fix: longest homopolymer needs to be case insensitive (#181)

Author: nh13

fgpyo/sequence.py

@@ -177,7 +177,7 @@ def longest_homopolymer_length(bases: str) -> int:
     while i < bases_len - cur_length:
         base = bases[i].upper()
         j = i + 1
-        while j < bases_len and bases[j] == base:
+        while j < bases_len and bases[j].upper() == base:
             j += 1
         cur_length = max(cur_length, j - i)
         # skip over all the bases in the current homopolymer

tests/fgpyo/test_sequence.py

@@ -39,6 +39,7 @@ def test_reverse_complement(bases: str, expected_rev_comp: str) -> None:
         ("", 0),
         ("A", 1),
         ("AAAA", 4),
+        ("ccgTATGC", 2),
         ("ACTACGATTTTTACGAT", 5),
         ("ACTACGATTTTTACGAT", 5),
         ("TTTTACTACGAACGAGTTTTT", 5),
@@ -124,6 +125,7 @@ def test_levenshtein_dynamic(string1: str, string2: str, levenshtein_distance: i
     ("", 2, 0),
     ("", 1, 0),
     ("A", 1, 1),
+    ("ccgTATGC", 1, 2),
     ("A", 2, 0),
     ("ACGT", 2, 2),
     ("AACCGGTT", 2, 2),