Merge pull request #472 from SynBioDex/sep_053

recommend use of existing SO terms for feature orientation

Author: Fontanapink

apdx-validation.tex

@@ -397,7 +397,7 @@ \subsubsection*{Rules for the \class{Feature} class}
 \printWarning{Each \sbolmult{role:F}{role} property of a \sbol{Feature} MUST refer to a resource that clarifies the intended function of the \sbol{Feature}.\\
 Reference: \sec{sec:Feature}}
 
-\printValid{If a \sbol{Feature} has an \sbolmult{orientation:F}{orientation} property, its \sbol{URI} MUST be drawn from \ref{tbl:orientation_types}.\\ Reference: \sec{sec:Feature}}
+\printValid{If a \sbol{Feature} has an \sbolmult{orientation:F}{orientation} property, its \sbol{URI} MUST be drawn from \ref{tbl:orientation_types} or \ref{tbl:orientation_types_alternative}.\\ Reference: \sec{sec:Feature}}
 
 %\todo[inline]{Should we add that orientation SHOULD be used precisely for features of type DNA in components of type DNA?}
 
@@ -507,7 +507,7 @@ \subsubsection*{Rules for the \class{SequenceFeature} class}
 \subsubsection*{Rules for the \class{Location} class} 
 \setcounter{sbolCtr}{11301}
 
-\printValid{If a \sbol{Location} has an \sbolmult{orientation:L}{orientation} property, its \sbol{URI} MUST be drawn from \ref{tbl:orientation_types}.\\ Reference: \sec{sec:Location}}
+\printValid{If a \sbol{Location} has an \sbolmult{orientation:L}{orientation} property, its \sbol{URI} MUST be drawn from \ref{tbl:orientation_types} or \ref{tbl:orientation_types_alternative}.\\ Reference: \sec{sec:Location}}
 
 \printValid{For every \sbol{Location} that is not an \sbol{EntireSequence} and that is the value of a \sbolmult{hasLocation:SC}{hasLocation} property of a \sbol{Feature}, the value of its \sbolmult{hasSequence:L}{hasSequence} property MUST also either be a value of the \sbolmult{hasSequence:L}{hasSequence} property of the parent \sbol{Component} or else be the value of some \sbolmult{hasSequence:L}{hasSequence} property of an \sbol{EntireSequence} that is also a child of the same \sbol{Component}.\\ Reference: \sec{sec:Location}}
 

feature.tex

@@ -25,8 +25,23 @@ \subsubsection{Feature}
 
 \subparagraph{The \sbolheading{orientation} property}
 \label{sec:orientation:F}
-The \sbolmult{orientation:F}{orientation} property is OPTIONAL and has a data type of \sbol{URI}. This can be used to indicate how any associated double-stranded \sbol{Feature} is oriented on the \sbol{elements} of a \sbol{Sequence} from their parent \sbol{Component}. \ref{tbl:orientation_types} provides a list of REQUIRED \sbolmult{orientation:F}{orientation} \sbol{URI}s. If a \sbol{Feature} object has an \sbolmult{orientation:F}{orientation}, then it MUST come from \ref{tbl:orientation_types}.
+The \sbolmult{orientation:F}{orientation} property is OPTIONAL and has a data type of \sbol{URI}. This can be used to indicate how any associated double-stranded \sbol{Feature} is oriented on the \sbol{elements} of a \sbol{Sequence} from their parent \sbol{Component}.
+If a \sbol{Feature} object has an \sbolmult{orientation:F}{orientation}, then it is RECOMMENDED that it come from \ref{tbl:orientation_types}; for reasons of backwards compatability it MAY instead come from \ref{tbl:orientation_types_alternative}.
 
+\begin{table}[ht]
+  \begin{edtable}{tabular}{lp{3.75in}}
+    \toprule
+    \textbf{Orientation URI} & \textbf{Description} \\
+    \midrule
+    \url{https://identifiers.org/SO:0001030} & The region specified by this \sbol{Feature} or \sbol{Location} is on the \sbol{elements} of a \sbol{Sequence}. \\
+    \url{https://identifiers.org/SO:0001031} & The region specified by this \sbol{Feature} or \sbol{Location} is on the reverse-complement mapping of the \sbol{elements} of a \sbol{Sequence}. The exact nature of this mapping depends on the \sbol{encoding} of the \sbol{Sequence}. \\
+    \bottomrule
+  \end{edtable}
+  \caption{RECOMMENDED \sbol{URI}s for the \sbolmult{orientation:F}{orientation} property}
+  \label{tbl:orientation_types}
+\end{table}
+
+
 
 \begin{table}[ht]
   \begin{edtable}{tabular}{lp{3.75in}}
@@ -37,8 +52,8 @@ \subsubsection{Feature}
     \url{http://sbols.org/v3\#reverseComplement} & The region specified by this \sbol{Feature} or \sbol{Location} is on the reverse-complement mapping of the \sbol{elements} of a \sbol{Sequence}. The exact nature of this mapping depends on the \sbol{encoding} of the \sbol{Sequence}. \\
     \bottomrule
   \end{edtable}
-  \caption{REQUIRED \sbol{URI}s for the \sbolmult{orientation:F}{orientation} property}
-  \label{tbl:orientation_types}
+  \caption{Permitted alternative \sbol{URI}s for the \sbolmult{orientation:F}{orientation} property. The URIS listed in \ref{tbl:orientation_types} are preferred and SHOULD be used instead where possible.}
+  \label{tbl:orientation_types_alternative}
 \end{table}
 
 \paragraph{SubComponent}

location.tex

@@ -14,7 +14,9 @@ \subsubsection{Location}
 
 \subparagraph{The \sbolheading{orientation} property}
 \label{sec:orientation:L}
-The \sbolmult{orientation:L}{orientation} property is OPTIONAL and has a data type of \sbol{URI}. All subclasses of \sbol{Location} share this property, which can be used to indicate how any associated double-stranded \sbol{Feature} is oriented on the \sbol{elements} of a \sbol{Sequence} from their parent \sbol{Component}. \ref{tbl:orientation_types} provides a list of REQUIRED \sbolmult{orientation:L}{orientation} \sbol{URI}s. If a \sbol{Location} object has an \sbolmult{orientation:L}{orientation}, then it MUST come from \ref{tbl:orientation_types}.
+The \sbolmult{orientation:L}{orientation} property is OPTIONAL and has a data type of \sbol{URI}. All subclasses of \sbol{Location} share this property, which can be used to indicate how any associated double-stranded \sbol{Feature} is oriented on the \sbol{elements} of a \sbol{Sequence} from their parent \sbol{Component}.
+If a \sbol{Location} object has an \sbolmult{orientation:F}{orientation}, then it is RECOMMENDED that it come from \ref{tbl:orientation_types}; for reasons of backwards compatability it MAY instead come from \ref{tbl:orientation_types_alternative}.
+
 
 As is typical practice in biology, any change in orientation is applied after indices are interpreted.
 Thus, for example, in a DNA \sbol{Sequence} with \sbol{elements} {\tt AAAAACCCCCTTTTTGGGGGTTTTTGGGGG},