|
1087 | 1087 | "references": ["pmid:38467784", "pmid:7603564", "pmid:10767345", "pmid:19267933", "omim:147791", "mondo:0007838"], |
1088 | 1088 | "additional_literature": ["pmid:37422244", "pmid:22131879", "pmid:22084433", "pmid:16474167"] |
1089 | 1089 | }, |
| 1090 | +{ |
| 1091 | + "chrom": "chr9", |
| 1092 | + "start_hg38": 133071240, |
| 1093 | + "stop_hg38": 133071499, |
| 1094 | + "start_hg19": 135946627, |
| 1095 | + "stop_hg19": 135946886, |
| 1096 | + "start_t2t": 145285396, |
| 1097 | + "stop_t2t": 145285622, |
| 1098 | + "id": "MODY8_CEL", |
| 1099 | + "disease_id": "MODY8", |
| 1100 | + "gene_strand": "+", |
| 1101 | + "reference_motif_reference_orientation": ["GGCCCCCCCCGTGCCGCCCACGGGTGACTCCGG"], |
| 1102 | + "pathogenic_motif_reference_orientation": ["GGCCCCCCCGTGCCGCCCACGGGTGACTCCGG"], |
| 1103 | + "pathogenic_motif_gene_orientation": ["ACGGGTGACTCCGGGGCCCCCCCGTGCCGCCC"], |
| 1104 | + "benign_motif_reference_orientation": [], |
| 1105 | + "benign_motif_gene_orientation": [], |
| 1106 | + "unknown_motif_reference_orientation": [], |
| 1107 | + "unknown_motif_gene_orientation": [], |
| 1108 | + "disease": "Maturity-Onset Diabetes of the Young Type 8", |
| 1109 | + "gene": "CEL", |
| 1110 | + "flank_motif": null, |
| 1111 | + "locus_structure": "(GGCCCCCCCCGTGCCGCCCACGGGTGACTCCGG)*", |
| 1112 | + "inheritance": ["AD"], |
| 1113 | + "type": "Exonic", |
| 1114 | + "location_in_gene": "Exon 11", |
| 1115 | + "benign_min": 7, |
| 1116 | + "benign_max": 23, |
| 1117 | + "intermediate_min": null, |
| 1118 | + "intermediate_max": null, |
| 1119 | + "pathogenic_min": 3, |
| 1120 | + "pathogenic_max": 3, |
| 1121 | + "ref_copies": 7.8, |
| 1122 | + "motif_len": 33, |
| 1123 | + "age_onset": "11-17 [@pmid:19760265]", |
| 1124 | + "age_onset_min": 11, |
| 1125 | + "age_onset_max": 17, |
| 1126 | + "typ_age_onset_min": null, |
| 1127 | + "typ_age_onset_max": null, |
| 1128 | + "novel": "novel", |
| 1129 | + "mechanism": "LoF?", |
| 1130 | + "mechanism_detail": "Loss of function at the protein level is possibly a part of the molecular mechanism. Research suggests that the mutations disrupt the C-terminal protein, leading to reduced stability of the mutant lipase in vitro [@pmid:16369531].", |
| 1131 | + "source": [], |
| 1132 | + "details": "There are two types of mutations proposed, a single basepair deletion causing a frameshift mutation [@pmid:16369531; @pmid:19760265]. One of these is a (C)8 to (C)7 within the VNTR causing a motif change (this is the pathogenic motif represented here). Also, a possible contraction from 4 to 3 VNTR repeats may be pathogenic with reduced penetrance, although evidence for this is sparse [@pmid:19760265].", |
| 1133 | + "omim": ["609812"], |
| 1134 | + "prevalence": null, |
| 1135 | + "prevalence_details": "Found in individuals of Danish and Norwegian ancestry [@pmid:16369531; @pmid:19760265].", |
| 1136 | + "stripy": [], |
| 1137 | + "gnomad": [], |
| 1138 | + "genereviews": [], |
| 1139 | + "mondo": ["0012348"], |
| 1140 | + "year": "2005", |
| 1141 | + "medgen": ["342845"], |
| 1142 | + "orphanet": ["552"], |
| 1143 | + "gard": [], |
| 1144 | + "malacard": ["MTR082"], |
| 1145 | + "webstr_hg38": [], |
| 1146 | + "webstr_hg19": [], |
| 1147 | + "tr_atlas": [], |
| 1148 | + "disease_description": "Maturity-onset diabetes of the young type 8 (MODY8) is characterized by onset of diabetes before age 25 years, with slowly progressive pancreatic exocrine dysfunction, fatty replacement of pancreatic parenchyma (lipomatosis), and development of pancreatic cysts [@omim:609812]. Other types of this disease have been associated with various genes and variant types. Comorbidity has been proposed between MODY and fecal elastase deficiency (FED).", |
| 1149 | + "locus_tags": ["unknown_evidence", "contraction"], |
| 1150 | + "disease_tags": [], |
| 1151 | + "references": ["pmid:19760265", "pmid:16369531", "omim:609812"], |
| 1152 | + "additional_literature": ["pmid:40641008", "pmid:39710966", "pmid:38483348", "pmid:38473919", "pmid:38458477", "pmid:36379850", "pmid:35583610", "pmid:35215948", "pmid:35156195", "pmid:35082198", "pmid:34850019", "pmid:34507899", "pmid:34100900", "pmid:33862081", "pmid:27802312", "pmid:27650499", "pmid:27773618", "pmid:23395566", "pmid:21784842", "pmid:15841033"] |
| 1153 | +}, |
1090 | 1154 | { |
1091 | 1155 | "chrom": "chr3", |
1092 | 1156 | "start_hg38": 129172576, |
|
0 commit comments