Feb lit update + additional PRs (#324)

## Description

Summarize the changes

Fixes: #318 , #295 , #317 , #284. #322, #319, #308

## Major Changes

- Updating outdated "mental retardation" to "intellectual development
disorder" in FRAXE (#318), FXS, & XMLR
- AFF2 name change (#318 ) and incomplete list of HPO terms added
- XLMR name change and disease ID change to XID and PHPX and overlap described
- New mechanistic information for OPDM2 (#295)
- Additional name added to NIID (#317)
- Added benign motif to CANVAS
- Handful of Motifs added to RFC1 (#322) 
- FTDALS1 pathogenic minimum brought down to 31 (intermediate brought
down to 30)

## Minor Changes

- FMR1 gene updated to fragile X messenger ribonucleoprotein 1 in FXS
description
- Added phenotype for premutation to FXTAS
- Additional mechanism detail added to NIID
- Added phenotype to CCHS

## Checklist

- [x] All changes are well summarized
- [ ] Check all tests pass
- [ ] Check that the website preview looks good
- [x] Update the STRchive version in `CITATION.cff`, format X.Y.Z. If
any major changes, increment Y. If only minor changes, increment Z. If
the breaking change (rare), increment X.
- [ ] Ask someone to review this PR

---------

Co-authored-by: Harriet Dashnow <h.dashnow@gmail.com>
Co-authored-by: hdashnow <3794821+hdashnow@users.noreply.github.com>
Co-authored-by: github-actions[bot] <41898282+github-actions[bot]@users.noreply.github.com>

Author: 3 people

CITATION.cff

@@ -1,6 +1,6 @@
 title: STRchive
-version: 2.15.0
-date-released: "2026-1-21"
+version: 2.16.0
+date-released: "2026-02-17"
 url: https://github.com/dashnowlab/STRchive
 authors:
   - family-names: Dashnow

data/STRchive-citations.json

@@ -72,10 +72,10 @@
   "stop_hg19": 147582273,
   "start_t2t": 146765190,
   "stop_t2t": 146765342,
-  "disease": "Fragile X syndrome, FRAXE type",
+  "disease": "Intellectual developmental disorder, Fragile X intellectual disability",
   "inheritance": ["XR"],
-  "disease_description": "A nonsyndromic X-linked mental retardation (NS-XLMR) characterized by mild intellectual deficit. FRAXE is the most common form of NS-XLMR [@mondo:0010659].",
-  "hpo_terms": null,
+  "disease_description": "A nonsyndromic X-linked intellectual development disorder characterized by mild intellectual deficit. FRAXE is the most common form of non-syndromic X-linked disability [@mondo:0010659].",
+  "hpo_terms": ["HP:0000718 Aggressive behavior", "HP:0000713 Agitation", "HP:0000729 Autistic behavior", "HP:0002312 Clumsiness", "HP:0000722 Compulsive behaviors", "HP:0000750 Delayed speech and language development", "HP:0001249 Intellectual disability"],
   "prevalence": "2/50000",
   "prevalence_details": "1-4/100,000 males [@url:medlineplus.gov/genetics/condition/fragile-xe-syndrome]; 1/50-100,000 males, more than 50 families [@pmid:11246464]. Found in populations around the globe, including in the UK, US, Canada, Taiwan, Germany, Greece, Cyprus, Spain, and Finland [@pmid:11246464].",
   "age_onset": "Typical: 2-10 [@pmid:11246464]. Range: 1-10; developmental delays without physical features can make onset difficult to detect until schooling [@omim:309548].",
@@ -926,8 +926,8 @@
   "benign_min": 2,
   "benign_max": 23,
   "intermediate_min": 24,
-  "intermediate_max": 60,
-  "pathogenic_min": 251,
+  "intermediate_max": 30,
+  "pathogenic_min": 31,
   "pathogenic_max": 4088,
   "motif_len": 6,
   "ref_copies": 10.8,
@@ -1634,10 +1634,10 @@
   "gene_strand": "-",
   "reference_motif_reference_orientation": ["GAA"],
   "pathogenic_motif_reference_orientation": ["GAA"],
-  "benign_motif_reference_orientation": ["GAAGGA", "GAAGAAGAAGAAGCA"],
+  "benign_motif_reference_orientation": ["GGA", "GCA"],
   "unknown_motif_reference_orientation": [],
   "pathogenic_motif_gene_orientation": ["CTT"],
-  "benign_motif_gene_orientation": ["CCTTCT", "CTGCTTCTTCTTCTT"],
+  "benign_motif_gene_orientation": ["CCT", "CTG"],
   "unknown_motif_gene_orientation": [],
   "locus_structure": [],
   "benign_min": 8,
@@ -1679,7 +1679,7 @@
   "stop_t2t": 146176769,
   "disease": "Fragile X syndrome (FXS), fragile X-associated tremor/ataxia syndrome (FXTAS), and fragile X-associated primary ovarian insufficiency FXPOI/POF1",
   "inheritance": ["XD"],
-  "disease_description": "A genetic syndrome caused by mutations in the FMR1 gene which is responsible for the expression of the fragile X mental retardation 1 protein. This protein participates in neural development. This syndrome is manifested with mental, emotional, behavioral, physical, and learning disabilities.; Any primary ovarian failure in which the cause of the disease is a mutation in the FMR1 gene.; Fragile X-associated tremor/ataxia syndrome (FXTAS) is a rare neurodegenerative disorder characterized by adult-onset progressive intention tremor and gait ataxia [@mondo:0010383; @mondo:0010706; @mondo:0010382].",
+  "disease_description": "A genetic syndrome caused by mutations in the FMR1 gene which is responsible for the expression of the fragile X messenger ribonucleoprotein 1 (FMR1) protein. This protein participates in neural development. This syndrome is manifested with mental, emotional, behavioral, physical, and learning disabilities.; Any primary ovarian failure in which the cause of the disease is a mutation in the FMR1 gene.; Fragile X-associated tremor/ataxia syndrome (FXTAS) is a rare neurodegenerative disorder characterized by adult-onset progressive intention tremor and gait ataxia [@mondo:0010383; @mondo:0010706; @mondo:0010382].",
   "hpo_terms": null,
   "prevalence": "14/100000",
   "prevalence_details": "Incidence of full mutation in males 19/100,000; prevalence 14/100,000 [@genereviews:NBK1384]. Female prevalence 9/100,000 [@pmid:24700618]. Known carrier frequency is approximately 300-500/100,000 but detected was 11/100,000 [@pmid:29100084]. FXS prevalence 1:7000 males, 1:11,000 females; FX premutation carriers 1:290-855 males, 1:148-300 females [@isbn:978-3-031-66932-3]. Found worldwide [@genereviews:NBK1384]. In Thailand, 1 in 600 women carry a premutation, and 1 in 400 carry a 'gray zone' allele [@pmid:39320553].",
@@ -1688,9 +1688,9 @@
   "age_onset_max": 78.0,
   "typ_age_onset_min": 1.0,
   "typ_age_onset_max": 65.0,
-  "details": "Intermediate or 'gray zone' occur at 45-54 alleles and may be unstable enough to expand into the premutation range, as well as associate with parkinsonism [@pmid:32463542; @genereviews:NBK1384]. FXTAS/POI occurs at 55-200 repeats, FXS >200, late onset; AGG and CTG interruptions documented [@genereviews:NBK1384; @pmid:29868108].",
+  "details": "Intermediate or 'gray zone' occur at 45-54 alleles and may be unstable enough to expand into the premutation range, as well as associate with parkinsonism [@pmid:32463542; @genereviews:NBK1384]. FXTAS/POI occurs at 55-200 repeats, FXS >200, late onset; AGG and CTG interruptions documented [@genereviews:NBK1384; @pmid:29868108]. Women with the premutation have been reported showing episodic memory deficits, similar to those seen in AD [@pmid:41555826].",
   "mechanism": "LoF/GoF",
-  "mechanism_detail": "Loss of function via transcriptional silencing in FXS, RNA gain of function in FXTAS/FXPOI [@pmid:16205714; @pmid:36169768].",
+  "mechanism_detail": "Loss of function via transcriptional silencing in FXS, RNA gain of function in FXTAS/FXPOI [@pmid:16205714; @pmid:36169768]. PRKGG appears to modulate neurotoxicity [@pmid:41507195].",
   "year": "1992 [@pmid:1605194]; causative gene discovered in 1991 [@pmid:1710175]",
   "location_in_gene": "5' UTR",
   "gene_strand": "+",
@@ -1884,9 +1884,9 @@
   "age_onset_max": 70.0,
   "typ_age_onset_min": 20.0,
   "typ_age_onset_max": 34.0,
-  "details": "Benign repeats range from absent [@gnomad:GIPC1] to 32 [@genereviews:NBK535148], while pathogenic alleles range from 73-164 repeats [@pmid:38876750; @genereviews:NBK535148]. Intermediate alleles have undetermined significance but may represent a phenotypic spectrum [@pmid:32413282]. Interruptions documented: CGA [@pmid:35245110]. Interruptions proposed but not confirmed in primary literature: TCG/CCT/TTG [@pmid:38467784].",
+  "details": "Benign repeats range from absent [@gnomad:GIPC1] to 32 [@genereviews:NBK535148], while pathogenic alleles range from 73-164 repeats [@pmid:38876750; @genereviews:NBK535148]. Findings suggest that alternative initiation sites and an upstream CTG codon serve as the initiation site for RAN translation [@pmid:41121761]. Intermediate alleles have undetermined significance but may represent a phenotypic spectrum [@pmid:32413282]. Interruptions documented: CGA [@pmid:35245110]. Interruptions proposed but not confirmed in primary literature: TCG/CCT/TTG [@pmid:38467784].",
   "mechanism": "LoF/GoF?",
-  "mechanism_detail": "RNA mediated toxicity hypothesized [@omim:618940], still unknown [@pmid:36169768].",
+  "mechanism_detail": "Findings suggest that the mechanism is likely not LoF, but the mechanism is otherwise unknown [@pmid:41121761]. This expansion appears to be predominantly RAN translated into a toxic protein [@pmid:41121761]. This protein has been reported to impair cell proliferation, induce cytotoxicity and apoptosis in multiple cell lines, and caused phenotypic defects in a zebrafish model [@pmid:41121761].",
   "year": "2020 [@pmid:32413282]",
   "location_in_gene": "5' UTR",
   "gene_strand": "-",
@@ -2838,9 +2838,9 @@
   "stop_hg19": 145209354,
   "start_t2t": 148519695,
   "stop_t2t": 148519738,
-  "disease": "Neuronal intranuclear inclusion disease, Alzheimer disease and parkinsonism phenotype, Oculopharyngodistal myopathy (OPDM) type 3",
+  "disease": "Neuronal intranuclear inclusion disease, Alzheimer disease and parkinsonism phenotype, Oculopharyngodistal myopathy (OPDM) type 3, hereditary essential tremor type 6",
   "inheritance": ["AD"],
-  "disease_description": "Neuronal intranuclear inclusion disease (NIID) is a very rare multisystem neurodegenerative disorder characterized by the presence of eosinophilic intranuclear inclusions in neuronal and glial cells, and neuronal loss [@mondo:0011327].",
+  "disease_description": "Neuronal intranuclear inclusion disease (NIID) is a very rare multisystem neurodegenerative disorder characterized by the presence of eosinophilic intranuclear inclusions in neuronal and glial cells, and neuronal loss [@mondo:0011327]. Due to overlapping phenotypes and the shared locus, it is unclear whether these four diseases are comorbid, synonymous, or entirely separate.",
   "hpo_terms": null,
   "prevalence": null,
   "prevalence_details": ">400 patients reported in literature [@pmid:37371433]. Found in individuals of East Asian ancestry [@pmid:38876750].",
@@ -2851,7 +2851,7 @@
   "typ_age_onset_max": 70.0,
   "details": "Benign alleles are less than 38 repeats, while pathogenic alleles contain 66+ repeats [@genereviews:NBK535148]. Intermediate alleles may be associated with a phenotypic spectrum, and even pathogenic cases can have variable phenotype [@pmid:39055960; @pmid:39496005]: NOTCH2NLC expansions have been linked Alzheimer's disease and Parkinson's disease, leading to a potential role in NIID-related disorders [@pmid:31178126]. Age of onset inversely related to allele size [@pmid:38377026]. Motif variation in controls: (AGG)(CGG)n(AGG)0-3(CGG)0-2. GGA and AGC interruptions may influence phenotype [@pmid:34718964]. Interruptions documented: GGA, GGG [@pmid:35245110]; ACCGAGAAGATGCCCGCCCTGC interruption proposed but not confirmed [@pmid:38467784]. Detection may be challenging due to parology between genes: C253572.1, NOTCH2, NOTCH2NL, NBPF14, NBPF19.",
   "mechanism": "GoF",
-  "mechanism_detail": "Polyglycine expansion; may relate to methylation or RNA pathogenicity [@omim:603472; @pmid:36169768; @pmid:38467784]. The polyglycine-containing protein sequesters a key subunit of transcription factor NF-κB in nuclear inclusions, leading to impaired autophagy [@doi:10.1186/s12964-025-02079-1].",
+  "mechanism_detail": "Polyglycine expansion; may relate to methylation or RNA pathogenicity [@omim:603472; @pmid:36169768; @pmid:38467784]. The polyglycine-containing protein sequesters a key subunit of transcription factor NF-κB in nuclear inclusions, leading to impaired autophagy [@doi:10.1186/s12964-025-02079-1]. Tau pathology is evident, changes in p-tau levels and tau deposition have been reported [@pmid:41539185].",
   "year": "2019 [@pmid:31332380]",
   "location_in_gene": "5' UTR",
   "gene_strand": "+",
@@ -3026,7 +3026,7 @@
   "stop_t2t": 41719805,
   "disease": "Congenital central hypoventilation syndrome",
   "inheritance": ["AD"],
-  "disease_description": "A rare disease due to a severely impaired central autonomic control of breathing and dysfunction of the autonomous nervous system. The incidence is estimated to be at 1 of 200 000 livebirths. A heterozygous mutation of PHOX-2B gene is found in 90% of the patients. Association with a Hirschsprung's disease is observed in 16% of the cases (adapted from Mondo) [@mondo:0800026].",
+  "disease_description": "A rare disease due to a severely impaired central autonomic control of breathing and dysfunction of the autonomous nervous system. The incidence is estimated to be at 1 of 200 000 livebirths. A heterozygous mutation of PHOX-2B gene is found in 90% of the patients. Association with a Hirschsprung's disease is observed in 16% of the cases (adapted from Mondo) [@mondo:0800026]. Hyperinsulinism has been observed in patients [@pmid:41531556].",
   "hpo_terms": null,
   "prevalence": null,
   "prevalence_details": "Incidence is 1:148000-200000 births (Estimated, may include mild/undiagnosed or be overestimated globally) [@genereviews:NBK1427]. Rare, but reported worldwide [@pmid:15121777].",
@@ -3583,12 +3583,12 @@
   "location_in_gene": "Intron 2",
   "gene_strand": "-",
   "reference_motif_reference_orientation": ["AAAAG"],
-  "pathogenic_motif_reference_orientation": ["AAGGG", "ACAGG", "AGGGC", "AAGGC", "AGAGG"],
-  "benign_motif_reference_orientation": ["AAAAG", "AAAGG", "AAGAG", "AAAGGG"],
-  "unknown_motif_reference_orientation": ["AAAAA", "AAAAC", "AACGG", "AAGAC", "AAGGT", "AGAAC", "AGGGG", "GAAAC", "GGGAC", "GTGAG", "AAAAGA", "AAAGGA", "GGAAAG"],
-  "pathogenic_motif_gene_orientation": ["CCCTT", "CCTGT", "CCCTG", "CCTTG", "CCTCT"],
-  "benign_motif_gene_orientation": ["CTTTT", "CCTTT", "CTCTT", "CCCTTT"],
-  "unknown_motif_gene_orientation": ["TTTTT", "GTTTT", "CCGTT", "CTTGT", "ACCTT", "CTGTT", "CCCCT", "CGTTT", "CCCGT", "ACCTC", "CTTTTT", "CCTTTT", "CCCTTT"],
+  "pathogenic_motif_reference_orientation": ["AAGGG", "ACAGG", "AAAGG", "AGGGC"],
+  "benign_motif_reference_orientation": ["AAAAG", "AAAGGG"],
+  "unknown_motif_reference_orientation": ["AAAAA", "AAAAC", "AACGG", "AAGAC", "AAGGT", "AGGGG", "AAGAG", "AAAAGG", "AAACG", "AACAG", "AGGTG", "ACGGG", "AAAAAG", "AAGGC"],
+  "pathogenic_motif_gene_orientation": ["CCCTT", "CCTGT", "CCTTT", "CCCTG"],
+  "benign_motif_gene_orientation": ["CTTTT", "CCCTTT"],
+  "unknown_motif_gene_orientation": ["TTTTT", "GTTTT", "CCGTT", "CTTGT", "ACCTT", "CCCCT", "CTCTT", "CCTTTT", "CGTTT", "CTGTT", "ACCTC", "CCCGT", "CTTTTT", "CCTTG"],
   "locus_structure": [
   {
     "motif": "AAAAG",
@@ -3823,8 +3823,8 @@
   "additional_literature": ["pmid:41426430", "pmid:41219789", "pmid:38961870", "pmid:38467733", "pmid:38059543", "pmid:37592133", "pmid:36740228", "pmid:36622139", "pmid:36092952", "pmid:33791773", "pmid:33721773", "pmid:33681653", "pmid:33501421", "pmid:33040085", "pmid:32973343", "pmid:32203200", "pmid:32194077", "pmid:32174879", "pmid:31664039", "pmid:31483537", "pmid:30559482", "pmid:30351492", "pmid:30194086"]
 },
 {
-  "id": "XLMR_SOX3",
-  "disease_id": "XLMR",
+  "id": "XLID_SOX3",
+  "disease_id": "XLID, PHPX",
   "gene": "SOX3",
   "chrom": "chrX",
   "start_hg38": 140504316,
@@ -3833,7 +3833,7 @@
   "stop_hg19": 139586526,
   "start_t2t": 138816203,
   "stop_t2t": 138816248,
-  "disease": "X-linked panhypopituitarism ; X-linked mental retardation with isolated growth hormone",
+  "disease": "X-linked intellectual developmental disorder with isolated growth hormone deficiency; X-linked panhypopituitarism (PHPX)",
   "inheritance": ["XR"],
   "disease_description": "X-linked isolated growth hormone deficiency (GHD) or combined pituitary hormone deficiency (CPHD) patients with or without intellectual disability [@pmid:24346842].",
   "hpo_terms": null,
@@ -3844,7 +3844,7 @@
   "age_onset_max": 9.0,
   "typ_age_onset_min": null,
   "typ_age_onset_max": null,
-  "details": "Expansion to 22-26 repeats or contraction to 8 repeats can cause disease, as reported in 3 families [@genereviews:NBK535148].",
+  "details": "Expansion to 22-26 repeats or contraction to 8 repeats can cause disease, as reported in 3 families [@genereviews:NBK535148]. There is phenotypic and allelic overlap between XLID and PHPX, with the pathogenic thresold for XLID estimated at 26 motifs and the pathogenic threshold for PHPX estimated at 22 motifs [@pmid:15800844, @pmid:12428212].",
   "mechanism": "LoF",
   "mechanism_detail": "Polyalanine expansions leading to aggresome formation and impaired transcriptional activity [@pmid:17127446].",
   "year": "2002 [@pmid:12428212]",

data/STRchive-loci.json

@@ -13,7 +13,7 @@ chr3	131917482	131917635	ID=DM2_CNBP;MOTIFS=CAGG,CAGA,CA;STRUC=<TR>
 chr3	141687011	141687054	ID=BPES_FOXL2;MOTIFS=NGC;STRUC=<TR>
 chr3	186521667	186521706	ID=FAME4_YEATS2;MOTIFS=TTTTA,TTTCA;STRUC=<TR>
 chr4	3073603	3073723	ID=HD_HTT;MOTIFS=CAG,CCG;STRUC=<TR>
-chr4	39318077	39318136	ID=CANVAS_RFC1;MOTIFS=AAAAG,AAGGG,ACAGG,AGGGC,AAGGC,AGAGG,AAAGG,AAGAG,AAAGGG;STRUC=<TR>
+chr4	39318077	39318136	ID=CANVAS_RFC1;MOTIFS=AAAAG,AAGGG,ACAGG,AAAGG,AGGGC,AAAGGG;STRUC=<TR>
 chr4	41719745	41719805	ID=CCHS_PHOX2B;MOTIFS=GCN;STRUC=<TR>
 chr4	162693303	162693405	ID=FAME7_RAPGEF2;MOTIFS=TTTTA,TTTCA;STRUC=<TR>
 chr5	10295525	10295593	ID=FAME3_MARCHF6;MOTIFS=TTTTA,TTTCA;STRUC=<TR>
@@ -38,7 +38,7 @@ chr12	111575873	111575940	ID=SCA2_ATXN2;MOTIFS=CTG;STRUC=<TR>
 chr12	123532573	123532603	ID=OPDM4_RILPL1;MOTIFS=GGC;STRUC=<TR>
 chr13	69361213	69361270	ID=SCA8_ATXN8OS;MOTIFS=CTA,CTG;STRUC=<TR>
 chr13	99196358	99196404	ID=HPE5_ZIC2;MOTIFS=GCN;STRUC=<TR>
-chr13	101377549	101377792	ID=SCA27B_FGF14;MOTIFS=GAA,GAAGGA,GAAGAAGAAGAAGCA;STRUC=<TR>
+chr13	101377549	101377792	ID=SCA27B_FGF14;MOTIFS=GAA,GGA,GCA;STRUC=<TR>
 chr14	17522488	17522519	ID=OPMD_PABPN1;MOTIFS=GCN;STRUC=<TR>
 chr14	86300519	86300603	ID=SCA3_ATXN3;MOTIFS=CTG;STRUC=<TR>
 chr15	20458510	20458536	ID=ALS1_NIPA1;MOTIFS=GCG;STRUC=<TR>
@@ -70,6 +70,6 @@ chrX	30882677	30882751	ID=DMD_DMD;MOTIFS=TTC,T;STRUC=<TR>
 chrX	65975147	65975250	ID=SBMA_AR;MOTIFS=GCA;STRUC=<TR>
 chrX	69887153	69887230	ID=XDP_TAF1;MOTIFS=AGAGGG;STRUC=<TR>
 chrX	135876774	135876804	ID=VACTERLX_ZIC3;MOTIFS=GCN;STRUC=<TR>
-chrX	138816203	138816248	ID=XLMR_SOX3;MOTIFS=NGC;STRUC=<TR>
+chrX	138816203	138816248	ID=XLID_SOX3;MOTIFS=NGC;STRUC=<TR>
 chrX	146176677	146176769	ID=FXS_FMR1;MOTIFS=CGG;STRUC=<TR>
 chrX	146765190	146765342	ID=FRAXE_AFF2;MOTIFS=GCC;STRUC=<TR>

data/catalogs/STRchive-disease-loci.T2T-chm13.TRGT.bed

@@ -82,6 +82,6 @@ chrX	30882743	30882751	T	1	DMD_DMD_flank
 chrX	65975147	65975250	GCA	3	SBMA_AR
 chrX	69887153	69887230	AGAGGG	6	XDP_TAF1
 chrX	135876774	135876804	GCN	3	VACTERLX_ZIC3
-chrX	138816203	138816248	NGC	3	XLMR_SOX3
+chrX	138816203	138816248	NGC	3	XLID_SOX3
 chrX	146176677	146176769	CGG	3	FXS_FMR1
 chrX	146765190	146765342	GCC	3	FRAXE_AFF2