.2.0) + rc-overflow: 1.3.2(react-dom@18.2.0(react@18.2.0))(react@18.2.0) + rc-util: 5.43.0(react-dom@18.2.0(react@18.2.0))(react@18.2.0) + react: 18.2.0 + react-dom: 18.2.0(react@18.2.0) + + rc-motion@2.9.3(react-dom@18.2.0(react@18.2.0))(react@18.2.0): + dependencies: + '@babel/runtime': 7.25.7 + classnames: 2.5.1 + rc-util: 5.43.0(react-dom@18.2.0(react@18.2.0))(react@18.2.0) + react: 18.2.0 + react-dom: 18.2.0(react@18.2.0) + + rc-notification@5.6.2(react-dom@18.2.0(react@18.2.0))(react@18.2.0): + dependencies: + '@babel/runtime': 7.25.7 + classnames: 2.5.1 + rc-motion: 2.9.3(react-dom@18.2.0(react@18.2.0))(react@18.2.0) + rc-util: 5.43.0(react-dom@18.2.0(react@18.2.0))(react@18.2.0) + react: 18.2.0 + react-dom: 18.2.0(react@18.2.0) + + rc-overflow@1.3.2(react-dom@18.2.0(react@18.2.0))(react@18.2.0): + dependencies: + '@babel/runtime': 7.25.7 + classnames: 2.5.1 + rc-resize-observer: 1.4.0(react-dom@18.2.0(react@18.2.0))(react@18.2.0) + rc-util: 5.43.0(react-dom@18.2.0(react@18.2.0))(react@18.2.0) + react: 18.2.0 + react-dom: 18.2.0(react@18.2.0) + + rc-pagination@4.2.0(react-dom@18.2.0(react@18.2.0))(react@18.2.0): + dependencies: + '@babel/runtime': 7.25.7 + classnames: 2.5.1 + rc-util: 5.43.0(react-dom@18.2.0(react@18.2.0))(react@18.2.0) + react: 18.2.0 + react-dom: 18.2.0(react@18.2.0) + + rc-picker@4.6.15(dayjs@1.11.13)(react-dom@18.2.0(react@18.2.0))(react@18.2.0): + dependencies: + '@babel/runtime': 7.25.7 + '@rc-component/trigger': 2.2.3(react-dom@18.2.0(react@18.2.0))(react@18.2.0) + classnames: 2.5.1 + rc-overflow: 1.3.2(react-dom@18.2.0(react@18.2.0))(react@18.2.0) + rc-resize-observer: 1.4.0(react-dom@18.2.0(react@18.2.0))(react@18.2.0) + rc-util: 5.43.0(react-dom@18.2.0(react@18.2.0))(react@18.2.0) + react: 18.2.0 + react-dom: 18.2.0(react@18.2.0) + optionalDependencies: + dayjs: 1.11.13 + + rc-progress@4.0.0(react-dom@18.2.0(react@18.2.0))(react@18.2.0): + dependencies: + '@babel/runtime': 7.25.7 + classnames: 2.5.1 + rc-util: 5.43.0(react-dom@18.2.0(react@18.2.0))(react@18.2.0) + react: 18.2.0 + react-dom: 18.2.0(react@18.2.0) + + rc-rate@2.13.0(react-dom@18.2.0(react@18.2.0))(react@18.2.0): + dependencies: + '@babel/runtime': 7.25.7 + classnames: 2.5.1 + rc-util: 5.43.0(react-dom@18.2.0(react@18.2.0))(react@18.2.0) + react: 18.2.0 + react-dom: 18.2.0(react@18.2.0) + + rc-resize-observer@1.4.0(react-dom@18.2.0(react@18.2.0))(react@18.2.0): + dependencies: + '@babel/runtime': 7.25.7 + classnames: 2.5.1 + rc-util: 5.43.0(react-dom@18.2.0(react@18.2.0))(react@18.2.0) + react: 18.2.0 + react-dom: 18.2.0(react@18.2.0) + resize-observer-polyfill: 1.5.1 + + rc-segmented@2.3.0(react-dom@18.2.0(react@18.2.0))(react@18.2.0): + dependencies: + '@babel/runtime': 7.25.7 + classnames: 2.5.1 + rc-motion: 2.9.3(react-dom@18.2.0(react@18.2.0))(react@18.2.0) + rc-util: 5.43.0(react-dom@18.2.0(react@18.2.0))(react@18.2.0) + react: 18.2.0 + react-dom: 18.2.0(react@18.2.0) + + rc-select@14.15.2(react-dom@18.2.0(react@18.2.0))(react@18.2.0): + dependencies: + '@babel/runtime': 7.25.7 + '@rc-component/trigger': 2.2.3(react-dom@18.2.0(react@18.2.0))(react@18.2.0) + classnames: 2.5.1 + rc-motion: 2.9.3(react-dom@18.2.0(react@18.2.0))(react@18.2.0) + rc-overflow: 1.3.2(react-dom@18.2.0(react@18.2.0))(react@18.2.0) + rc-util: 5.43.0(react-dom@18.2.0(react@18.2.0))(react@18.2.0) + rc-virtual-list: 3.14.8(react-dom@18.2.0(react@18.2.0))(react@18.2.0) + react: 18.2.0 + react-dom: 18.2.0(react@18.2.0) + + rc-slider@11.1.6(react-dom@18.2.0(react@18.2.0))(react@18.2.0): + dependencies: + '@babel/runtime': 7.25.7 + classnames: 2.5.1 + rc-util: 5.43.0(react-dom@18.2.0(react@18.2.0))(react@18.2.0) + react: 18.2.0 + react-dom: 18.2.0(react@18.2.0) + + rc-steps@6.0.1(react-dom@18.2.0(react@18.2.0))(react@18.2.0): + dependencies: + '@babel/runtime': 7.25.7 + classnames: 2.5.1 + rc-util: 5.43.0(react-dom@18.2.0(react@18.2.0))(react@18.2.0) + react: 18.2.0 + react-dom: 18.2.0(react@18.2.0) + + rc-switch@4.1.0(react-dom@18.2.0(react@18.2.0))(react@18.2.0): + dependencies: + '@babel/runtime': 7.25.7 + classnames: 2.5.1 + rc-util: 5.43.0(react-dom@18.2.0(react@18.2.0))(react@18.2.0) + react: 18.2.0 + react-dom: 18.2.0(react@18.2.0) + + rc-table@7.45.7(react-dom@18.2.0(react@18.2.0))(react@18.2.0): + dependencies: + '@babel/runtime': 7.25.7 + '@rc-component/context': 1.4.0(react-dom@18.2.0(react@18.2.0))(react@18.2.0) + classnames: 2.5.1 + rc-resize-observer: 1.4.0(react-dom@18.2.0(react@18.2.0))(react@18.2.0) + rc-util: 5.43.0(react-dom@18.2.0(react@18.2.0))(react@18.2.0) + rc-virtual-list: 3.14.8(react-dom@18.2.0(react@18.2.0))(react@18.2.0) + react: 18.2.0 + react-dom: 18.2.0(react@18.2.0) + + rc-tabs@15.1.1(react-dom@18.2.0(react@18.2.0))(react@18.2.0): + dependencies: + '@babel/runtime': 7.25.7 + classnames: 2.5.1 + rc-dropdown: 4.2.0(react-dom@18.2.0(react@18.2.0))(react@18.2.0) + rc-menu: 9.14.1(react-dom@18.2.0(react@18.2.0))(react@18.2.0) + rc-motion: 2.9.3(react-dom@18.2.0(react@18.2.0))(react@18.2.0) + rc-resize-observer: 1.4.0(react-dom@18.2.0(react@18.2.0))(react@18.2.0) + rc-util: 5.43.0(react-dom@18.2.0(react@18.2.0))(react@18.2.0) + react: 18.2.0 + react-dom: 18.2.0(react@18.2.0) + + rc-textarea@1.8.2(react-dom@18.2.0(react@18.2.0))(react@18.2.0): + dependencies: + '@babel/runtime': 7.25.7 + classnames: 2.5.1 + rc-input: 1.6.3(react-dom@18.2.0(react@18.2.0))(react@18.2.0) + rc-resize-observer: 1.4.0(react-dom@18.2.0(react@18.2.0))(react@18.2.0) + rc-util: 5.43.0(react-dom@18.2.0(react@18.2.0))(react@18.2.0) + react: 18.2.0 + react-dom: 18.2.0(react@18.2.0) + + rc-tooltip@6.2.1(react-dom@18.2.0(react@18.2.0))(react@18.2.0): + dependencies: + '@babel/runtime': 7.25.7 + '@rc-component/trigger': 2.2.3(react-dom@18.2.0(react@18.2.0))(react@18.2.0) + classnames: 2.5.1 + react: 18.2.0 + react-dom: 18.2.0(react@18.2.0) + + rc-tree-select@5.23.0(react-dom@18.2.0(react@18.2.0))(react@18.2.0): + dependencies: + '@babel/runtime': 7.25.7 + classnames: 2.5.1 + rc-select: 14.15.2(react-dom@18.2.0(react@18.2.0))(react@18.2.0) + rc-tree: 5.9.0(react-dom@18.2.0(react@18.2.0))(react@18.2.0) + rc-util: 5.43.0(react-dom@18.2.0(react@18.2.0))(react@18.2.0) + react: 18.2.0 + react-dom: 18.2.0(react@18.2.0) + + rc-tree@5.9.0(react-dom@18.2.0(react@18.2.0))(react@18.2.0): + dependencies: + '@babel/runtime': 7.25.7 + classnames: 2.5.1 + rc-motion: 2.9.3(react-dom@18.2.0(react@18.2.0))(react@18.2.0) + rc-util: 5.43.0(react-dom@18.2.0(react@18.2.0))(react@18.2.0) + rc-virtual-list: 3.14.8(react-dom@18.2.0(react@18.2.0))(react@18.2.0) + react: 18.2.0 + react-dom: 18.2.0(react@18.2.0) + + rc-upload@4.7.0(react-dom@18.2.0(react@18.2.0))(react@18.2.0): + dependencies: + '@babel/runtime': 7.25.7 + classnames: 2.5.1 + rc-util: 5.43.0(react-dom@18.2.0(react@18.2.0))(react@18.2.0) + react: 18.2.0 + react-dom: 18.2.0(react@18.2.0) + + rc-util@5.43.0(react-dom@18.2.0(react@18.2.0))(react@18.2.0): + dependencies: + '@babel/runtime': 7.25.7 + react: 18.2.0 + react-dom: 18.2.0(react@18.2.0) + react-is: 18.3.1 + + rc-virtual-list@3.14.8(react-dom@18.2.0(react@18.2.0))(react@18.2.0): + dependencies: + '@babel/runtime': 7.25.7 + classnames: 2.5.1 + rc-resize-observer: 1.4.0(react-dom@18.2.0(react@18.2.0))(react@18.2.0) + rc-util: 5.43.0(react-dom@18.2.0(react@18.2.0))(react@18.2.0) + react: 18.2.0 + react-dom: 18.2.0(react@18.2.0) + + react-dom@18.2.0(react@18.2.0): + dependencies: + loose-envify: 1.4.0 + react: 18.2.0 + scheduler: 0.23.2 + + react-is@16.13.1: {} + + react-is@17.0.2: {} + + react-is@18.3.1: {} + + react-timer-hook@3.0.7(react@18.2.0): + dependencies: + react: 18.2.0 + + react-use-websocket@4.9.0: {} + + react@18.2.0: + dependencies: + loose-envify: 1.4.0 + + readable-stream@2.3.8: + dependencies: + core-util-is: 1.0.3 + inherits: 2.0.4 + isarray: 1.0.0 + process-nextick-args: 2.0.1 + safe-buffer: 5.1.2 + string_decoder: 1.1.1 + util-deprecate: 1.0.2 + + readable-stream@3.6.2: + dependencies: + inherits: 2.0.4 + string_decoder: 1.3.0 + util-deprecate: 1.0.2 + + readdirp@4.0.1: {} + + redent@3.0.0: + dependencies: + indent-string: 4.0.0 + strip-indent: 3.0.0 + + reflect.getprototypeof@1.0.6: + dependencies: + call-bind: 1.0.7 + define-properties: 1.2.1 + es-abstract: 1.23.3 + es-errors: 1.3.0 + get-intrinsic: 1.2.4 + globalthis: 1.0.4 + which-builtin-type: 1.1.4 + + regenerator-runtime@0.14.1: {} + + regexp.prototype.flags@1.5.3: + dependencies: + call-bind: 1.0.7 + define-properties: 1.2.1 + es-errors: 1.3.0 + set-function-name: 2.0.2 + + regexpp@3.2.0: {} + + require-directory@2.1.1: {} + + requires-port@1.0.0: {} + + resize-observer-polyfill@1.5.1: {} + + resolve-cwd@3.0.0: + dependencies: + resolve-from: 5.0.0 + + resolve-from@4.0.0: {} + + resolve-from@5.0.0: {} + + resolve-pkg-maps@1.0.0: {} + + resolve.exports@2.0.2: {} + + resolve@1.22.8: + dependencies: + is-core-module: 2.15.1 + path-parse: 1.0.7 + supports-preserve-symlinks-flag: 1.0.0 + + resolve@2.0.0-next.5: + dependencies: + is-core-module: 2.15.1 + path-parse: 1.0.7 + supports-preserve-symlinks-flag: 1.0.0 + + reusify@1.0.4: {} + + rimraf@3.0.2: + dependencies: + glob: 7.2.3 + + run-parallel@1.2.0: + dependencies: + queue-microtask: 1.2.3 + + safe-array-concat@1.1.2: + dependencies: + call-bind: 1.0.7 + get-intrinsic: 1.2.4 + has-symbols: 1.0.3 + isarray: 2.0.5 + + safe-buffer@5.1.2: {} + + safe-buffer@5.2.1: {} + + safe-regex-test@1.0.3: + dependencies: + call-bind: 1.0.7 + es-errors: 1.3.0 + is-regex: 1.1.4 + + safer-buffer@2.1.2: {} + + sass@1.79.2: + dependencies: + chokidar: 4.0.1 + immutable: 4.3.7 + source-map-js: 1.2.1 + + saxes@6.0.0: + dependencies: + xmlchars: 2.2.0 + + scheduler@0.23.2: + dependencies: + loose-envify: 1.4.0 + + scroll-into-view-if-needed@3.1.0: + dependencies: + compute-scroll-into-view: 3.1.0 + + sdp@3.2.0: {} + + selenium-webdriver@4.26.0: + dependencies: + '@bazel/runfiles': 6.3.1 + jszip: 3.10.1 + tmp: 0.2.3 + ws: 8.18.0 + transitivePeerDependencies: + - bufferutil + - utf-8-validate + + semver@6.3.1: {} + + semver@7.6.3: {} + + set-function-length@1.2.2: + dependencies: + define-data-property: 1.1.4 + es-errors: 1.3.0 + function-bind: 1.1.2 + get-intrinsic: 1.2.4 + gopd: 1.0.1 + has-property-descriptors: 1.0.2 + + set-function-name@2.0.2: + dependencies: + define-data-property: 1.1.4 + es-errors: 1.3.0 + functions-have-names: 1.2.3 + has-property-descriptors: 1.0.2 + + setimmediate@1.0.5: {} + + shebang-command@2.0.0: + dependencies: + shebang-regex: 3.0.0 + + shebang-regex@3.0.0: {} + + side-channel@1.0.6: + dependencies: + call-bind: 1.0.7 + es-errors: 1.3.0 + get-intrinsic: 1.2.4 + object-inspect: 1.13.2 + + signal-exit@3.0.7: {} + + signal-exit@4.1.0: {} + + simple-peer@9.11.1: + dependencies: + buffer: 6.0.3 + debug: 4.3.7 + err-code: 3.0.1 + get-browser-rtc: 1.1.0 + queue-microtask: 1.2.3 + randombytes: 2.1.0 + readable-stream: 3.6.2 + transitivePeerDependencies: + - supports-color + + sisteransi@1.0.5: {} + + slash@3.0.0: {} + + source-map-js@1.2.1: {} + + source-map-support@0.5.13: + dependencies: + buffer-from: 1.1.2 + source-map: 0.6.1 + + source-map@0.6.1: {} + + sprintf-js@1.0.3: {} + + stack-utils@2.0.6: + dependencies: + escape-string-regexp: 2.0.0 + + stop-iteration-iterator@1.0.0: + dependencies: + internal-slot: 1.0.7 + + streamsearch@1.1.0: {} + + string-convert@0.2.1: {} + + string-length@4.0.2: + dependencies: + char-regex: 1.0.2 + strip-ansi: 6.0.1 + + string-width@4.2.3: + dependencies: + emoji-regex: 8.0.0 + is-fullwidth-code-point: 3.0.0 + strip-ansi: 6.0.1 + + string-width@5.1.2: + dependencies: + eastasianwidth: 0.2.0 + emoji-regex: 9.2.2 + strip-ansi: 7.1.0 + + string.prototype.includes@2.0.0: + dependencies: + define-properties: 1.2.1 + es-abstract: 1.23.3 + + string.prototype.matchall@4.0.11: + dependencies: + call-bind: 1.0.7 + define-properties: 1.2.1 + es-abstract: 1.23.3 + es-errors: 1.3.0 + es-object-atoms: 1.0.0 + get-intrinsic: 1.2.4 + gopd: 1.0.1 + has-symbols: 1.0.3 + internal-slot: 1.0.7 + regexp.prototype.flags: 1.5.3 + set-function-name: 2.0.2 + side-channel: 1.0.6 + + string.prototype.repeat@1.0.0: + dependencies: + define-properties: 1.2.1 + es-abstract: 1.23.3 + + string.prototype.trim@1.2.9: + dependencies: + call-bind: 1.0.7 + define-properties: 1.2.1 + es-abstract: 1.23.3 + es-object-atoms: 1.0.0 + + string.prototype.trimend@1.0.8: + dependencies: + call-bind: 1.0.7 + define-properties: 1.2.1 + es-object-atoms: 1.0.0 + + string.prototype.trimstart@1.0.8: + dependencies: + call-bind: 1.0.7 + define-properties: 1.2.1 + es-object-atoms: 1.0.0 + + string_decoder@1.1.1: + dependencies: + safe-buffer: 5.1.2 + + string_decoder@1.3.0: + dependencies: + safe-buffer: 5.2.1 + + strip-ansi@6.0.1: + dependencies: + ansi-regex: 5.0.1 + + strip-ansi@7.1.0: + dependencies: + ansi-regex: 6.1.0 + + strip-bom@3.0.0: {} + + strip-bom@4.0.0: {} + + strip-final-newline@2.0.0: {} + + strip-indent@3.0.0: + dependencies: + min-indent: 1.0.1 + + strip-json-comments@3.1.1: {} + + style-mod@4.1.2: {} + + styled-jsx@5.1.1(@babel/core@7.26.0)(react@18.2.0): + dependencies: + client-only: 0.0.1 + react: 18.2.0 + optionalDependencies: + '@babel/core': 7.26.0 + + stylis@4.3.4: {} + + supports-color@7.2.0: + dependencies: + has-flag: 4.0.0 + + supports-color@8.1.1: + dependencies: + has-flag: 4.0.0 + + supports-preserve-symlinks-flag@1.0.0: {} + + symbol-tree@3.2.4: {} + + tapable@2.2.1: {} + + test-exclude@6.0.0: + dependencies: + '@istanbuljs/schema': 0.1.3 + glob: 7.2.3 + minimatch: 3.1.2 + + text-table@0.2.0: {} + + throttle-debounce@5.0.2: {} + + tmp@0.2.3: {} + + tmpl@1.0.5: {} + + to-regex-range@5.0.1: + dependencies: + is-number: 7.0.0 + + toggle-selection@1.0.6: {} + + tough-cookie@4.1.4: + dependencies: + psl: 1.9.0 + punycode: 2.3.1 + universalify: 0.2.0 + url-parse: 1.5.10 + + tr46@3.0.0: + dependencies: + punycode: 2.3.1 + + ts-api-utils@1.3.0(typescript@5.0.2): + dependencies: + typescript: 5.0.2 + + ts-node@10.9.2(@types/node@20.0.0)(typescript@5.0.2): + dependencies: + '@cspotcode/source-map-support': 0.8.1 + '@tsconfig/node10': 1.0.11 + '@tsconfig/node12': 1.0.11 + '@tsconfig/node14': 1.0.3 + '@tsconfig/node16': 1.0.4 + '@types/node': 20.0.0 + acorn: 8.12.1 + acorn-walk: 8.3.4 + arg: 4.1.3 + create-require: 1.1.1 + diff: 4.0.2 + make-error: 1.3.6 + typescript: 5.0.2 + v8-compile-cache-lib: 3.0.1 + yn: 3.1.1 + + tsconfig-paths@3.15.0: + dependencies: + '@types/json5': 0.0.29 + json5: 1.0.2 + minimist: 1.2.8 + strip-bom: 3.0.0 + + tslib@2.7.0: {} + + type-check@0.4.0: + dependencies: + prelude-ls: 1.2.1 + + type-detect@4.0.8: {} + + type-fest@0.20.2: {} + + type-fest@0.21.3: {} + + typed-array-buffer@1.0.2: + dependencies: + call-bind: 1.0.7 + es-errors: 1.3.0 + is-typed-array: 1.1.13 + + typed-array-byte-length@1.0.1: + dependencies: + call-bind: 1.0.7 + for-each: 0.3.3 + gopd: 1.0.1 + has-proto: 1.0.3 + is-typed-array: 1.1.13 + + typed-array-byte-offset@1.0.2: + dependencies: + available-typed-arrays: 1.0.7 + call-bind: 1.0.7 + for-each: 0.3.3 + gopd: 1.0.1 + has-proto: 1.0.3 + is-typed-array: 1.1.13 + + typed-array-length@1.0.6: + dependencies: + call-bind: 1.0.7 + for-each: 0.3.3 + gopd: 1.0.1 + has-proto: 1.0.3 + is-typed-array: 1.1.13 + possible-typed-array-names: 1.0.0 + + typeface-montserrat@1.1.13: {} + + typescript@5.0.2: {} + + unbox-primitive@1.0.2: + dependencies: + call-bind: 1.0.7 + has-bigints: 1.0.2 + has-symbols: 1.0.3 + which-boxed-primitive: 1.0.2 + + universalify@0.2.0: {} + + update-browserslist-db@1.1.1(browserslist@4.24.2): + dependencies: + browserslist: 4.24.2 + escalade: 3.2.0 + picocolors: 1.1.0 + + uri-js@4.4.1: + dependencies: + punycode: 2.3.1 + + url-parse@1.5.10: + dependencies: + querystringify: 2.2.0 + requires-port: 1.0.0 + + util-deprecate@1.0.2: {} + + v8-compile-cache-lib@3.0.1: {} + + v8-compile-cache@2.4.0: {} + + v8-to-istanbul@9.3.0: + dependencies: + '@jridgewell/trace-mapping': 0.3.25 + '@types/istanbul-lib-coverage': 2.0.6 + convert-source-map: 2.0.0 + + w3c-keyname@2.2.8: {} + + w3c-xmlserializer@4.0.0: + dependencies: + xml-name-validator: 4.0.0 + + walker@1.0.8: + dependencies: + makeerror: 1.0.12 + + webidl-conversions@7.0.0: {} + + webrtc-adapter@9.0.1: + dependencies: + sdp: 3.2.0 + + whatwg-encoding@2.0.0: + dependencies: + iconv-lite: 0.6.3 + + whatwg-mimetype@3.0.0: {} + + whatwg-url@11.0.0: + dependencies: + tr46: 3.0.0 + webidl-conversions: 7.0.0 + + which-boxed-primitive@1.0.2: + dependencies: + is-bigint: 1.0.4 + is-boolean-object: 1.1.2 + is-number-object: 1.0.7 + is-string: 1.0.7 + is-symbol: 1.0.4 + + which-builtin-type@1.1.4: + dependencies: + function.prototype.name: 1.1.6 + has-tostringtag: 1.0.2 + is-async-function: 2.0.0 + is-date-object: 1.0.5 + is-finalizationregistry: 1.0.2 + is-generator-function: 1.0.10 + is-regex: 1.1.4 + is-weakref: 1.0.2 + isarray: 2.0.5 + which-boxed-primitive: 1.0.2 + which-collection: 1.0.2 + which-typed-array: 1.1.15 + + which-collection@1.0.2: + dependencies: + is-map: 2.0.3 + is-set: 2.0.3 + is-weakmap: 2.0.2 + is-weakset: 2.0.3 + + which-typed-array@1.1.15: + dependencies: + available-typed-arrays: 1.0.7 + call-bind: 1.0.7 + for-each: 0.3.3 + gopd: 1.0.1 + has-tostringtag: 1.0.2 + + which@2.0.2: + dependencies: + isexe: 2.0.0 + + word-wrap@1.2.5: {} + + wrap-ansi@7.0.0: + dependencies: + ansi-styles: 4.3.0 + string-width: 4.2.3 + strip-ansi: 6.0.1 + + wrap-ansi@8.1.0: + dependencies: + ansi-styles: 6.2.1 + string-width: 5.1.2 + strip-ansi: 7.1.0 + + wrappy@1.0.2: {} + + write-file-atomic@4.0.2: + dependencies: + imurmurhash: 0.1.4 + signal-exit: 3.0.7 + + ws@8.18.0: {} + + xml-name-validator@4.0.0: {} + + xmlchars@2.2.0: {} + + y-codemirror.next@0.3.5(@codemirror/state@6.4.1)(@codemirror/view@6.34.1)(yjs@13.6.20): + dependencies: + '@codemirror/state': 6.4.1 + '@codemirror/view': 6.34.1 + lib0: 0.2.98 + yjs: 13.6.20 + + y-protocols@1.0.6(yjs@13.6.20): + dependencies: + lib0: 0.2.98 + yjs: 13.6.20 + + y-webrtc@10.3.0(yjs@13.6.20): + dependencies: + lib0: 0.2.98 + simple-peer: 9.11.1 + y-protocols: 1.0.6(yjs@13.6.20) + yjs: 13.6.20 + optionalDependencies: + ws: 8.18.0 + transitivePeerDependencies: + - bufferutil + - supports-color + - utf-8-validate + + y18n@5.0.8: {} + + yallist@3.1.1: {} + + yargs-parser@21.1.1: {} + + yargs@17.7.2: + dependencies: + cliui: 8.0.1 + escalade: 3.2.0 + get-caller-file: 2.0.5 + require-directory: 2.1.1 + string-width: 4.2.3 + y18n: 5.0.8 + yargs-parser: 21.1.1 + + yjs@13.6.20: + dependencies: + lib0: 0.2.98 + + yn@3.1.1: {} + + yocto-queue@0.1.0: {} diff --git a/apps/frontend/public/assets/coding.gif b/apps/frontend/public/assets/coding.gif new file mode 100644 index 0000000000..c29535a58c Binary files /dev/null and b/apps/frontend/public/assets/coding.gif differ diff --git a/apps/frontend/src/app/collaboration/[id]/page.tsx b/apps/frontend/src/app/collaboration/[id]/page.tsx new file mode 100644 index 0000000000..739eac08a6 --- /dev/null +++ b/apps/frontend/src/app/collaboration/[id]/page.tsx @@ -0,0 +1,619 @@ +"use client"; +import Header from "@/components/Header/header"; +import { + Button, + Col, + Input, + Layout, + Modal, + message, + Row, + TabsProps, + Tag, + Typography, + Spin, +} from "antd"; +import { Content } from "antd/es/layout/layout"; +import "./styles.scss"; +import { useRouter } from "next/navigation"; +import { useEffect, useRef, useState } from "react"; +import { GetSingleQuestion, Question } from "@/app/services/question"; +import { + ClockCircleOutlined, + CodeOutlined, + InfoCircleFilled, + SendOutlined, + VideoCameraOutlined, +} from "@ant-design/icons"; +import CollaborativeEditor, { + CollaborativeEditorHandle, +} from "@/components/CollaborativeEditor/CollaborativeEditor"; +import { WebrtcProvider } from "y-webrtc"; +import { + ExecuteVisibleAndCustomTests, + ExecuteVisibleAndHiddenTestsAndSubmit, + ExecutionResults, + GetVisibleTests, + isTestResult, + SubmissionHiddenTestResultsAndStatus, + SubmissionResults, + Test, + TestData, + TestResult, +} from "@/app/services/execute"; +import { QuestionDetailFull } from "@/components/question/QuestionDetailFull/QuestionDetailFull"; +import VideoPanel from "@/components/VideoPanel/VideoPanel"; + +interface CollaborationProps {} + +export default function CollaborationPage(props: CollaborationProps) { + const router = useRouter(); + const providerRef = useRef(null); + const submissionProviderRef = useRef(null); + const executionProviderRef = useRef(null); + + const editorRef = useRef(null); + + const [isLoading, setIsLoading] = useState(false); + + // Code Editor States + const [historyDocRefId, setHistoryDocRefId] = useState( + undefined + ); + const [code, setCode] = useState(""); + const [questionTitle, setQuestionTitle] = useState( + undefined + ); + const [questionDocRefId, setQuestionDocRefId] = useState( + undefined + ); + const [complexity, setComplexity] = useState(undefined); + const [categories, setCategories] = useState([]); // Store the selected filter categories + const [description, setDescription] = useState(undefined); + const [selectedLanguage, setSelectedLanguage] = useState("Python"); // State to hold the selected language item + + // Session states + const [collaborationId, setCollaborationId] = useState( + undefined + ); + const [currentUser, setCurrentUser] = useState(undefined); + const [matchedUser, setMatchedUser] = useState("Loading..."); + const [sessionDuration, setSessionDuration] = useState(0); // State for count-up timer (TODO: currently using localstorage to store time, change to db stored time in the future) + const stopwatchRef = useRef(null); + const [matchedTopics, setMatchedTopics] = useState( + undefined + ); + + useEffect(() => { + const storedTime = localStorage.getItem("session-duration"); + setSessionDuration(storedTime ? parseInt(storedTime) : 0); + }, []); + + // Chat states + const [messageToSend, setMessageToSend] = useState( + undefined + ); + + // Test case states + const [manualTestCase, setManualTestCase] = useState( + undefined + ); + const [visibleTestCases, setVisibleTestCases] = useState([]); + const [isLoadingTestCase, setIsLoadingTestCase] = useState(false); + const [isLoadingSubmission, setIsLoadingSubmission] = + useState(false); + const [ + submissionHiddenTestResultsAndStatus, + setSubmissionHiddenTestResultsAndStatus, + ] = useState(undefined); + + // End Button Modal state + const [isModalOpen, setIsModalOpen] = useState(false); + // Session End Modal State + const [isSessionEndModalOpen, setIsSessionEndModalOpen] = + useState(false); + const [countDown, setCountDown] = useState(5); + + // Stops the session duration stopwatch + const stopStopwatch = () => { + if (stopwatchRef.current) { + clearInterval(stopwatchRef.current); + } + }; + + // Starts the session duration stopwatch + const startStopwatch = () => { + if (stopwatchRef.current) { + clearInterval(stopwatchRef.current); + } + + stopwatchRef.current = setInterval(() => { + setSessionDuration((prevTime) => { + const newTime = prevTime + 1; + localStorage.setItem("session-duration", newTime.toString()); + return newTime; + }); + }, 1000); + }; + + // Convert seconds into time of format "hh:mm:ss" + const formatTime = (seconds: number) => { + const hours = Math.floor(seconds / 3600); + const minutes = Math.floor((seconds % 3600) / 60); + const secs = seconds % 60; + + return ( + (hours > 9 ? hours : "0" + hours) + + ":" + + (minutes > 9 ? minutes : "0" + minutes) + + ":" + + (secs > 9 ? secs : "0" + secs) + ); + }; + + // Message + const [messageApi, contextHolder] = message.useMessage(); + + const successMessage = (message: string) => { + messageApi.open({ + type: "success", + content: message, + }); + }; + + const infoMessage = (message: string) => { + messageApi.open({ + type: "info", + content: message, + }); + }; + + const sendSubmissionResultsToMatchedUser = (data: SubmissionResults) => { + if (!providerRef.current) { + throw new Error("Provider not initialized"); + } + providerRef.current.awareness.setLocalStateField("submissionResultsState", { + submissionResults: data, + id: Date.now(), + }); + }; + + const sendExecutingStateToMatchedUser = (executing: boolean) => { + if (!providerRef.current) { + throw new Error("Provider not initialized"); + } + providerRef.current.awareness.setLocalStateField("executingState", { + executing: executing, + id: Date.now(), + }); + }; + + const sendSubmittingStateToMatchedUser = (submitting: boolean) => { + if (!providerRef.current) { + throw new Error("Provider not initialized"); + } + providerRef.current.awareness.setLocalStateField("submittingState", { + submitting: submitting, + id: Date.now(), + }); + }; + + const sendExecutionResultsToMatchedUser = (data: ExecutionResults) => { + if (!providerRef.current) { + throw new Error("Provider not initialized"); + } + providerRef.current.awareness.setLocalStateField("executionResultsState", { + executionResults: data, + id: Date.now(), + }); + }; + + const updateSubmissionResults = (data: SubmissionResults) => { + setSubmissionHiddenTestResultsAndStatus({ + hiddenTestResults: data.hiddenTestResults, + status: data.status, + }); + setVisibleTestCases(data.visibleTestResults); + }; + + const updateExecutionResults = (data: ExecutionResults) => { + setVisibleTestCases(data.visibleTestResults); + }; + + const handleRunTestCases = async () => { + if (!questionDocRefId) { + throw new Error("Question ID not found"); + } + setIsLoadingTestCase(true); + sendExecutingStateToMatchedUser(true); + const data = await ExecuteVisibleAndCustomTests(questionDocRefId, { + code: code, + language: selectedLanguage, + customTestCases: "", + }); + setVisibleTestCases(data.visibleTestResults); + infoMessage("Test cases executed. Review the results below."); + sendExecutionResultsToMatchedUser(data); + setIsLoadingTestCase(false); + sendExecutingStateToMatchedUser(false); + }; + + const handleSubmitCode = async () => { + if (!questionDocRefId) { + throw new Error("Question ID not found"); + } + setIsLoadingSubmission(true); + sendSubmittingStateToMatchedUser(true); + const data = await ExecuteVisibleAndHiddenTestsAndSubmit(questionDocRefId, { + code: code, + language: selectedLanguage, + user: currentUser ?? "", + matchedUser: matchedUser ?? "", + matchedTopics: matchedTopics ?? [], + title: questionTitle ?? "", + questionDifficulty: complexity ?? "", + questionTopics: categories, + }); + setVisibleTestCases(data.visibleTestResults); + setSubmissionHiddenTestResultsAndStatus({ + hiddenTestResults: data.hiddenTestResults, + status: data.status, + }); + sendSubmissionResultsToMatchedUser(data); + successMessage("Code saved successfully!"); + setIsLoadingSubmission(false); + sendSubmittingStateToMatchedUser(false); + }; + + const handleCodeChange = (code: string) => { + setCode(code); + }; + + // Fetch the question on initialisation + useEffect(() => { + if (!isLoading) { + setIsLoading(true); + } + + // Retrieve details from localstorage + const questionDocRefId: string = + localStorage.getItem("questionDocRefId") ?? ""; + const collabId: string = localStorage.getItem("collabId") ?? ""; + const matchedUser: string = localStorage.getItem("matchedUser") ?? ""; + const currentUser: string = localStorage.getItem("user") ?? ""; + const matchedTopics: string[] = + localStorage.getItem("matchedTopics")?.split(",") ?? []; + + // Set states from localstorage + setCollaborationId(collabId); + setMatchedUser(matchedUser); + setCurrentUser(currentUser); + setMatchedTopics(matchedTopics); + setQuestionDocRefId(questionDocRefId); + + GetSingleQuestion(questionDocRefId).then((data: Question) => { + setQuestionTitle(`${data.id}. ${data.title}`); + setComplexity(data.complexity); + setCategories(data.categories); + setDescription(data.description); + }); + + GetVisibleTests(questionDocRefId).then((data: Test[]) => { + setVisibleTestCases(data); + }); + + // Start stopwatch + startStopwatch(); + }, []); + + // useEffect for timer + useEffect(() => { + if (isSessionEndModalOpen && countDown > 0) { + const timer = setInterval(() => { + setCountDown((prevCountDown) => prevCountDown - 1); + }, 1000); + + return () => clearInterval(timer); // Clean up on component unmount or when countdown changes + } else if (countDown === 0) { + router.push("/matching"); // Redirect to matching page + } + }, [isSessionEndModalOpen, countDown]); + + // Tabs component items for visibleTestCases + var items: TabsProps["items"] = visibleTestCases.map((item, index) => { + return { + key: index.toString(), + label: ( + + Case {index + 1} + + ), + children: ( +
+ + {isTestResult(item) && ( +
+ + + {item.passed ? "Passed" : "Failed"} + +
+ Actual Output:{" "} + {item.actual} +
+ {item.error && ( + <> + Error: +
{item.error}
+ + )} +
+ )} +
+ ), + }; + }); + + // Handles the cleaning of localstorage variables, stopping the timer & signalling collab user on webrtc + // type: "initiator" | "peer" + const handleCloseCollaboration = (type: string) => { + // Stop stopwatch + stopStopwatch(); + if (editorRef.current && type === "initiator") { + editorRef.current.endSession(); // Call the method on the editor + } + + // Trigger modal open showing session end details + setIsSessionEndModalOpen(true); + + // Remove localstorage variables for collaboration + localStorage.removeItem("session-duration"); // TODO: Remove this after collaboration backend data stored + localStorage.removeItem("user"); + localStorage.removeItem("matchedUser"); + localStorage.removeItem("collabId"); + localStorage.removeItem("questionDocRefId"); + localStorage.removeItem("matchedTopics"); + }; + + return ( + + {contextHolder} +
+ + +

+ The collaboration session has ended. You will be redirected in{" "} + {countDown} seconds +

+

+ Question:{" "} + {questionTitle} +

+

+ Difficulty:{" "} + + {complexity && + complexity.charAt(0).toUpperCase() + complexity.slice(1)} + +

+

+ Duration:{" "} + + {formatTime(sessionDuration)} + +

+

+ Matched User:{" "} + + {matchedUser} + +

+ + + + + + + +
+
+
+ + Code +
+ {/* TODO: Link to execution service for code submission */} +
+
+ {isLoadingSubmission && } +
+ +
+
+ {collaborationId && currentUser && selectedLanguage && ( + + )} +
+ + + Session Status:{" "} + {submissionHiddenTestResultsAndStatus + ? submissionHiddenTestResultsAndStatus.status + : "Not Attempted"} + +
+ {submissionHiddenTestResultsAndStatus && ( + + Passed{" "} + { + submissionHiddenTestResultsAndStatus.hiddenTestResults + .passed + }{" "} + /{" "} + { + submissionHiddenTestResultsAndStatus.hiddenTestResults + .total + }{" "} + hidden test cases + + )} +
+
+ + + + +
+
+
+ + Session Details +
+ handleCloseCollaboration("initiator")} + open={isModalOpen} + onCancel={() => setIsModalOpen(false)} + width={400} + > +

+ Are you sure you want to quit the existing collaboration + session? This will end the session for both users! +

+ + +
+ +
+ Duration: + + {formatTime(sessionDuration)} + +
+
+ Matched User: + + {matchedUser} + +
+
+ + +
+
+ + Video +
+ + {/*
+
+ Matched with {matchedUser} +
+
+
+
+ setMessageToSend(e.target.value)} + placeholder="Send Message Here" + rows={4} + /> +
*/} +
+ + + + + + ); +} diff --git a/apps/frontend/src/app/collaboration/[id]/styles.scss b/apps/frontend/src/app/collaboration/[id]/styles.scss new file mode 100644 index 0000000000..66999ff862 --- /dev/null +++ b/apps/frontend/src/app/collaboration/[id]/styles.scss @@ -0,0 +1,187 @@ +.collaboration-layout { + background: white; + display: flex; + flex-direction: column; + height: 100vh; +} + +.collaboration-content { + background: white; + flex: 1; + overflow-y: auto; +} + +.first-col, +.second-col, +.third-col { + height: 90vh; +} + +.collab-row { + padding: 0rem 1rem; +} + +.code-row { + height: 100%; + padding: 1rem 0.25rem 0.25rem; +} + +.session-row { + height: 18%; + padding: 1rem 0.25rem 0.25rem; +} + +.chat-row { + height: 82%; + padding: 0.25rem; +} + +.test-top-container, +.code-top-container, +.session-top-container { + display: flex; + justify-content: space-between; +} + +.code-container { + border: 2px solid #463f3a; + border-radius: 10px; + width: 100%; + padding: 1rem; +} + +// .code-second-container { +// display: flex; +// margin: 4px 0px; +// } + +.code-language { + margin: auto 8px auto 0px; +} + +.language-select { + width: 120px; +} + +.session-container { + border: 2px solid #463f3a; + border-radius: 10px; + width: 100%; + padding: 1rem; +} + +.chat-container { + border: 2px solid #463f3a; + border-radius: 10px; + width: 100%; + padding: 1rem; +} + +.chat-message-box { + margin-top: 1rem; + height: 365px; + border: 1px solid #d9d9d9; + border-radius: 6px; + overflow-y: scroll; +} + +.chat-header-message { + font-size: 14px; + color: #c6c6c6; + margin: 3px auto; + text-align: center; +} + +.chat-typing-box { + margin-top: 1rem; +} + +.question-title, +.test-title, +.code-title, +.session-title, +.chat-title { + font-size: 16px; + font-weight: bold; +} + +.question-difficulty, +.question-topic { + margin: 4px 0px; +} + +.session-duration, +.session-matched-user-label { + margin: 4px 0px; +} + +.session-duration-timer { + font-weight: normal; + margin-left: 8px; +} + +.session-matched-user-name { + color: #e0afa0; + margin-left: 8px; +} + +.topic-label, +.session-duration, +.session-matched-user-label { + font-size: 14px; + font-weight: bold; +} + +.title-icons { + margin-right: 4px; +} + +.code-submit-button, +.session-end-button, +.test-case-button { + width: fit-content; +} + +.modal-description { + margin-bottom: 2rem; +} + +.session-modal-question, +.session-modal-difficulty, +.session-modal-duration, +.session-modal-matched-user { + font-weight: bold; +} + +.session-modal-time, +.session-modal-title { + font-weight: normal; +} +.session-modal-matched-user-name { + color: #e0afa0; +} + +.info-modal-icon { + color: red; +} + +.test-result-container { + margin-top: 10px; +} + +.hidden-test-icon { + margin-right: 5px; +} + +.error-message { + overflow-x: auto; + overflow-y: auto; // Allows vertical scroll if content exceeds max-height + white-space: nowrap; + max-width: 100%; + padding: 4px; + min-height: 50px; // Adjust height as needed + max-height: 150px; // Adjust max height for scrollable area + border: 1px solid #ddd; // Optional: add a border for visibility + border-radius: 4px; // Optional: round the corners slightly + background-color: #f9f9f9; // Optional: light background color +} diff --git a/apps/frontend/src/app/history/page.tsx b/apps/frontend/src/app/history/page.tsx new file mode 100644 index 0000000000..e881b3118b --- /dev/null +++ b/apps/frontend/src/app/history/page.tsx @@ -0,0 +1,191 @@ +"use client"; +import Header from "@/components/Header/header"; +import { Layout, message, PaginationProps, Row, Table, Tag } from "antd"; +import { Content } from "antd/es/layout/layout"; +import { HistoryOutlined } from "@ant-design/icons"; +import "./styles.scss"; +import { useEffect, useState } from "react"; +import React from "react"; +import { useRouter } from "next/navigation"; +import { GetUserHistories, History } from "@/app/services/history"; +import { ValidateUser, VerifyTokenResponseType } from "@/app/services/user"; + +interface TablePagination { + totalCount: number; + totalPages: number; + currentPage: number; + limit: number; +} + +export default function QuestionPage() { + // Message States + const [messageApi, contextHolder] = message.useMessage(); + + const error = (message: string) => { + messageApi.open({ + type: "error", + content: message, + }); + }; + + const router = useRouter(); + + const [username, setUsername] = useState(undefined); + const [userQuestionHistories, setUserQuestionHistories] = + useState(); + const [isHistoryLoading, setIsHistoryLoading] = useState(true); + const [paginationParams, setPaginationParams] = useState({ + totalCount: 0, + totalPages: 0, + currentPage: 1, + limit: 10, + }); + + // Handler for change in page jumper + const onPageJump: PaginationProps["onChange"] = (pageNumber) => { + setPaginationParams((prev) => { + loadQuestionHistories(pageNumber, prev.limit); + return { ...paginationParams, currentPage: pageNumber }; + }); + }; + + // Handler for show size change for pagination + const onShowSizeChange: PaginationProps["onShowSizeChange"] = ( + current, + pageSize + ) => { + setPaginationParams((prev) => { + loadQuestionHistories(current, pageSize); + return { ...paginationParams, currentPage: current, limit: pageSize }; + }); + }; + + async function loadQuestionHistories(currentPage: number, limit: number) { + if (username === undefined) return; + setIsHistoryLoading(true); + GetUserHistories(username, currentPage, limit) + .then((data: any) => { + setUserQuestionHistories(data.histories); + setPaginationParams({ + ...paginationParams, + totalCount: data.totalCount, + totalPages: data.totalPages, + currentPage: data.currentPage, + limit: data.limit, + }); + }) + .finally(() => { + setIsHistoryLoading(false); + }); + } + + useEffect(() => { + loadQuestionHistories(paginationParams.currentPage, paginationParams.limit); + }, [username]); + + useEffect(() => { + ValidateUser().then((data: VerifyTokenResponseType) => { + setUsername(data.data.username); + }); + }, []); + + const columns = [ + { + title: "Question Title", + dataIndex: "title", + key: "title", + }, + { + title: "Categories", + dataIndex: "questionTopics", + key: "questionTopics", + render: (categories: string[]) => + categories.map((category) => {category}), + }, + { + title: "Difficulty", + dataIndex: "questionDifficulty", + key: "questionDifficulty", + render: (difficulty: string) => { + let color = ""; + if (difficulty === "easy") { + color = "#2DB55D"; + } else if (difficulty === "medium") { + color = "orange"; + } else if (difficulty === "hard") { + color = "red"; + } + return ( +
+ {difficulty.charAt(0).toUpperCase() + difficulty.slice(1)} +
+ ); + }, + }, + { + title: "Submitted at", + dataIndex: "createdAt", + key: "createdAt", + render: (date: string) => { + return new Date(date).toLocaleString(); + }, + }, + { + title: "Language", + dataIndex: "language", + key: "language", + }, + { + title: "Matched with", + dataIndex: "matchedUser", + key: "matchedUser", + }, + ]; + + const handleRowClick = (h: History) => { + // Link to page + // questionId is just read as "history", as only the doc ref id is involved in requests + // If the question database is reloaded, then the questionDocRefId may not be correct + router.push( + `/question/history?data=${h.questionDocRefId}&history=${h.historyDocRefId}` + ); + }; + + return ( +
+ {contextHolder} + +
+ +
+
+
Submission History
+
+
+ { + return { + onClick: () => handleRowClick(record), + style: { cursor: "pointer" }, + }; + }} + loading={isHistoryLoading} + pagination={{ + current: paginationParams.currentPage, + total: paginationParams.totalCount, + pageSize: paginationParams.limit, + onChange: onPageJump, + showSizeChanger: true, + onShowSizeChange: onShowSizeChange, + }} + /> + + + + + + ); +} diff --git a/apps/frontend/src/app/history/styles.scss b/apps/frontend/src/app/history/styles.scss new file mode 100644 index 0000000000..3d435ad375 --- /dev/null +++ b/apps/frontend/src/app/history/styles.scss @@ -0,0 +1,64 @@ +.layout { + background: white; +} + +.content { + background: white; +} + +.content-card { + margin: 4rem 8rem; + padding: 2rem 4rem; + background-color: white; + min-height: 100vh; + border-radius: 30px; + box-shadow: 0px 10px 60px rgba(226, 236, 249, 0.5); +} + +.content-row-1 { + display: flex; + flex-direction: row; + justify-content: space-between; +} + +.content-title { + // font-family: "Poppins"; + // font-style: normal; + font-weight: 600; + font-size: 22px; + line-height: 33px; + letter-spacing: -0.01em; + color: #000000; +} + +.content-filter { + margin: 1.5rem 0; +} + +.edit-button { + margin-right: 0.5rem; +} + +.filter-button { + margin-left: 8px; + box-shadow: 0 2px 0 rgba(0, 0, 0, 0.02) !important; +} + +.clear-button { + width: 100%; +} + +.categories-multi-select, +.difficulty-select, +.order-select { + width: 100%; +} + +.create-title, +.new-problem-categories-multi-select, +.new-problem-difficulty-select, +.create-description, +.create-problem-id { + width: 100%; + margin: 5px; +} diff --git a/apps/frontend/src/app/layout.tsx b/apps/frontend/src/app/layout.tsx new file mode 100644 index 0000000000..e68cebe340 --- /dev/null +++ b/apps/frontend/src/app/layout.tsx @@ -0,0 +1,35 @@ +import React from "react"; +import { AntdRegistry } from "@ant-design/nextjs-registry"; +import { ConfigProvider } from "antd"; +import WebSocketProvider from "@/components/WebSocketProvider/websocketprovider"; + +const RootLayout = ({ + children, +}: React.PropsWithChildren) => ( + + + + + {children} + + + + +); + +export default RootLayout; diff --git a/apps/frontend/src/app/login/page.tsx b/apps/frontend/src/app/login/page.tsx new file mode 100644 index 0000000000..09df31faef --- /dev/null +++ b/apps/frontend/src/app/login/page.tsx @@ -0,0 +1,106 @@ +"use client"; +import Header from "@/components/Header/header"; +import { Button, Input, Layout, message, Form } from "antd"; +import { Content } from "antd/es/layout/layout"; +import "./styles.scss"; +import { useState } from "react"; +import Link from "next/link"; +import { loginUser } from "@/app/services/user"; +import { setToken } from "@/app/services/login-store"; +import { useRouter } from "next/navigation"; +import NoAuthHeader from "@/components/NoAuthHeader/NoAuthHeader"; + +type InputFields = { + email: string; + password: string; +}; + +export default function LoginPage() { + const [isLoginFailed, setIsLoginFailed] = useState(false); + const router = useRouter(); + const [messageApi, contextHolder] = message.useMessage(); + + const successMessage = (message: string) => { + messageApi.open({ + type: "success", + content: message, + }); + }; + + function submitDetails({ email, password }: InputFields): void { + loginUser(email, password) + .then((jwt) => { + successMessage("Login successful"); + setToken(jwt); + router.push("/"); + }) + .catch((err) => { + console.error(err); + setIsLoginFailed(true); + }); + } + + return ( + <> + {contextHolder} + + + +
+

Login

+
+ + name="email" + rules={[ + { + required: true, + message: "Please provide your email.", + }, + ]} + > + + + + + name="password" + rules={[ + { + required: true, + message: "Please enter your password.", + }, + ]} + > + + + +
+ This email/username is not valid +
+ + + + + +
+

+ Not registered yet?{" "} + + Create an account + +

+
+
+ + + + ); +} diff --git a/apps/frontend/src/app/login/styles.scss b/apps/frontend/src/app/login/styles.scss new file mode 100644 index 0000000000..66debaa0cb --- /dev/null +++ b/apps/frontend/src/app/login/styles.scss @@ -0,0 +1,42 @@ +.layout { + background: white; +} + +.content { + background: white; +} + +.login-card { + /* Rectangle 6698 */ + margin: 8rem auto; + padding: 2rem 3rem; + box-sizing: border-box; + max-width: 26rem; + background: #ffffff; + border: 2px solid #8a817c; + box-shadow: 3px 4px 4px rgba(0, 0, 0, 0.25); + border-radius: 15px; +} + +.registration-failed-text { + color: #f02849; + font-size: 13px; +} + +.login-button { + width: 100%; +} + +.registration-text { + color: #bcb8b1; + margin: auto; + text-align: center; +} + +.create-account-link { + color: #8a817c; +} + +.create-account-link:hover { + color: #463f3a; +} diff --git a/apps/frontend/src/app/matching/MatchingModal.tsx b/apps/frontend/src/app/matching/MatchingModal.tsx new file mode 100644 index 0000000000..cf8db123e7 --- /dev/null +++ b/apps/frontend/src/app/matching/MatchingModal.tsx @@ -0,0 +1,185 @@ +"use client" + +import React, { useState, useEffect } from 'react'; +import { + Form, + Button, + Modal, + } from 'antd'; +import 'typeface-montserrat'; +import './styles.scss'; +import FindMatchContent from './modalContent/FindMatchContent'; +import MatchingInProgressContent from './modalContent/MatchingInProgressContent'; +import MatchFoundContent from './modalContent/MatchFoundContent'; +import JoinedMatchContent from './modalContent/JoinedMatchContent'; +import MatchNotFoundContent from './modalContent/MatchNotFoundContent'; +import MatchCancelledContent from './modalContent/MatchCancelledContent'; +import useMatching from '../services/use-matching'; +import { ValidateUser } from '../services/user'; +import { useTimer } from 'react-timer-hook'; +import { useRouter } from 'next/navigation'; + +interface MatchingModalProps { + isOpen: boolean; + close: () => void; +} + +export interface MatchParams { + topics: string[], + difficulties: string[], +} +const MATCH_TIMEOUT = 30; +const JOIN_TIMEOUT = 5; + +const MatchingModal: React.FC = ({ isOpen, close: _close }) => { + const matchingState = useMatching(); + const [closedType, setClosedType] = useState<"finding" | "cancelled" | "joined">("finding"); + const isClosable = ["timeout", "closed"].includes(matchingState.state) && closedType != "joined"; + const router = useRouter(); + const { totalSeconds, pause: pauseTimer, restart: restartTimer } = useTimer({ + expiryTimestamp: new Date(Date.now() + MATCH_TIMEOUT * 1000), + autoStart: false, + onExpire() { + if (matchingState.state === "matching") { + matchingState.timeout(); + return; + } + if (matchingState.state === "found") { + join(); + return; + } + console.warn(`matching is in ${matchingState.state}`) + }, + }); + const passed = MATCH_TIMEOUT - totalSeconds; + + function close() { + // clean up matching and closedType State + if (matchingState.state === "timeout") { + matchingState.ok(); + } + setClosedType("finding"); + _close(); + } + + const startMatch = matchingState.state == "closed" || matchingState.state == "timeout" ? async (params: MatchParams): Promise => { + const user = await ValidateUser(); + + restartTimer( + new Date(Date.now() + MATCH_TIMEOUT * 1000), + ); + + matchingState.start({ + email: user.data.email, + username: user.data.username, + type: "match_request", + ...params + }); + } : undefined; + + const join = matchingState.state == "found" ? (() => { + matchingState.ok(); + setClosedType("joined"); + localStorage.setItem("user", matchingState.info.user); + localStorage.setItem( + "matchedUser", + matchingState.info.matchedUser + ); + localStorage.setItem("collabId", matchingState.info.matchId); + localStorage.setItem("questionDocRefId", matchingState.info.questionDocRefId); + localStorage.setItem("matchedTopics", matchingState.info.matchedTopics.join(",")); + + // Redirect to collaboration page + router.push(`/collaboration/${matchingState.info.matchId}`); + }) : () => { throw new Error("join called when not found"); } + + useEffect(() => { + if (matchingState.state === "cancelling" || matchingState.state === "timeout") { + pauseTimer(); + return; + } + if (matchingState.state === "found") { + restartTimer( + new Date(Date.now() + JOIN_TIMEOUT * 1000), + ) + } + }, [matchingState]) + + const renderModalContent = () => { + switch (matchingState.state) { + case 'closed': + switch (closedType) { + case "finding": + return {}}/>; + case "cancelled": + return { + setClosedType("finding"); + }} + canceledIn={passed} + />; + case "joined": + return { + setClosedType("cancelled"); + }} + name1={matchingState.info?.user ?? ""} + name2={matchingState.info?.matchedUser ?? ""} + />; + } + case 'matching': + return { + setClosedType("cancelled"); + matchingState.cancel(); + pauseTimer(); + }} + timePassed={passed} + />; + case 'cancelling': + return {}} timePassed={passed}/>; + case 'starting': + return {}}/> + case 'found': + return { + matchingState.ok(); + setClosedType("cancelled"); + }} + join={join} + name1={matchingState.info.user} + name2={matchingState.info.matchedUser} + joiningIn={totalSeconds} + /> + case 'timeout': + return ; + default: + throw new Error('Invalid matching state.'); + } + } + + return ( + + + name="match" + onFinish={startMatch} + initialValues={{ + topics: [], + difficulties: [], + }}> + {renderModalContent()} + + {isClosable && ( + + )} + + ) +} + +export default MatchingModal; diff --git a/apps/frontend/src/app/matching/handlers.ts b/apps/frontend/src/app/matching/handlers.ts new file mode 100644 index 0000000000..424f1c2439 --- /dev/null +++ b/apps/frontend/src/app/matching/handlers.ts @@ -0,0 +1,27 @@ +export const handleFindMatch = () => { + // start timer + // open socket connection + // change matching state to 'matching' +} + +export const handleCancelMatch = () => { + // close socket connection + // stop timer + // change matching state to 'cancelled' +} + +// TODO: wait for collaboration service +export const handleJoinMatch = () => { + // notify server that user has joined the match (close connection?) + // change matching state to 'joined' +} + +export const handleRetryMatch = () => { + // retain current difficulty and topics + // same as handleFindMatch +} + +export const handleReselectMatchOptions = () => { + // reset selected difficulties and topics + // same as handleFindMatch +} diff --git a/apps/frontend/src/app/matching/modalContent/FindMatchContent.tsx b/apps/frontend/src/app/matching/modalContent/FindMatchContent.tsx new file mode 100644 index 0000000000..393500569f --- /dev/null +++ b/apps/frontend/src/app/matching/modalContent/FindMatchContent.tsx @@ -0,0 +1,74 @@ +import React, { useState } from 'react'; +import { + Tag, + Select, + Space, + Form, + Button, + } from 'antd'; +import { + DifficultyOption, + CategoriesOption, +} from '@/utils/SelectOptions'; +import type { SelectProps } from 'antd'; +import 'typeface-montserrat'; +import './styles.scss'; +import { ValidateUser } from "@/app/services/user" +import { type MatchRequestParams } from '@/app/services/use-matching'; +import { MatchParams } from '../MatchingModal'; + +interface Props { + beginMatch(request: MatchRequestParams): void +} + +const FindMatchContent: React.FC = ({ beginMatch }) => { + return ( +
+
Find Match
+
Difficulty
+
+ name="difficulties"> + {/* @ts-ignore Not required to pass value and onChange as since this is handled by Form.Item wrapper*/} + + +
+
Topic
+
+ + name="topics" + > + + + +
+ + + + + + + + + + + + + + {isEditable && ( + <> + + + + )} + + + + + + + ); +}; + +export default ProfilePage; diff --git a/apps/frontend/src/app/profile/styles.scss b/apps/frontend/src/app/profile/styles.scss new file mode 100644 index 0000000000..80cbd2a6fe --- /dev/null +++ b/apps/frontend/src/app/profile/styles.scss @@ -0,0 +1,81 @@ +.layout { + background: white; +} + +.content { + background: white !important; +} + +.content-card1 { + position: relative; + margin: 4rem 18rem; + padding: 7rem 4rem 2rem; + background-color: white; + // min-height: 80vh; + border-radius: 30px; + box-shadow: 0px 10px 60px rgba(226, 236, 249, 0.5); +} + +.profile-header { + position: relative; + z-index: 2; + display: flex; + justify-content: space-between; +} + +.left-header { + display: flex; +} + +.right-header { + margin: auto 0; +} + +.avatar { + font-size: 32px !important; + background-color: rgb(189, 189, 189) !important; +} + +.name-container { + margin: auto 2rem; +} + +.username { + font-size: 24px; + font-weight: 600; + margin-bottom: 8px; +} + +.email { + font-weight: 20px; + font-weight: 500; + color: rgb(171, 170, 170); + margin-bottom: 12px; +} +.edit-button, +.cancel-button { + width: 80px; +} + +.cancel-button { + margin-right: 8px; +} +.save-button { + box-shadow: none !important; +} + +.profile-form { + padding: 2rem 0; +} + +.gradient-header { + position: absolute; + top: 0; + left: 0; + width: 100%; + height: 80px; /* Adjust this to control the gradient height */ + background: linear-gradient(to right, #e0afa0, #463f3a); + z-index: 1; /* Ensure this is lower than the profile header */ + border-top-left-radius: 30px; + border-top-right-radius: 30px; +} diff --git a/apps/frontend/src/app/question/[id]/page.tsx b/apps/frontend/src/app/question/[id]/page.tsx new file mode 100644 index 0000000000..9b5b353ad4 --- /dev/null +++ b/apps/frontend/src/app/question/[id]/page.tsx @@ -0,0 +1,360 @@ +"use client"; +import Header from "@/components/Header/header"; +import { Col, Layout, message, PaginationProps, Row, Spin, Table } from "antd"; +import { Content } from "antd/es/layout/layout"; +import { CodeOutlined, HistoryOutlined } from "@ant-design/icons"; +import "./styles.scss"; +import { useEffect, useRef, useState } from "react"; +import { GetSingleQuestion } from "../../services/question"; +import React from "react"; +import { useSearchParams } from "next/navigation"; +import { useRouter } from "next/navigation"; +import { QuestionDetailFull } from "@/components/question/QuestionDetailFull/QuestionDetailFull"; +import { Compartment, EditorState } from "@codemirror/state"; +import { basicSetup, EditorView } from "codemirror"; +import { javascript } from "@codemirror/lang-javascript"; +import { GetHistory, GetUserQuestionHistories } from "@/app/services/history"; +import { ValidateUser, VerifyTokenResponseType } from "@/app/services/user"; +import { GetVisibleTests, Test } from "@/app/services/execute"; + +interface Submission { + submittedAt: string; + language: string; + matchedUser: string; + otherUser: string; + historyDocRefId: string; + code: string; +} + +interface TablePagination { + totalCount: number; + totalPages: number; + currentPage: number; + limit: number; +} + +export default function QuestionPage() { + const [isLoading, setIsLoading] = useState(true); // Store the states related to table's loading + + // Message States + const [messageApi, contextHolder] = message.useMessage(); + + const error = (message: string) => { + messageApi.open({ + type: "error", + content: message, + }); + }; + + const editorRef = useRef(null); + const languageConf = new Compartment(); + + // Retrieve the questionDocRefId and historyDocRefId from query params during page navigation + const searchParams = useSearchParams(); + const questionDocRefId: string = searchParams?.get("data") ?? ""; + const historyDocRefId: string = searchParams?.get("history") ?? ""; + // Code Editor States + const [questionTitle, setQuestionTitle] = useState( + undefined + ); + const [complexity, setComplexity] = useState(undefined); + const [categories, setCategories] = useState([]); // Store the selected filter categories + const [description, setDescription] = useState(undefined); + const [username, setUsername] = useState(undefined); + const [userQuestionHistories, setUserQuestionHistories] = + useState(); + const [submission, setSubmission] = useState(); + const [isHistoryLoading, setIsHistoryLoading] = useState(true); + const [isSubmissionLoading, setIsSubmissionLoading] = useState(true); + const [currentSubmissionId, setCurrentSubmissionId] = useState< + string | undefined + >(historyDocRefId == "" ? undefined : historyDocRefId); + const [paginationParams, setPaginationParams] = useState({ + totalCount: 0, + totalPages: 0, + currentPage: 1, + limit: 3, + }); + const [visibleTestCases, setVisibleTestCases] = useState([]); + + const state = EditorState.create({ + doc: "", + extensions: [ + basicSetup, + languageConf.of(javascript()), + EditorView.theme({ + "&": { height: "100%", overflow: "hidden" }, // Enable Scroll + }), + EditorView.editable.of(false), // Disable editing + ], + }); + + // Handler for change in page jumper + const onPageJump: PaginationProps["onChange"] = (pageNumber) => { + setPaginationParams((prev) => { + loadQuestionHistories(pageNumber, prev.limit); + return { ...paginationParams, currentPage: pageNumber }; + }); + }; + + async function loadQuestionHistories(currentPage: number, limit: number) { + if (username === undefined) return; + setIsHistoryLoading(true); + GetUserQuestionHistories(username, questionDocRefId, currentPage, limit) + .then((data: any) => { + setUserQuestionHistories(data.histories); + setPaginationParams({ + ...paginationParams, + totalCount: data.totalCount, + totalPages: data.totalPages, + currentPage: data.currentPage, + limit: data.limit, + }); + }) + .finally(() => { + setIsHistoryLoading(false); + }); + } + + // When code editor page is initialised, fetch the particular question, and display in code editor + useEffect(() => { + if (!isLoading) { + setIsLoading(true); + } + + GetSingleQuestion(questionDocRefId) + .then((data: any) => { + setQuestionTitle(data.title); + setComplexity(data.complexity); + setCategories(data.categories); + setDescription(data.description); + }) + .finally(() => { + setIsLoading(false); + }); + + GetVisibleTests(questionDocRefId).then((data: Test[]) => { + setVisibleTestCases(data); + }); + }, [questionDocRefId]); + + useEffect(() => { + loadQuestionHistories(paginationParams.currentPage, paginationParams.limit); + }, [username]); + + useEffect(() => { + ValidateUser().then((data: VerifyTokenResponseType) => { + setUsername(data.data.username); + }); + }, []); + + useEffect(() => { + // Only show history if a history is selected + if (currentSubmissionId === undefined) return; + + const view = new EditorView({ + state, + parent: editorRef.current || undefined, + }); + + setIsSubmissionLoading(true); + GetHistory(currentSubmissionId) + .then((data: any) => { + const submittedAt = new Date(data.createdAt); + setSubmission({ + submittedAt: submittedAt.toLocaleString("en-US"), + language: data.language, + matchedUser: + username == data.matchedUser ? data.user : data.matchedUser, + otherUser: data.user, + historyDocRefId: data.historyDocRefId, + code: data.code, + }); + setIsSubmissionLoading(false); + + view.dispatch( + state.update({ + changes: { from: 0, to: state.doc.length, insert: data.code }, + }) + ); + }) + .finally(() => {}); + + return () => { + // Cleanup on component unmount + view.destroy(); + }; + }, [currentSubmissionId]); + + const columns = [ + { + title: "Submitted at", + dataIndex: "createdAt", + key: "createdAt", + render: (date: string) => { + return new Date(date).toLocaleString(); + }, + }, + { + title: "Language", + dataIndex: "language", + key: "language", + }, + { + title: "Matched with", + dataIndex: "matchedUser", + key: "matchedUser", + }, + ]; + + const handleRowClick = (s: Submission) => { + setCurrentSubmissionId(s.historyDocRefId); + }; + + return ( +
+ {contextHolder} + +
+ + +
+ + + + +
+
+
+ + Submission History +
+
+
{ + return { + onClick: () => handleRowClick(record), + style: { cursor: "pointer" }, + }; + }} + loading={isHistoryLoading} + pagination={{ + size: "small", + current: paginationParams.currentPage, + total: paginationParams.totalCount, + pageSize: paginationParams.limit, + onChange: onPageJump, + }} + scroll={{ y: 200 }} + /> + + + + + {currentSubmissionId && ( + +
+ {isSubmissionLoading && ( +
+ +
+ )} +
+
+
+ + Submitted Code +
+
+ + {/* Details of submission */} +
+
+
+ Submitted at: +
+
+ {submission?.submittedAt || "-"} +
+
+
+
Language:
+
+ {submission?.language || "-"} +
+
+
+
+ Matched with: +
+
+ {submission?.matchedUser + ? // Check to ensure that matched user is correct, otherwise swap with otherUser + username == submission.matchedUser + ? submission.otherUser + : submission.matchedUser + : "-"} +
+
+
+ + {/* Code Editor */} +
+
+
+
+
+ + )} + + + + + + ); +} diff --git a/apps/frontend/src/app/question/[id]/styles.scss b/apps/frontend/src/app/question/[id]/styles.scss new file mode 100644 index 0000000000..343f2bd3e9 --- /dev/null +++ b/apps/frontend/src/app/question/[id]/styles.scss @@ -0,0 +1,84 @@ +.question-layout { + background: white; + display: flex; + flex-direction: column; + height: 100vh; +} + +.question-content { + background: white; + flex: 1; + // overflow-y: auto; +} + +.first-col, +.second-col { + height: 90vh; +} + +.question-row { + padding: 0rem 1rem; +} + +.history-row { + padding: 0.5rem 0.25rem 0.25rem; + height: 40%; +} + +.code-row { + flex: 1; + height: 60%; + padding: 0.5rem 0.25rem 0.25rem; +} + +.test-top-container { + display: flex; + justify-content: space-between; + height: 50%; +} + +.history-container, +.code-container { + border: 2px solid #463f3a; + border-radius: 10px; + width: 100%; + height: 100%; + padding: 1rem; +} + +.history-language { + margin: auto 8px auto 0px; +} + +.language-select { + width: 120px; +} + +.question-title, +.test-title, +.code-title, +.history-title { + font-size: 16px; + font-weight: bold; +} + +.question-difficulty, +.question-topic { + margin: 4px 0px; +} + +.topic-label { + font-size: 14px; + font-weight: bold; +} + +.title-icons { + margin-right: 4px; +} + +.submission-header-detail { + font-weight: normal; + display: flex; + flex-direction: row; + padding: 0px 10px 0px 0px; +} diff --git a/apps/frontend/src/app/question/page.tsx b/apps/frontend/src/app/question/page.tsx new file mode 100644 index 0000000000..cb88d0bf3f --- /dev/null +++ b/apps/frontend/src/app/question/page.tsx @@ -0,0 +1,752 @@ +"use client"; +import Header from "@/components/Header/header"; +import { + Button, + Col, + Input, + Layout, + message, + PaginationProps, + Row, + Select, + Table, + TableProps, + Tag, + Modal, + Form, +} from "antd"; +import { Content } from "antd/es/layout/layout"; +import { + DeleteOutlined, + EditOutlined, + PlusCircleOutlined, + SearchOutlined, +} from "@ant-design/icons"; +import "./styles.scss"; +import { useEffect, useState, useLayoutEffect } from "react"; +import { + DeleteQuestion as DeleteQuestionByDocref, + GetQuestions, + Question, + CreateQuestion, + NewQuestion, + EditQuestion, +} from "../services/question"; +import { + CategoriesOption, + DifficultyOption, + OrderOption, +} from "../../utils/SelectOptions"; +import Link from "next/link"; +import TextArea from "antd/es/input/TextArea"; +import { ValidateUser, VerifyTokenResponseType } from "../services/user"; + +/** + * defines the State of the page whe a user is deleing an object. Has 3 general states: + * - {}: user is not deleting anything. The page's normal state + * - {index: docref string, deleteConfirmed: false}: Modal popup asking whether to delete the question, pending user's decision to confirm or cancel + * - {index: docref string, deleteConfirmed: true}: Currently deleting the question and reloading the database + */ +type DeletionStage = {} | { index: Question; deleteConfirmed: boolean }; + +function DeleteModal({ + isDeleting, + questionTitle, + okHandler, + cancelHandler, +}: { + questionTitle: string; + okHandler: () => void; + cancelHandler: () => void; + isDeleting: boolean; +}) { + const title: string = `Delete Question \"${questionTitle}\"?`; + const text: string = "This action is irreversible(?)!"; + + return ( + +

{text}

+ + ); +} + +export default function QuestionListPage() { + // State of Deletion + const [deletionStage, setDeletionStage] = useState({}); + + // Table States + const [questions, setQuestions] = useState(undefined); // Store the questions + const [totalCount, setTotalCount] = useState(undefined); // Store the total count of questions + const [totalPages, setTotalPages] = useState(undefined); // Store the total number of pages + const [currentPage, setCurrentPage] = useState(1); // Store the current page + const [limit, setLimit] = useState(10); // Store the quantity of questions to be displayed + const [isLoading, setIsLoading] = useState(true); // Store the states related to table's loading + + // Filtering States + const [search, setSearch] = useState(undefined); // Store the search + const [delayedSearch, setDelayedSearch] = useState( + undefined + ); // Store the delayed search value + const [categories, setCategories] = useState([]); // Store the selected filter categories + const [difficulty, setDifficulty] = useState([]); // Store the selected difficulty level + const [sortBy, setSortBy] = useState(undefined); // Store the selected sorting parameter + + // Message States + const [messageApi, contextHolder] = message.useMessage(); + + // States for Create New Problem Modal + const [form] = Form.useForm(); + const [isNewProblemModalOpen, setIsNewProblemModelOpen] = useState(false); + + // States for Edit Existing Problem Modal + const [editForm] = Form.useForm(); + const [isEditModalOpen, setIsEditModalOpen] = useState( + undefined + ); + + // State for refreshing data + const [refresh, setRefresh] = useState(false); + + // used to check if user JWT is verified + + const [isAdmin, setIsAdmin] = useState(undefined); + + useLayoutEffect(() => { + ValidateUser() + .then((data: VerifyTokenResponseType) => { + setIsAdmin(data.data.isAdmin); + }) + }, []); + + const handleEditClick = (index: number, question: Question) => { + // Open the modal for the specific question + const updatedModals = + isEditModalOpen && isEditModalOpen.map((_, idx) => idx === index); + setIsEditModalOpen(updatedModals); // Only the selected question's modal is open + + // Set the form value + editForm.setFieldsValue({ + title: question.title, + description: question.description, + complexity: question.complexity, + categories: question.categories, + }); + }; + + // Function to handle modal close + const handleModalClose = (index: number) => { + if (isEditModalOpen) { + const updatedModals = [...isEditModalOpen]; + updatedModals[index] = false; // Close the specific modal + setIsEditModalOpen(updatedModals); + } + }; + + const handleEditQuestion = async ( + values: NewQuestion, + index: number, + docRefId: string + ) => { + try { + const editedQuestion = await EditQuestion(values, docRefId); + // Reset form or update UI as needed + handleModalClose(index); + editForm.resetFields(); + success("Problem Updated!"); + setRefresh(!refresh); + } catch (err: any) { + error(err.message); + } + }; + + const handleCreateQuestion = async (values: NewQuestion) => { + try { + const createdQuestion = await CreateQuestion(values); + // Reset form or update UI as needed + setIsNewProblemModelOpen(false); + form.resetFields(); + success("New Problem Created!"); + setRefresh(!refresh); + } catch (err: any) { + error(err.message); + } + }; + + const showNewProblemModal = () => { + setIsNewProblemModelOpen(true); + }; + + const success = (message: string) => { + messageApi.open({ + type: "success", + content: message, + }); + }; + + const error = (message: string) => { + messageApi.open({ + type: "error", + content: message, + }); + }; + + const warning = (message: string) => { + messageApi.open({ + type: "warning", + content: message, + }); + }; + + async function loadQuestions() { + if (!isLoading) { + setIsLoading(true); + } + + let data = await GetQuestions( + currentPage, + limit, + sortBy, + difficulty, + categories, + delayedSearch + ); + setQuestions(data.questions); + setTotalCount(data.totalCount); + setTotalPages(data.totalPages); + setCurrentPage(data.currentPage); + setLimit(data.limit); + setIsLoading(false); + setIsEditModalOpen(Array(data.questions.length).fill(false)); + } + + useEffect(() => { + loadQuestions(); + }, [ + limit, + currentPage, + sortBy, + difficulty, + categories, + delayedSearch, + refresh, + ]); + + // Delay the fetching of data only after user stops typing for awhile + useEffect(() => { + const timeout = setTimeout(() => { + setDelayedSearch(search); + setCurrentPage(1); // Reset the current page + }, 500); + return () => clearTimeout(timeout); + }, [search]); + + // Table column specification + var columns: TableProps["columns"]; + if (isAdmin) { + columns = [ + { + title: "Id", + dataIndex: "id", + key: "id", + // render: (id: number) =>
{id}
, + }, + { + title: "Title", + dataIndex: "title", + key: "title", + render: (text: string, question: Question) => ( + + {text} + + ), + }, + { + title: "Categories", + dataIndex: "categories", + key: "categories", + render: (categories: string[]) => + categories.map((category) => {category}), + }, + { + title: "Difficulty", + dataIndex: "complexity", + key: "complexity", + render: (difficulty: string) => { + let color = ""; + if (difficulty === "easy") { + color = "#2DB55D"; + } else if (difficulty === "medium") { + color = "orange"; + } else if (difficulty === "hard") { + color = "red"; + } + return ( +
+ {difficulty.charAt(0).toUpperCase() + difficulty.slice(1)} +
+ ); + }, + }, + { + title: "Actions", + key: "actions", + dataIndex: "id", + render: (_: number, question: Question, index: number) => ( +
+ handleModalClose(index)} + footer={null} + width={600} + > +
{ + handleEditQuestion(values, index, question.docRefId); + }} + > + + + + +