From 917c7aa6f617d02f1e88a23b471e8a3b0430625b Mon Sep 17 00:00:00 2001 From: jch Date: Fri, 7 Nov 2025 05:04:03 +1100 Subject: [PATCH 01/77] feat: add amas and macros --- tools/amas/.shed.yml | 10 +++ tools/amas/amas.xml | 155 ++++++++++++++++++++++++++++++++++++++++++ tools/amas/macros.xml | 12 ++++ 3 files changed, 177 insertions(+) create mode 100644 tools/amas/.shed.yml create mode 100644 tools/amas/amas.xml create mode 100644 tools/amas/macros.xml diff --git a/tools/amas/.shed.yml b/tools/amas/.shed.yml new file mode 100644 index 00000000000..2e34c51b154 --- /dev/null +++ b/tools/amas/.shed.yml @@ -0,0 +1,10 @@ +categories: + - Sequence Alignment + - Statistics +description: AMAS Alignment manipulation and summary statistics +homepage_url: https://github.com/marekborowiec/AMAS +long_description: Calculate summary statistics and + manipulate multiple sequence alignments +name: amas +owner: biohackathon +remote_repository_url: https://github.com/jchchiu/uscophy-aus (temp) \ No newline at end of file diff --git a/tools/amas/amas.xml b/tools/amas/amas.xml new file mode 100644 index 00000000000..cceca28c205 --- /dev/null +++ b/tools/amas/amas.xml @@ -0,0 +1,155 @@ + + Alignment manipulation (Concatenating, Replicating, Splitting) + + macros.xml + + + amas + + + amas + + AMAS.py -h + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + action["action_selector"] == "concat" + + + + + + + + + + action["action_selector"] == "concat" + + + + + + + + + + + + + + + + + + + + + + + \ No newline at end of file diff --git a/tools/amas/macros.xml b/tools/amas/macros.xml new file mode 100644 index 00000000000..020f7bff153 --- /dev/null +++ b/tools/amas/macros.xml @@ -0,0 +1,12 @@ + + + 1.0 + 0 + + + + 10.7717/peerj.1660 + + + + \ No newline at end of file From bb629f6256ce31f147cef2d36db3f517fcb281de Mon Sep 17 00:00:00 2001 From: jch Date: Fri, 7 Nov 2025 05:04:35 +1100 Subject: [PATCH 02/77] test: add simple working test case --- tools/amas/test-data/concat_1.fasta | 6 ++++++ tools/amas/test-data/concat_2.fasta | 6 ++++++ tools/amas/test-data/expected_concat.phylip | 4 ++++ tools/amas/test-data/expected_partitions.txt | 6 ++++++ 4 files changed, 22 insertions(+) create mode 100644 tools/amas/test-data/concat_1.fasta create mode 100644 tools/amas/test-data/concat_2.fasta create mode 100644 tools/amas/test-data/expected_concat.phylip create mode 100644 tools/amas/test-data/expected_partitions.txt diff --git a/tools/amas/test-data/concat_1.fasta b/tools/amas/test-data/concat_1.fasta new file mode 100644 index 00000000000..8869ded1323 --- /dev/null +++ b/tools/amas/test-data/concat_1.fasta @@ -0,0 +1,6 @@ +>OTU1 +?ACCATGTTTGTTGTAGGAGTCAACTTAGAAGCTTATGACCCATCCTATAAAGTCATCTCCAATGCCTCGTGCACAACCAACTGCTTAGCTCCACTCGCT +>OTU2 +ACCCATGTTTGTTGTAGGAGTCAACTTAGAAGCTTATGACCCATCCTATAAAGTCATCTCCAATGCCTCGTGCACAACCAACTGCTTAGCTCCACTCGCT +>OTU10 +AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA \ No newline at end of file diff --git a/tools/amas/test-data/concat_2.fasta b/tools/amas/test-data/concat_2.fasta new file mode 100644 index 00000000000..ff5e4cc8f61 --- /dev/null +++ b/tools/amas/test-data/concat_2.fasta @@ -0,0 +1,6 @@ +>OTU1 +?ACCATGTTTGTTGTAGGAGTCAACTTAGAAGCTTATGACCCATCCTATAAAGTCATCTCCAATGCCTCGTGCACAACCAACTGCTTAGCTCCACTCGCT +>OTU2 +ACCCATGTTTGTTGTAGGAGTCAACTTAGAAGCTTATGACCCATCCTATAAAGTCATCTCCAATGCCTCGTGCACAACCAACTGCTTAGCTCCACTCGCT +>OTU10 +TTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTT \ No newline at end of file diff --git a/tools/amas/test-data/expected_concat.phylip b/tools/amas/test-data/expected_concat.phylip new file mode 100644 index 00000000000..5ce3ce2d664 --- /dev/null +++ b/tools/amas/test-data/expected_concat.phylip @@ -0,0 +1,4 @@ +10 200 +OTU1 ?ACCATGTTTGTTGTAGGAGTCAACTTAGAAGCTTATGACCCATCCTATAAAGTCATCTCCAATGCCTCGTGCACAACCAACTGCTTAGCTCCACTCGCT?ACCATGTTTGTTGTAGGAGTCAACTTAGAAGCTTATGACCCATCCTATAAAGTCATCTCCAATGCCTCGTGCACAACCAACTGCTTAGCTCCACTCGCT +OTU10 AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAATTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTT +OTU2 ACCCATGTTTGTTGTAGGAGTCAACTTAGAAGCTTATGACCCATCCTATAAAGTCATCTCCAATGCCTCGTGCACAACCAACTGCTTAGCTCCACTCGCTACCCATGTTTGTTGTAGGAGTCAACTTAGAAGCTTATGACCCATCCTATAAAGTCATCTCCAATGCCTCGTGCACAACCAACTGCTTAGCTCCACTCGCT \ No newline at end of file diff --git a/tools/amas/test-data/expected_partitions.txt b/tools/amas/test-data/expected_partitions.txt new file mode 100644 index 00000000000..37c2c77c26d --- /dev/null +++ b/tools/amas/test-data/expected_partitions.txt @@ -0,0 +1,6 @@ +#NEXUS + +Begin sets; + charset p1_concat_1 = 1-100; + charset p2_concat_2 = 101-200; +End; \ No newline at end of file From be4db1f2c262fbc328216d9ca31f82016aeb3642 Mon Sep 17 00:00:00 2001 From: jch Date: Fri, 7 Nov 2025 05:43:23 +1100 Subject: [PATCH 03/77] fix: change category to Multiple Alignments --- tools/amas/.shed.yml | 3 +-- 1 file changed, 1 insertion(+), 2 deletions(-) diff --git a/tools/amas/.shed.yml b/tools/amas/.shed.yml index 2e34c51b154..27db21da491 100644 --- a/tools/amas/.shed.yml +++ b/tools/amas/.shed.yml @@ -1,6 +1,5 @@ categories: - - Sequence Alignment - - Statistics + - Multiple Alignments description: AMAS Alignment manipulation and summary statistics homepage_url: https://github.com/marekborowiec/AMAS long_description: Calculate summary statistics and From 932783d08b54facfbd690a60c727b59b9831a1c4 Mon Sep 17 00:00:00 2001 From: jch Date: Fri, 7 Nov 2025 05:49:09 +1100 Subject: [PATCH 04/77] fix: change category to Sequence Analysis --- tools/amas/.shed.yml | 2 +- 1 file changed, 1 insertion(+), 1 deletion(-) diff --git a/tools/amas/.shed.yml b/tools/amas/.shed.yml index 27db21da491..610521b3e22 100644 --- a/tools/amas/.shed.yml +++ b/tools/amas/.shed.yml @@ -1,5 +1,5 @@ categories: - - Multiple Alignments + - Sequence Analysis description: AMAS Alignment manipulation and summary statistics homepage_url: https://github.com/marekborowiec/AMAS long_description: Calculate summary statistics and From 793a6b17457ae02a575b8b3a0282e741512ac00c Mon Sep 17 00:00:00 2001 From: jch Date: Fri, 7 Nov 2025 16:25:24 +1100 Subject: [PATCH 05/77] update from george --- tools/amas/.shed.yml | 10 +- tools/amas/amas.xml | 279 +++++++++++-------- tools/amas/macros.xml | 84 +++++- tools/amas/test-data/concat_1.fasta | 6 - tools/amas/test-data/concat_2.fasta | 6 - tools/amas/test-data/expected_concat.phylip | 4 - tools/amas/test-data/expected_partitions.txt | 6 - tools/amas/tests.xml | 150 ++++++++++ 8 files changed, 400 insertions(+), 145 deletions(-) delete mode 100644 tools/amas/test-data/concat_1.fasta delete mode 100644 tools/amas/test-data/concat_2.fasta delete mode 100644 tools/amas/test-data/expected_concat.phylip delete mode 100644 tools/amas/test-data/expected_partitions.txt create mode 100644 tools/amas/tests.xml diff --git a/tools/amas/.shed.yml b/tools/amas/.shed.yml index 610521b3e22..a0fd18c9bf3 100644 --- a/tools/amas/.shed.yml +++ b/tools/amas/.shed.yml @@ -1,9 +1,9 @@ categories: - Sequence Analysis -description: AMAS Alignment manipulation and summary statistics +description: AMAS high-throughput alignment manipulation and summaries for phylogenomics homepage_url: https://github.com/marekborowiec/AMAS -long_description: Calculate summary statistics and - manipulate multiple sequence alignments +long_description: Handle expansive phylogenomic data sets by concatenating, converting, + trimming, translating, replicating, splitting, and summarising large nucleotide or amino acid alignments while retaining AMAS' efficient Python 3 core. name: amas -owner: biohackathon -remote_repository_url: https://github.com/jchchiu/uscophy-aus (temp) \ No newline at end of file +owner: george/biohackathon25aus +remote_repository_url: https://github.com/jchchiu/tools-iuc.git \ No newline at end of file diff --git a/tools/amas/amas.xml b/tools/amas/amas.xml index cceca28c205..2692cb0419c 100644 --- a/tools/amas/amas.xml +++ b/tools/amas/amas.xml @@ -1,74 +1,140 @@ - - Alignment manipulation (Concatenating, Replicating, Splitting) + + + High-throughput alignment manipulation and statistics for large phylogenomics + info.xml macros.xml + tests.xml + amas - - amas - - AMAS.py -h - + + + + - + - - - - - + + + + + + + + + + + + + + + - - - - + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + @@ -81,75 +147,66 @@ - - - - - - - - + + + - - + action["action_selector"] == "concat" - - - - - + + + + + - + action["action_selector"] == "concat" - - - - - - - - - - - - - - + - - - - - + + action["action_selector"] == "split" + + + + + action["action_selector"] == "remove" + - AMAS works on amino acid and nucleotide alignments and combines capabilities of sequence manipulation with a function that calculates - basic statistics. The manipulation functions include conversions among popular formats, concatenation, extracting sites and splitting - according to a pre-defined partitioning scheme, creation of replicate data sets, and removal of taxa. The statistics calculated - include the number of taxa, alignment length, total count of matrix cells, overall number of undetermined characters, percent of - missing data, AT and GC contents (for DNA alignments), count and proportion of variable sites, count and proportion of parsimony - informative sites, and counts of all characters relevant for a nucleotide or amino acid alphabet. AMAS is particularly suitable for - very large alignments with hundreds of taxa and thousands of loci. It is computationally efficient, utilizes parallel processing, - and performs better at concatenation than other popular tools. AMAS is a Python 3 program that relies solely on Python’s - core modules and needs no additional dependencies. + + + action["action_selector"] == "translate" + + + + + action["action_selector"] == "trim" + + - Note, The Tool Standard Output for concat will say "Wrote concatenated sequences to fasta file 'concatenated.out'"; however the file - obtained will be renamed with the output format you have chosen (e.g. 'concatenated.fasta' for fasta, 'concatenated.nex' for nexus and nexus-int) + - AMAS source code and manual can be downloaded from http://github.com/marekborowiec/AMAS/ under GNU General Public License. - ]]> - + + \ No newline at end of file diff --git a/tools/amas/macros.xml b/tools/amas/macros.xml index 020f7bff153..9850be23405 100644 --- a/tools/amas/macros.xml +++ b/tools/amas/macros.xml @@ -1,12 +1,82 @@ - + - 1.0 - 0 + + + amas + + - - - 10.7717/peerj.1660 - + + python -m amas.AMAS -h + + + \ No newline at end of file diff --git a/tools/amas/test-data/concat_1.fasta b/tools/amas/test-data/concat_1.fasta deleted file mode 100644 index 8869ded1323..00000000000 --- a/tools/amas/test-data/concat_1.fasta +++ /dev/null @@ -1,6 +0,0 @@ ->OTU1 -?ACCATGTTTGTTGTAGGAGTCAACTTAGAAGCTTATGACCCATCCTATAAAGTCATCTCCAATGCCTCGTGCACAACCAACTGCTTAGCTCCACTCGCT ->OTU2 -ACCCATGTTTGTTGTAGGAGTCAACTTAGAAGCTTATGACCCATCCTATAAAGTCATCTCCAATGCCTCGTGCACAACCAACTGCTTAGCTCCACTCGCT ->OTU10 -AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA \ No newline at end of file diff --git a/tools/amas/test-data/concat_2.fasta b/tools/amas/test-data/concat_2.fasta deleted file mode 100644 index ff5e4cc8f61..00000000000 --- a/tools/amas/test-data/concat_2.fasta +++ /dev/null @@ -1,6 +0,0 @@ ->OTU1 -?ACCATGTTTGTTGTAGGAGTCAACTTAGAAGCTTATGACCCATCCTATAAAGTCATCTCCAATGCCTCGTGCACAACCAACTGCTTAGCTCCACTCGCT ->OTU2 -ACCCATGTTTGTTGTAGGAGTCAACTTAGAAGCTTATGACCCATCCTATAAAGTCATCTCCAATGCCTCGTGCACAACCAACTGCTTAGCTCCACTCGCT ->OTU10 -TTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTT \ No newline at end of file diff --git a/tools/amas/test-data/expected_concat.phylip b/tools/amas/test-data/expected_concat.phylip deleted file mode 100644 index 5ce3ce2d664..00000000000 --- a/tools/amas/test-data/expected_concat.phylip +++ /dev/null @@ -1,4 +0,0 @@ -10 200 -OTU1 ?ACCATGTTTGTTGTAGGAGTCAACTTAGAAGCTTATGACCCATCCTATAAAGTCATCTCCAATGCCTCGTGCACAACCAACTGCTTAGCTCCACTCGCT?ACCATGTTTGTTGTAGGAGTCAACTTAGAAGCTTATGACCCATCCTATAAAGTCATCTCCAATGCCTCGTGCACAACCAACTGCTTAGCTCCACTCGCT -OTU10 AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAATTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTT -OTU2 ACCCATGTTTGTTGTAGGAGTCAACTTAGAAGCTTATGACCCATCCTATAAAGTCATCTCCAATGCCTCGTGCACAACCAACTGCTTAGCTCCACTCGCTACCCATGTTTGTTGTAGGAGTCAACTTAGAAGCTTATGACCCATCCTATAAAGTCATCTCCAATGCCTCGTGCACAACCAACTGCTTAGCTCCACTCGCT \ No newline at end of file diff --git a/tools/amas/test-data/expected_partitions.txt b/tools/amas/test-data/expected_partitions.txt deleted file mode 100644 index 37c2c77c26d..00000000000 --- a/tools/amas/test-data/expected_partitions.txt +++ /dev/null @@ -1,6 +0,0 @@ -#NEXUS - -Begin sets; - charset p1_concat_1 = 1-100; - charset p2_concat_2 = 101-200; -End; \ No newline at end of file diff --git a/tools/amas/tests.xml b/tools/amas/tests.xml new file mode 100644 index 00000000000..7f1a573cf51 --- /dev/null +++ b/tools/amas/tests.xml @@ -0,0 +1,150 @@ + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + \ No newline at end of file From af75ec90b65972aa1a21aea87b2171f6f15eec9a Mon Sep 17 00:00:00 2001 From: jch Date: Fri, 7 Nov 2025 16:29:53 +1100 Subject: [PATCH 06/77] update from george; add tests --- tools/amas/test-data/inputs/aa_alignment1.faa | 6 ++++++ .../test-data/inputs/aa_alignment1.int-phy | 6 ++++++ tools/amas/test-data/inputs/aa_alignment2.faa | 6 ++++++ .../test-data/inputs/aa_alignment2.int-phy | 6 ++++++ tools/amas/test-data/inputs/concat_1.fasta | 6 ++++++ tools/amas/test-data/inputs/concat_2.fasta | 6 ++++++ .../test-data/inputs/concat_result.phylip | 4 ++++ tools/amas/test-data/inputs/fasta1.fas | 20 +++++++++++++++++++ .../test-data/inputs/partitions_concat.nex | 6 ++++++ .../inputs/partitions_concat_unspecified.txt | 2 ++ tools/amas/test-data/inputs/remove_input.nex | 20 +++++++++++++++++++ .../amas/test-data/inputs/translate_input.fas | 6 ++++++ tools/amas/test-data/inputs/trim_input.fas | 8 ++++++++ .../test-data/outputs/expected_concat.phylip | 4 ++++ .../outputs/expected_concat_fasta.fas | 12 +++++++++++ .../expected_convert_aa_alignment1.int-nex | 14 +++++++++++++ .../expected_convert_aa_alignment2.int-nex | 14 +++++++++++++ .../test-data/outputs/expected_partitions.txt | 6 ++++++ .../outputs/expected_partitions_raxml.txt | 2 ++ .../outputs/expected_remove_filtered.int-nex | 19 ++++++++++++++++++ .../test-data/outputs/expected_replicate1.nex | 20 +++++++++++++++++++ .../test-data/outputs/expected_replicate2.nex | 20 +++++++++++++++++++ .../outputs/expected_split_partition1.fas | 9 +++++++++ .../outputs/expected_split_partition2.fas | 9 +++++++++ .../test-data/outputs/expected_summary.txt | 2 ++ .../outputs/expected_taxa_summary.txt | 11 ++++++++++ .../outputs/expected_translate_phylip.phy | 4 ++++ .../expected_trimmed_phylip_int.int-phy | 2 ++ 28 files changed, 250 insertions(+) create mode 100644 tools/amas/test-data/inputs/aa_alignment1.faa create mode 100644 tools/amas/test-data/inputs/aa_alignment1.int-phy create mode 100644 tools/amas/test-data/inputs/aa_alignment2.faa create mode 100644 tools/amas/test-data/inputs/aa_alignment2.int-phy create mode 100644 tools/amas/test-data/inputs/concat_1.fasta create mode 100644 tools/amas/test-data/inputs/concat_2.fasta create mode 100644 tools/amas/test-data/inputs/concat_result.phylip create mode 100644 tools/amas/test-data/inputs/fasta1.fas create mode 100644 tools/amas/test-data/inputs/partitions_concat.nex create mode 100644 tools/amas/test-data/inputs/partitions_concat_unspecified.txt create mode 100644 tools/amas/test-data/inputs/remove_input.nex create mode 100644 tools/amas/test-data/inputs/translate_input.fas create mode 100644 tools/amas/test-data/inputs/trim_input.fas create mode 100644 tools/amas/test-data/outputs/expected_concat.phylip create mode 100644 tools/amas/test-data/outputs/expected_concat_fasta.fas create mode 100644 tools/amas/test-data/outputs/expected_convert_aa_alignment1.int-nex create mode 100644 tools/amas/test-data/outputs/expected_convert_aa_alignment2.int-nex create mode 100644 tools/amas/test-data/outputs/expected_partitions.txt create mode 100644 tools/amas/test-data/outputs/expected_partitions_raxml.txt create mode 100644 tools/amas/test-data/outputs/expected_remove_filtered.int-nex create mode 100644 tools/amas/test-data/outputs/expected_replicate1.nex create mode 100644 tools/amas/test-data/outputs/expected_replicate2.nex create mode 100644 tools/amas/test-data/outputs/expected_split_partition1.fas create mode 100644 tools/amas/test-data/outputs/expected_split_partition2.fas create mode 100644 tools/amas/test-data/outputs/expected_summary.txt create mode 100644 tools/amas/test-data/outputs/expected_taxa_summary.txt create mode 100644 tools/amas/test-data/outputs/expected_translate_phylip.phy create mode 100644 tools/amas/test-data/outputs/expected_trimmed_phylip_int.int-phy diff --git a/tools/amas/test-data/inputs/aa_alignment1.faa b/tools/amas/test-data/inputs/aa_alignment1.faa new file mode 100644 index 00000000000..f292704cace --- /dev/null +++ b/tools/amas/test-data/inputs/aa_alignment1.faa @@ -0,0 +1,6 @@ +>Spec1 +ACDEFGHIKLMN +>Spec2 +ACDEYGHIKLMN +>Spec3 +ACDEFGHIKLMQ diff --git a/tools/amas/test-data/inputs/aa_alignment1.int-phy b/tools/amas/test-data/inputs/aa_alignment1.int-phy new file mode 100644 index 00000000000..aab718f6ef2 --- /dev/null +++ b/tools/amas/test-data/inputs/aa_alignment1.int-phy @@ -0,0 +1,6 @@ +3 12 + +Spec1 ACDEFGHIKLMN +Spec2 ACDEYGHIKLMN +Spec3 ACDEFGHIKLMQ + diff --git a/tools/amas/test-data/inputs/aa_alignment2.faa b/tools/amas/test-data/inputs/aa_alignment2.faa new file mode 100644 index 00000000000..270fd2004f5 --- /dev/null +++ b/tools/amas/test-data/inputs/aa_alignment2.faa @@ -0,0 +1,6 @@ +>SpecA +MSTNPKPQRKST +>SpecB +MSTNPKPQRKSA +>SpecC +MSTDPKPQRKST diff --git a/tools/amas/test-data/inputs/aa_alignment2.int-phy b/tools/amas/test-data/inputs/aa_alignment2.int-phy new file mode 100644 index 00000000000..c9713e7b469 --- /dev/null +++ b/tools/amas/test-data/inputs/aa_alignment2.int-phy @@ -0,0 +1,6 @@ +3 12 + +SpecA MSTNPKPQRKST +SpecB MSTNPKPQRKSA +SpecC MSTDPKPQRKST + diff --git a/tools/amas/test-data/inputs/concat_1.fasta b/tools/amas/test-data/inputs/concat_1.fasta new file mode 100644 index 00000000000..8869ded1323 --- /dev/null +++ b/tools/amas/test-data/inputs/concat_1.fasta @@ -0,0 +1,6 @@ +>OTU1 +?ACCATGTTTGTTGTAGGAGTCAACTTAGAAGCTTATGACCCATCCTATAAAGTCATCTCCAATGCCTCGTGCACAACCAACTGCTTAGCTCCACTCGCT +>OTU2 +ACCCATGTTTGTTGTAGGAGTCAACTTAGAAGCTTATGACCCATCCTATAAAGTCATCTCCAATGCCTCGTGCACAACCAACTGCTTAGCTCCACTCGCT +>OTU10 +AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA \ No newline at end of file diff --git a/tools/amas/test-data/inputs/concat_2.fasta b/tools/amas/test-data/inputs/concat_2.fasta new file mode 100644 index 00000000000..ff5e4cc8f61 --- /dev/null +++ b/tools/amas/test-data/inputs/concat_2.fasta @@ -0,0 +1,6 @@ +>OTU1 +?ACCATGTTTGTTGTAGGAGTCAACTTAGAAGCTTATGACCCATCCTATAAAGTCATCTCCAATGCCTCGTGCACAACCAACTGCTTAGCTCCACTCGCT +>OTU2 +ACCCATGTTTGTTGTAGGAGTCAACTTAGAAGCTTATGACCCATCCTATAAAGTCATCTCCAATGCCTCGTGCACAACCAACTGCTTAGCTCCACTCGCT +>OTU10 +TTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTT \ No newline at end of file diff --git a/tools/amas/test-data/inputs/concat_result.phylip b/tools/amas/test-data/inputs/concat_result.phylip new file mode 100644 index 00000000000..5ce3ce2d664 --- /dev/null +++ b/tools/amas/test-data/inputs/concat_result.phylip @@ -0,0 +1,4 @@ +10 200 +OTU1 ?ACCATGTTTGTTGTAGGAGTCAACTTAGAAGCTTATGACCCATCCTATAAAGTCATCTCCAATGCCTCGTGCACAACCAACTGCTTAGCTCCACTCGCT?ACCATGTTTGTTGTAGGAGTCAACTTAGAAGCTTATGACCCATCCTATAAAGTCATCTCCAATGCCTCGTGCACAACCAACTGCTTAGCTCCACTCGCT +OTU10 AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAATTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTT +OTU2 ACCCATGTTTGTTGTAGGAGTCAACTTAGAAGCTTATGACCCATCCTATAAAGTCATCTCCAATGCCTCGTGCACAACCAACTGCTTAGCTCCACTCGCTACCCATGTTTGTTGTAGGAGTCAACTTAGAAGCTTATGACCCATCCTATAAAGTCATCTCCAATGCCTCGTGCACAACCAACTGCTTAGCTCCACTCGCT \ No newline at end of file diff --git a/tools/amas/test-data/inputs/fasta1.fas b/tools/amas/test-data/inputs/fasta1.fas new file mode 100644 index 00000000000..3f7183c557b --- /dev/null +++ b/tools/amas/test-data/inputs/fasta1.fas @@ -0,0 +1,20 @@ +>OTU1 +?ACCATGTTTGTTGTAGGAGTCAACTTAGAAGCTTATGACCCATCCTATAAAGTCATCTCCAATGCCTCGTGCACAACCAACTGCTTAGCTCCACTCGCT +>OTU2 +ACCCATGTTTGTTGTAGGAGTCAACTTAGAAGCTTATGACCCATCCTATAAAGTCATCTCCAATGCCTCGTGCACAACCAACTGCTTAGCTCCACTCGCT +>OTU3 +ACCCATGTTTGTTGTAGGAGTCAACTTAGAAGCTTATGACCCATCCTATAAAGTCATCTCCAATGCCTCGTGCACAACCAACTGCTTAGCTCCACTCGCT +>OTU4 +ACCCATGTTTGTTGTAGGAGTCAACTTAGAAGCTTATGACCCATCCTATAAAGTCATCTCCAATGCCTCGTGCACAACCAACTGCTTAGCTCCACTCGCT +>OTU5 +ACCCATGTTTGTTGTAGGAGTCAACTTAGAAGCTTATGACCCATCCTATAAAGTCATCTCCAATGCCTCGTGCACAACCAACTGCTTAGCTCCACTCGCT +>OTU6 +ACCCATGTTTGTTGTAGGAGTCAACTTAGAAGCTTATGACCCATCCTATAAAGTCATCTCCAATGCCTCGTGCACAACCAACTGCTTAGCTCCACTCGCT +>OTU7 +ACCCATGTTTGTTGTAGGAGTCAACTTAGAAGCTTATGACCCATCCTATAAAGTCATCTCCAATGCCTCGTGCACAACCAACTGCTTAGCTCCACTCGCT +>OTU8 +ACCCATGTTTGTTGTAGGAGTCAACTTAGAAGCTTATGACCCATCCTATAAAGTCATCTCCAATGCCTCGTGCACAACCAACTGCTTAGCTCCACTCGCT +>OTU9 +ACACATGTTTGTTGTAGGAGTCAACTTAGAAGCTTATGACCCATCCTATAAAGTCATCTCCAATGCCTCGTGCACAACCAACTGCTTAGCTCCACTCGCT +>OTU10 +ACACATGTTTGTTGTAGGAGTCAACTTAGAAGCTTATGACCCATCCTATAAAGTCATCTCCAATGCCTCGTGCACAACCAACTGCTTAGCTCCACTCGCT diff --git a/tools/amas/test-data/inputs/partitions_concat.nex b/tools/amas/test-data/inputs/partitions_concat.nex new file mode 100644 index 00000000000..37c2c77c26d --- /dev/null +++ b/tools/amas/test-data/inputs/partitions_concat.nex @@ -0,0 +1,6 @@ +#NEXUS + +Begin sets; + charset p1_concat_1 = 1-100; + charset p2_concat_2 = 101-200; +End; \ No newline at end of file diff --git a/tools/amas/test-data/inputs/partitions_concat_unspecified.txt b/tools/amas/test-data/inputs/partitions_concat_unspecified.txt new file mode 100644 index 00000000000..0e23d953c9b --- /dev/null +++ b/tools/amas/test-data/inputs/partitions_concat_unspecified.txt @@ -0,0 +1,2 @@ +p1_concat_1 = 1-100 +p2_concat_2 = 101-200 diff --git a/tools/amas/test-data/inputs/remove_input.nex b/tools/amas/test-data/inputs/remove_input.nex new file mode 100644 index 00000000000..002c144c2b0 --- /dev/null +++ b/tools/amas/test-data/inputs/remove_input.nex @@ -0,0 +1,20 @@ +#NEXUS + +BEGIN DATA; + DIMENSIONS NTAX=10 NCHAR=100; + FORMAT DATATYPE=DNA GAP = - MISSING = ?; + MATRIX + OTU1 ?ACCATGTTTGTTGTAGGAGTCAACTTAGAAGCTTATGACCCATCCTATAAAGTCATCTCCAATGCCTCGTGCACAACCAACTGCTTAGCTCCACTCGCT + OTU10 ACACATGTTTGTTGTAGGAGTCAACTTAGAAGCTTATGACCCATCCTATAAAGTCATCTCCAATGCCTCGTGCACAACCAACTGCTTAGCTCCACTCGCT + OTU2 ACCCATGTTTGTTGTAGGAGTCAACTTAGAAGCTTATGACCCATCCTATAAAGTCATCTCCAATGCCTCGTGCACAACCAACTGCTTAGCTCCACTCGCT + OTU3 ACCCATGTTTGTTGTAGGAGTCAACTTAGAAGCTTATGACCCATCCTATAAAGTCATCTCCAATGCCTCGTGCACAACCAACTGCTTAGCTCCACTCGCT + OTU4 ACCCATGTTTGTTGTAGGAGTCAACTTAGAAGCTTATGACCCATCCTATAAAGTCATCTCCAATGCCTCGTGCACAACCAACTGCTTAGCTCCACTCGCT + OTU5 ACCCATGTTTGTTGTAGGAGTCAACTTAGAAGCTTATGACCCATCCTATAAAGTCATCTCCAATGCCTCGTGCACAACCAACTGCTTAGCTCCACTCGCT + OTU6 ACCCATGTTTGTTGTAGGAGTCAACTTAGAAGCTTATGACCCATCCTATAAAGTCATCTCCAATGCCTCGTGCACAACCAACTGCTTAGCTCCACTCGCT + OTU7 ACCCATGTTTGTTGTAGGAGTCAACTTAGAAGCTTATGACCCATCCTATAAAGTCATCTCCAATGCCTCGTGCACAACCAACTGCTTAGCTCCACTCGCT + OTU8 ACCCATGTTTGTTGTAGGAGTCAACTTAGAAGCTTATGACCCATCCTATAAAGTCATCTCCAATGCCTCGTGCACAACCAACTGCTTAGCTCCACTCGCT + OTU9 ACACATGTTTGTTGTAGGAGTCAACTTAGAAGCTTATGACCCATCCTATAAAGTCATCTCCAATGCCTCGTGCACAACCAACTGCTTAGCTCCACTCGCT + +; + +END; \ No newline at end of file diff --git a/tools/amas/test-data/inputs/translate_input.fas b/tools/amas/test-data/inputs/translate_input.fas new file mode 100644 index 00000000000..b202aeafcd9 --- /dev/null +++ b/tools/amas/test-data/inputs/translate_input.fas @@ -0,0 +1,6 @@ +>Seq1 +ATGGCCTTTAAA +>Seq2 +ATGGCCCTTAAC +>Seq3 +ATGGCCCTTAAA diff --git a/tools/amas/test-data/inputs/trim_input.fas b/tools/amas/test-data/inputs/trim_input.fas new file mode 100644 index 00000000000..d9d6aa4735d --- /dev/null +++ b/tools/amas/test-data/inputs/trim_input.fas @@ -0,0 +1,8 @@ +>tax1 +ACGTACGT---- +>tax2 +A-GTAC-TNNNN +>tax3 +AC-TACGT---- +>tax4 +----ACGTACGT diff --git a/tools/amas/test-data/outputs/expected_concat.phylip b/tools/amas/test-data/outputs/expected_concat.phylip new file mode 100644 index 00000000000..5ce3ce2d664 --- /dev/null +++ b/tools/amas/test-data/outputs/expected_concat.phylip @@ -0,0 +1,4 @@ +10 200 +OTU1 ?ACCATGTTTGTTGTAGGAGTCAACTTAGAAGCTTATGACCCATCCTATAAAGTCATCTCCAATGCCTCGTGCACAACCAACTGCTTAGCTCCACTCGCT?ACCATGTTTGTTGTAGGAGTCAACTTAGAAGCTTATGACCCATCCTATAAAGTCATCTCCAATGCCTCGTGCACAACCAACTGCTTAGCTCCACTCGCT +OTU10 AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAATTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTT +OTU2 ACCCATGTTTGTTGTAGGAGTCAACTTAGAAGCTTATGACCCATCCTATAAAGTCATCTCCAATGCCTCGTGCACAACCAACTGCTTAGCTCCACTCGCTACCCATGTTTGTTGTAGGAGTCAACTTAGAAGCTTATGACCCATCCTATAAAGTCATCTCCAATGCCTCGTGCACAACCAACTGCTTAGCTCCACTCGCT \ No newline at end of file diff --git a/tools/amas/test-data/outputs/expected_concat_fasta.fas b/tools/amas/test-data/outputs/expected_concat_fasta.fas new file mode 100644 index 00000000000..6992ad7318c --- /dev/null +++ b/tools/amas/test-data/outputs/expected_concat_fasta.fas @@ -0,0 +1,12 @@ +>OTU1 +?ACCATGTTTGTTGTAGGAGTCAACTTAGAAGCTTATGACCCATCCTATAAAGTCATCTCCAATGCCTCGTGCACAACCA +ACTGCTTAGCTCCACTCGCT?ACCATGTTTGTTGTAGGAGTCAACTTAGAAGCTTATGACCCATCCTATAAAGTCATCTC +CAATGCCTCGTGCACAACCAACTGCTTAGCTCCACTCGCT +>OTU10 +AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA +AAAAAAAAAAAAAAAAAAAATTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTT +TTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTT +>OTU2 +ACCCATGTTTGTTGTAGGAGTCAACTTAGAAGCTTATGACCCATCCTATAAAGTCATCTCCAATGCCTCGTGCACAACCA +ACTGCTTAGCTCCACTCGCTACCCATGTTTGTTGTAGGAGTCAACTTAGAAGCTTATGACCCATCCTATAAAGTCATCTC +CAATGCCTCGTGCACAACCAACTGCTTAGCTCCACTCGCT diff --git a/tools/amas/test-data/outputs/expected_convert_aa_alignment1.int-nex b/tools/amas/test-data/outputs/expected_convert_aa_alignment1.int-nex new file mode 100644 index 00000000000..0c86475ab11 --- /dev/null +++ b/tools/amas/test-data/outputs/expected_convert_aa_alignment1.int-nex @@ -0,0 +1,14 @@ +#NEXUS + +BEGIN DATA; + DIMENSIONS NTAX=3 NCHAR=12; + FORMAT INTERLEAVE DATATYPE=PROTEIN GAP = - MISSING = ?; + MATRIX +Spec1 ACDEFGHIKLMN +Spec2 ACDEYGHIKLMN +Spec3 ACDEFGHIKLMQ + + +; + +END; \ No newline at end of file diff --git a/tools/amas/test-data/outputs/expected_convert_aa_alignment2.int-nex b/tools/amas/test-data/outputs/expected_convert_aa_alignment2.int-nex new file mode 100644 index 00000000000..97a214415db --- /dev/null +++ b/tools/amas/test-data/outputs/expected_convert_aa_alignment2.int-nex @@ -0,0 +1,14 @@ +#NEXUS + +BEGIN DATA; + DIMENSIONS NTAX=3 NCHAR=12; + FORMAT INTERLEAVE DATATYPE=PROTEIN GAP = - MISSING = ?; + MATRIX +SpecA MSTNPKPQRKST +SpecB MSTNPKPQRKSA +SpecC MSTDPKPQRKST + + +; + +END; \ No newline at end of file diff --git a/tools/amas/test-data/outputs/expected_partitions.txt b/tools/amas/test-data/outputs/expected_partitions.txt new file mode 100644 index 00000000000..37c2c77c26d --- /dev/null +++ b/tools/amas/test-data/outputs/expected_partitions.txt @@ -0,0 +1,6 @@ +#NEXUS + +Begin sets; + charset p1_concat_1 = 1-100; + charset p2_concat_2 = 101-200; +End; \ No newline at end of file diff --git a/tools/amas/test-data/outputs/expected_partitions_raxml.txt b/tools/amas/test-data/outputs/expected_partitions_raxml.txt new file mode 100644 index 00000000000..41adfcf7a76 --- /dev/null +++ b/tools/amas/test-data/outputs/expected_partitions_raxml.txt @@ -0,0 +1,2 @@ +DNA, p1_concat_1 = 1-100 +DNA, p2_concat_2 = 101-200 diff --git a/tools/amas/test-data/outputs/expected_remove_filtered.int-nex b/tools/amas/test-data/outputs/expected_remove_filtered.int-nex new file mode 100644 index 00000000000..964dd0b604a --- /dev/null +++ b/tools/amas/test-data/outputs/expected_remove_filtered.int-nex @@ -0,0 +1,19 @@ +#NEXUS + +BEGIN DATA; + DIMENSIONS NTAX=8 NCHAR=100; + FORMAT INTERLEAVE DATATYPE=DNA GAP = - MISSING = ?; + MATRIX +OTU1 ?ACCATGTTTGTTGTAGGAGTCAACTTAGAAGCTTATGACCCATCCTATAAAGTCATCTCCAATGCCTCGTGCACAACCAACTGCTTAGCTCCACTCGCT +OTU2 ACCCATGTTTGTTGTAGGAGTCAACTTAGAAGCTTATGACCCATCCTATAAAGTCATCTCCAATGCCTCGTGCACAACCAACTGCTTAGCTCCACTCGCT +OTU3 ACCCATGTTTGTTGTAGGAGTCAACTTAGAAGCTTATGACCCATCCTATAAAGTCATCTCCAATGCCTCGTGCACAACCAACTGCTTAGCTCCACTCGCT +OTU4 ACCCATGTTTGTTGTAGGAGTCAACTTAGAAGCTTATGACCCATCCTATAAAGTCATCTCCAATGCCTCGTGCACAACCAACTGCTTAGCTCCACTCGCT +OTU5 ACCCATGTTTGTTGTAGGAGTCAACTTAGAAGCTTATGACCCATCCTATAAAGTCATCTCCAATGCCTCGTGCACAACCAACTGCTTAGCTCCACTCGCT +OTU6 ACCCATGTTTGTTGTAGGAGTCAACTTAGAAGCTTATGACCCATCCTATAAAGTCATCTCCAATGCCTCGTGCACAACCAACTGCTTAGCTCCACTCGCT +OTU7 ACCCATGTTTGTTGTAGGAGTCAACTTAGAAGCTTATGACCCATCCTATAAAGTCATCTCCAATGCCTCGTGCACAACCAACTGCTTAGCTCCACTCGCT +OTU8 ACCCATGTTTGTTGTAGGAGTCAACTTAGAAGCTTATGACCCATCCTATAAAGTCATCTCCAATGCCTCGTGCACAACCAACTGCTTAGCTCCACTCGCT + + +; + +END; \ No newline at end of file diff --git a/tools/amas/test-data/outputs/expected_replicate1.nex b/tools/amas/test-data/outputs/expected_replicate1.nex new file mode 100644 index 00000000000..002c144c2b0 --- /dev/null +++ b/tools/amas/test-data/outputs/expected_replicate1.nex @@ -0,0 +1,20 @@ +#NEXUS + +BEGIN DATA; + DIMENSIONS NTAX=10 NCHAR=100; + FORMAT DATATYPE=DNA GAP = - MISSING = ?; + MATRIX + OTU1 ?ACCATGTTTGTTGTAGGAGTCAACTTAGAAGCTTATGACCCATCCTATAAAGTCATCTCCAATGCCTCGTGCACAACCAACTGCTTAGCTCCACTCGCT + OTU10 ACACATGTTTGTTGTAGGAGTCAACTTAGAAGCTTATGACCCATCCTATAAAGTCATCTCCAATGCCTCGTGCACAACCAACTGCTTAGCTCCACTCGCT + OTU2 ACCCATGTTTGTTGTAGGAGTCAACTTAGAAGCTTATGACCCATCCTATAAAGTCATCTCCAATGCCTCGTGCACAACCAACTGCTTAGCTCCACTCGCT + OTU3 ACCCATGTTTGTTGTAGGAGTCAACTTAGAAGCTTATGACCCATCCTATAAAGTCATCTCCAATGCCTCGTGCACAACCAACTGCTTAGCTCCACTCGCT + OTU4 ACCCATGTTTGTTGTAGGAGTCAACTTAGAAGCTTATGACCCATCCTATAAAGTCATCTCCAATGCCTCGTGCACAACCAACTGCTTAGCTCCACTCGCT + OTU5 ACCCATGTTTGTTGTAGGAGTCAACTTAGAAGCTTATGACCCATCCTATAAAGTCATCTCCAATGCCTCGTGCACAACCAACTGCTTAGCTCCACTCGCT + OTU6 ACCCATGTTTGTTGTAGGAGTCAACTTAGAAGCTTATGACCCATCCTATAAAGTCATCTCCAATGCCTCGTGCACAACCAACTGCTTAGCTCCACTCGCT + OTU7 ACCCATGTTTGTTGTAGGAGTCAACTTAGAAGCTTATGACCCATCCTATAAAGTCATCTCCAATGCCTCGTGCACAACCAACTGCTTAGCTCCACTCGCT + OTU8 ACCCATGTTTGTTGTAGGAGTCAACTTAGAAGCTTATGACCCATCCTATAAAGTCATCTCCAATGCCTCGTGCACAACCAACTGCTTAGCTCCACTCGCT + OTU9 ACACATGTTTGTTGTAGGAGTCAACTTAGAAGCTTATGACCCATCCTATAAAGTCATCTCCAATGCCTCGTGCACAACCAACTGCTTAGCTCCACTCGCT + +; + +END; \ No newline at end of file diff --git a/tools/amas/test-data/outputs/expected_replicate2.nex b/tools/amas/test-data/outputs/expected_replicate2.nex new file mode 100644 index 00000000000..002c144c2b0 --- /dev/null +++ b/tools/amas/test-data/outputs/expected_replicate2.nex @@ -0,0 +1,20 @@ +#NEXUS + +BEGIN DATA; + DIMENSIONS NTAX=10 NCHAR=100; + FORMAT DATATYPE=DNA GAP = - MISSING = ?; + MATRIX + OTU1 ?ACCATGTTTGTTGTAGGAGTCAACTTAGAAGCTTATGACCCATCCTATAAAGTCATCTCCAATGCCTCGTGCACAACCAACTGCTTAGCTCCACTCGCT + OTU10 ACACATGTTTGTTGTAGGAGTCAACTTAGAAGCTTATGACCCATCCTATAAAGTCATCTCCAATGCCTCGTGCACAACCAACTGCTTAGCTCCACTCGCT + OTU2 ACCCATGTTTGTTGTAGGAGTCAACTTAGAAGCTTATGACCCATCCTATAAAGTCATCTCCAATGCCTCGTGCACAACCAACTGCTTAGCTCCACTCGCT + OTU3 ACCCATGTTTGTTGTAGGAGTCAACTTAGAAGCTTATGACCCATCCTATAAAGTCATCTCCAATGCCTCGTGCACAACCAACTGCTTAGCTCCACTCGCT + OTU4 ACCCATGTTTGTTGTAGGAGTCAACTTAGAAGCTTATGACCCATCCTATAAAGTCATCTCCAATGCCTCGTGCACAACCAACTGCTTAGCTCCACTCGCT + OTU5 ACCCATGTTTGTTGTAGGAGTCAACTTAGAAGCTTATGACCCATCCTATAAAGTCATCTCCAATGCCTCGTGCACAACCAACTGCTTAGCTCCACTCGCT + OTU6 ACCCATGTTTGTTGTAGGAGTCAACTTAGAAGCTTATGACCCATCCTATAAAGTCATCTCCAATGCCTCGTGCACAACCAACTGCTTAGCTCCACTCGCT + OTU7 ACCCATGTTTGTTGTAGGAGTCAACTTAGAAGCTTATGACCCATCCTATAAAGTCATCTCCAATGCCTCGTGCACAACCAACTGCTTAGCTCCACTCGCT + OTU8 ACCCATGTTTGTTGTAGGAGTCAACTTAGAAGCTTATGACCCATCCTATAAAGTCATCTCCAATGCCTCGTGCACAACCAACTGCTTAGCTCCACTCGCT + OTU9 ACACATGTTTGTTGTAGGAGTCAACTTAGAAGCTTATGACCCATCCTATAAAGTCATCTCCAATGCCTCGTGCACAACCAACTGCTTAGCTCCACTCGCT + +; + +END; \ No newline at end of file diff --git a/tools/amas/test-data/outputs/expected_split_partition1.fas b/tools/amas/test-data/outputs/expected_split_partition1.fas new file mode 100644 index 00000000000..205a34b8042 --- /dev/null +++ b/tools/amas/test-data/outputs/expected_split_partition1.fas @@ -0,0 +1,9 @@ +>OTU1 +?ACCATGTTTGTTGTAGGAGTCAACTTAGAAGCTTATGACCCATCCTATAAAGTCATCTCCAATGCCTCGTGCACAACCA +ACTGCTTAGCTCCACTCGCT +>OTU10 +AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA +AAAAAAAAAAAAAAAAAAAA +>OTU2 +ACCCATGTTTGTTGTAGGAGTCAACTTAGAAGCTTATGACCCATCCTATAAAGTCATCTCCAATGCCTCGTGCACAACCA +ACTGCTTAGCTCCACTCGCT diff --git a/tools/amas/test-data/outputs/expected_split_partition2.fas b/tools/amas/test-data/outputs/expected_split_partition2.fas new file mode 100644 index 00000000000..d16ff20f2f2 --- /dev/null +++ b/tools/amas/test-data/outputs/expected_split_partition2.fas @@ -0,0 +1,9 @@ +>OTU1 +?ACCATGTTTGTTGTAGGAGTCAACTTAGAAGCTTATGACCCATCCTATAAAGTCATCTCCAATGCCTCGTGCACAACCA +ACTGCTTAGCTCCACTCGCT +>OTU10 +TTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTT +TTTTTTTTTTTTTTTTTTTT +>OTU2 +ACCCATGTTTGTTGTAGGAGTCAACTTAGAAGCTTATGACCCATCCTATAAAGTCATCTCCAATGCCTCGTGCACAACCA +ACTGCTTAGCTCCACTCGCT diff --git a/tools/amas/test-data/outputs/expected_summary.txt b/tools/amas/test-data/outputs/expected_summary.txt new file mode 100644 index 00000000000..6eef1b748f6 --- /dev/null +++ b/tools/amas/test-data/outputs/expected_summary.txt @@ -0,0 +1,2 @@ +Alignment_name No_of_taxa Alignment_length Total_matrix_cells Undetermined_characters Missing_percent No_variable_sites Proportion_variable_sites Parsimony_informative_sites Proportion_parsimony_informative AT_content GC_content A C G T K M R Y S W B V H D X N O - ? +fasta1.fas 10 100 1000 1 0.1 2 0.02 1 0.01 0.543 0.457 262 297 160 280 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 \ No newline at end of file diff --git a/tools/amas/test-data/outputs/expected_taxa_summary.txt b/tools/amas/test-data/outputs/expected_taxa_summary.txt new file mode 100644 index 00000000000..16d6e91e103 --- /dev/null +++ b/tools/amas/test-data/outputs/expected_taxa_summary.txt @@ -0,0 +1,11 @@ +Alignment_name Taxon_name Sequence_length Undetermined_characters Missing_percent AT_content GC_content A C G T K M R Y S W B V H D X N O - ? +fasta1.fas OTU1 100 1 1.0 0.545 0.455 26 29 16 28 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 +fasta1.fas OTU10 100 0 0.0 0.55 0.45 27 29 16 28 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 +fasta1.fas OTU2 100 0 0.0 0.54 0.46 26 30 16 28 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 +fasta1.fas OTU3 100 0 0.0 0.54 0.46 26 30 16 28 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 +fasta1.fas OTU4 100 0 0.0 0.54 0.46 26 30 16 28 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 +fasta1.fas OTU5 100 0 0.0 0.54 0.46 26 30 16 28 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 +fasta1.fas OTU6 100 0 0.0 0.54 0.46 26 30 16 28 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 +fasta1.fas OTU7 100 0 0.0 0.54 0.46 26 30 16 28 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 +fasta1.fas OTU8 100 0 0.0 0.54 0.46 26 30 16 28 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 +fasta1.fas OTU9 100 0 0.0 0.55 0.45 27 29 16 28 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 \ No newline at end of file diff --git a/tools/amas/test-data/outputs/expected_translate_phylip.phy b/tools/amas/test-data/outputs/expected_translate_phylip.phy new file mode 100644 index 00000000000..455afa97d8d --- /dev/null +++ b/tools/amas/test-data/outputs/expected_translate_phylip.phy @@ -0,0 +1,4 @@ +3 3 +Seq1 WPL +Seq2 WPL +Seq3 WPL diff --git a/tools/amas/test-data/outputs/expected_trimmed_phylip_int.int-phy b/tools/amas/test-data/outputs/expected_trimmed_phylip_int.int-phy new file mode 100644 index 00000000000..0e4ab097844 --- /dev/null +++ b/tools/amas/test-data/outputs/expected_trimmed_phylip_int.int-phy @@ -0,0 +1,2 @@ +4 0 + From a45c8b5de21c13a1c02903c7f72121f1c8d1c775 Mon Sep 17 00:00:00 2001 From: jch Date: Fri, 7 Nov 2025 16:35:26 +1100 Subject: [PATCH 07/77] update from george; add info.xml --- tools/amas/info.xml | 38 ++++++++++++++++++++++++++++++++++++++ 1 file changed, 38 insertions(+) create mode 100644 tools/amas/info.xml diff --git a/tools/amas/info.xml b/tools/amas/info.xml new file mode 100644 index 00000000000..7340834bb08 --- /dev/null +++ b/tools/amas/info.xml @@ -0,0 +1,38 @@ + + + 1.0 + 1 + + + -seq-summary.txt` files. +* **convert** — re-encode each alignment as fasta/phylip/nexus (sequential or interleaved) using AMAS’ native `-out.` naming. +* **replicate** — generate phylogenetic jack-knife replicates by sampling loci; users set the number of replicates and loci per replicate. +* **split** — divide a concatenated alignment using a partitions file (format `unspecified`, `nexus`, or `raxml`) and optionally drop taxa that are entirely missing within a partition. +* **remove** — drop one or more taxa by name, prefixing resulting files with `reduced_` unless a custom prefix is supplied. +* **translate** — translate DNA alignments to amino acids with the chosen NCBI genetic code (1, 2, 3, 4, 5, 6, 9, 10, 11, 12, 13, 14, 16, 21, 22, 23, 24, 25, 26) and reading frame. +* **trim** — prune columns with occupancy below the nominated threshold and optionally retain only parsimony-informative sites (`AMAS trim` behaviour). Output files are named `trimmed_-out.`. + +Common arguments: + +1. `--in-files` (multi-select parameter in Galaxy). +2. `--in-format` — `fasta`, `phylip`, `nexus`, `phylip-int`, or `nexus-int`. +3. `--data-type` — `dna` or `aa`. +4. `--check-align` verifies that sequences are aligned (disabled by default for performance). +5. `--cores` controls the multiprocessing pool used when summarising alignments (set to 1 for deterministic Galaxy tests). + +Regression expectations from the upstream `amas/tests/tests.py` suite (e.g., `summary.txt`, `fasta1.fas-seq-summary.txt`) are bundled under `test-data/outputs/` so this wrapper stays in lock-step with the reference implementation. + +AMAS source code and manual: https://github.com/marekborowiec/AMAS + ]]> + + + + + 10.7717/peerj.1660 + + + \ No newline at end of file From e816d9c4d54d619b751d508afa48ca0337c115c0 Mon Sep 17 00:00:00 2001 From: jch Date: Fri, 7 Nov 2025 16:40:59 +1100 Subject: [PATCH 08/77] fix lint --- tools/amas/.shed.yml | 2 +- 1 file changed, 1 insertion(+), 1 deletion(-) diff --git a/tools/amas/.shed.yml b/tools/amas/.shed.yml index a0fd18c9bf3..e3908fa0957 100644 --- a/tools/amas/.shed.yml +++ b/tools/amas/.shed.yml @@ -5,5 +5,5 @@ homepage_url: https://github.com/marekborowiec/AMAS long_description: Handle expansive phylogenomic data sets by concatenating, converting, trimming, translating, replicating, splitting, and summarising large nucleotide or amino acid alignments while retaining AMAS' efficient Python 3 core. name: amas -owner: george/biohackathon25aus +owner: george-biohackathon25aus remote_repository_url: https://github.com/jchchiu/tools-iuc.git \ No newline at end of file From 9967a62e12c45cb2d69f7a4f04db326b62e20589 Mon Sep 17 00:00:00 2001 From: jch Date: Fri, 7 Nov 2025 17:57:55 +1100 Subject: [PATCH 09/77] add split test; update .shed; add comment to xml command --- tools/amas/.shed.yml | 4 ++-- tools/amas/macros.xml | 2 ++ tools/amas/tests.xml | 16 ++++++++++++++++ 3 files changed, 20 insertions(+), 2 deletions(-) diff --git a/tools/amas/.shed.yml b/tools/amas/.shed.yml index e3908fa0957..06fa9ff368a 100644 --- a/tools/amas/.shed.yml +++ b/tools/amas/.shed.yml @@ -3,7 +3,7 @@ categories: description: AMAS high-throughput alignment manipulation and summaries for phylogenomics homepage_url: https://github.com/marekborowiec/AMAS long_description: Handle expansive phylogenomic data sets by concatenating, converting, - trimming, translating, replicating, splitting, and summarising large nucleotide or amino acid alignments while retaining AMAS' efficient Python 3 core. + trimming, translating, replicating, splitting, and summarising large nucleotide or amino acid alignments. name: amas -owner: george-biohackathon25aus +owner: julian-joy-george-biohackathon25aus remote_repository_url: https://github.com/jchchiu/tools-iuc.git \ No newline at end of file diff --git a/tools/amas/macros.xml b/tools/amas/macros.xml index 9850be23405..1aa6b24747c 100644 --- a/tools/amas/macros.xml +++ b/tools/amas/macros.xml @@ -17,6 +17,8 @@ set -eu; rm -rf "run_dir/${action.action_selector}"; mkdir -p "run_dir/${action.action_selector}"; +## Create symlinks with original filename for consistent tests because +## input filenames are used as str vars in the partitions.txt output #for $f in $input_files ln -s '${f}' "run_dir/${action.action_selector}/${f.element_identifier}"; #end for diff --git a/tools/amas/tests.xml b/tools/amas/tests.xml index 7f1a573cf51..e7023e0edb9 100644 --- a/tools/amas/tests.xml +++ b/tools/amas/tests.xml @@ -145,6 +145,22 @@ + + + + + + + + + + + + + + + + \ No newline at end of file From 8e937d7dddc7a2a65e09b8126873ce976574a276 Mon Sep 17 00:00:00 2001 From: jch Date: Fri, 7 Nov 2025 19:38:08 +1100 Subject: [PATCH 10/77] update .shed owners --- tools/amas/.shed.yml | 2 +- 1 file changed, 1 insertion(+), 1 deletion(-) diff --git a/tools/amas/.shed.yml b/tools/amas/.shed.yml index 06fa9ff368a..ed50db71c3a 100644 --- a/tools/amas/.shed.yml +++ b/tools/amas/.shed.yml @@ -5,5 +5,5 @@ homepage_url: https://github.com/marekborowiec/AMAS long_description: Handle expansive phylogenomic data sets by concatenating, converting, trimming, translating, replicating, splitting, and summarising large nucleotide or amino acid alignments. name: amas -owner: julian-joy-george-biohackathon25aus +owner: biohackathon25aus-george-joy-julian-patra remote_repository_url: https://github.com/jchchiu/tools-iuc.git \ No newline at end of file From a6ff62e8b4c630223d272553bf19ff2e55d5c0a4 Mon Sep 17 00:00:00 2001 From: jch Date: Fri, 7 Nov 2025 22:28:04 +1100 Subject: [PATCH 11/77] remove translate --- tools/amas/amas.xml | 35 ----------------------------------- 1 file changed, 35 deletions(-) diff --git a/tools/amas/amas.xml b/tools/amas/amas.xml index 2692cb0419c..afbbb2edd66 100644 --- a/tools/amas/amas.xml +++ b/tools/amas/amas.xml @@ -89,41 +89,6 @@ - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - From c3546058d70aedfbaa937686d7db1f85b3ad4115 Mon Sep 17 00:00:00 2001 From: jch Date: Tue, 11 Nov 2025 11:24:33 +1100 Subject: [PATCH 12/77] docs: update .shed --- tools/amas/.shed.yml | 4 ++-- 1 file changed, 2 insertions(+), 2 deletions(-) diff --git a/tools/amas/.shed.yml b/tools/amas/.shed.yml index ed50db71c3a..0cc0d02c4e9 100644 --- a/tools/amas/.shed.yml +++ b/tools/amas/.shed.yml @@ -5,5 +5,5 @@ homepage_url: https://github.com/marekborowiec/AMAS long_description: Handle expansive phylogenomic data sets by concatenating, converting, trimming, translating, replicating, splitting, and summarising large nucleotide or amino acid alignments. name: amas -owner: biohackathon25aus-george-joy-julian-patra -remote_repository_url: https://github.com/jchchiu/tools-iuc.git \ No newline at end of file +owner: iuc +remote_repository_url: https://github.com/galaxyproject/tools-iuc/tree/main/tools/amas \ No newline at end of file From a4fc62fdc0f97360f15e69912d440287a9c1da2e Mon Sep 17 00:00:00 2001 From: jch Date: Tue, 11 Nov 2025 11:25:11 +1100 Subject: [PATCH 13/77] refactor: split concat into separate tool --- tools/amas/amas_concat.xml | 101 +++++++++++++++++++++++++++++++++++++ 1 file changed, 101 insertions(+) create mode 100644 tools/amas/amas_concat.xml diff --git a/tools/amas/amas_concat.xml b/tools/amas/amas_concat.xml new file mode 100644 index 00000000000..ba289f6b2d7 --- /dev/null +++ b/tools/amas/amas_concat.xml @@ -0,0 +1,101 @@ + + High-throughput alignment manipulation and statistics for large phylogenomics + + info.xml + macros.xml + + + + amas + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + \ No newline at end of file From 6a56045d23e62daf5e60e4c9d52d188d5ece7d7a Mon Sep 17 00:00:00 2001 From: jch Date: Tue, 11 Nov 2025 11:25:43 +1100 Subject: [PATCH 14/77] refactor: add input and output format as shared macro --- tools/amas/macros.xml | 22 +++++++++++++++++++++- 1 file changed, 21 insertions(+), 1 deletion(-) diff --git a/tools/amas/macros.xml b/tools/amas/macros.xml index 1aa6b24747c..a504be5ff15 100644 --- a/tools/amas/macros.xml +++ b/tools/amas/macros.xml @@ -1,4 +1,3 @@ - @@ -81,4 +80,25 @@ python -m amas.AMAS $check_align ]]> + + + + + + + + + + + + + + + + + + + + + \ No newline at end of file From 426a57798373d8367af1cbfcaedf2fb85072543a Mon Sep 17 00:00:00 2001 From: jch Date: Tue, 11 Nov 2025 11:35:34 +1100 Subject: [PATCH 15/77] refactor: add macro for changing output format --- tools/amas/amas_concat.xml | 26 +++++++++++++++++--------- tools/amas/macros.xml | 10 ++++++++++ 2 files changed, 27 insertions(+), 9 deletions(-) diff --git a/tools/amas/amas_concat.xml b/tools/amas/amas_concat.xml index ba289f6b2d7..609f51ca858 100644 --- a/tools/amas/amas_concat.xml +++ b/tools/amas/amas_concat.xml @@ -1,8 +1,8 @@ High-throughput alignment manipulation and statistics for large phylogenomics - info.xml macros.xml + info.xml @@ -62,13 +62,7 @@ - - - - - - - + @@ -96,6 +90,20 @@ - + + \ No newline at end of file diff --git a/tools/amas/macros.xml b/tools/amas/macros.xml index a504be5ff15..791ef2146a6 100644 --- a/tools/amas/macros.xml +++ b/tools/amas/macros.xml @@ -101,4 +101,14 @@ python -m amas.AMAS + + + + + + + + + + \ No newline at end of file From c75700820168f453e8ce43b439021afa6537bda2 Mon Sep 17 00:00:00 2001 From: jch Date: Tue, 11 Nov 2025 17:38:04 +1100 Subject: [PATCH 16/77] refactor: move info to macros --- tools/amas/macros.xml | 9 +++++++++ 1 file changed, 9 insertions(+) diff --git a/tools/amas/macros.xml b/tools/amas/macros.xml index 791ef2146a6..1fc05643db2 100644 --- a/tools/amas/macros.xml +++ b/tools/amas/macros.xml @@ -1,4 +1,7 @@ + 1.0 + 1 + amas @@ -111,4 +114,10 @@ python -m amas.AMAS + + + 10.7717/peerj.1660 + + + \ No newline at end of file From 1509d85f202626e84ae9c9679949cd3af25abb47 Mon Sep 17 00:00:00 2001 From: jch Date: Tue, 11 Nov 2025 17:45:23 +1100 Subject: [PATCH 17/77] refactor: change tool id/name; remove info macro --- tools/amas/amas_concat.xml | 7 ++++--- 1 file changed, 4 insertions(+), 3 deletions(-) diff --git a/tools/amas/amas_concat.xml b/tools/amas/amas_concat.xml index 609f51ca858..943a2c64308 100644 --- a/tools/amas/amas_concat.xml +++ b/tools/amas/amas_concat.xml @@ -1,8 +1,8 @@ - - High-throughput alignment manipulation and statistics for large phylogenomics + + concatenate multiple alignments + macros.xml - info.xml @@ -11,6 +11,7 @@ + Date: Tue, 11 Nov 2025 22:00:57 +1100 Subject: [PATCH 18/77] docs: update categories; reduce actions --- tools/amas/.shed.yml | 6 ++++-- 1 file changed, 4 insertions(+), 2 deletions(-) diff --git a/tools/amas/.shed.yml b/tools/amas/.shed.yml index 0cc0d02c4e9..61761aa5a15 100644 --- a/tools/amas/.shed.yml +++ b/tools/amas/.shed.yml @@ -1,9 +1,11 @@ categories: + - Phylogenetics - Sequence Analysis + - Statistics description: AMAS high-throughput alignment manipulation and summaries for phylogenomics homepage_url: https://github.com/marekborowiec/AMAS -long_description: Handle expansive phylogenomic data sets by concatenating, converting, - trimming, translating, replicating, splitting, and summarising large nucleotide or amino acid alignments. +long_description: Handle expansive phylogenomic data sets by concatenating, removing, + replicating, splitting, and summarising large nucleotide or amino acid alignments. name: amas owner: iuc remote_repository_url: https://github.com/galaxyproject/tools-iuc/tree/main/tools/amas \ No newline at end of file From c77e24628689ef7f099d17fb6edec28395975b79 Mon Sep 17 00:00:00 2001 From: jch Date: Tue, 11 Nov 2025 22:01:42 +1100 Subject: [PATCH 19/77] refactor: rename output format --- tools/amas/amas_concat.xml | 28 ++++++++++++++-------------- tools/amas/macros.xml | 16 ++-------------- 2 files changed, 16 insertions(+), 28 deletions(-) diff --git a/tools/amas/amas_concat.xml b/tools/amas/amas_concat.xml index 943a2c64308..643f98a137c 100644 --- a/tools/amas/amas_concat.xml +++ b/tools/amas/amas_concat.xml @@ -1,6 +1,6 @@ concatenate multiple alignments - + macros.xml @@ -33,12 +33,12 @@ --concat-part partitions.txt --concat-out concatenated.out --part-format $part_format - --out-format $concat_out_format + --out-format $out_format --in-files - #for $f in $input_files - #set $safename_input = re.sub('[^\w\-_\.]', '_', $f.element_identifier) - '${safename_input}' - #end for + #for $f in $input_files + #set $safename_input = re.sub('[^\w\-_\.]', '_', $f.element_identifier) + '${safename_input}' + #end for --in-format $in_format --data-type $data_type --cores "\${GALAXY_SLOTS:-1}" @@ -47,8 +47,8 @@ - - + + @@ -62,8 +62,8 @@ - - + + @@ -71,22 +71,22 @@ - + - + - + - + diff --git a/tools/amas/macros.xml b/tools/amas/macros.xml index 1fc05643db2..4b09981b1a9 100644 --- a/tools/amas/macros.xml +++ b/tools/amas/macros.xml @@ -1,7 +1,7 @@ 1.0 1 - + amas @@ -60,18 +60,6 @@ python -m amas.AMAS #for $taxon in $taxa_to_remove '$taxon.taxon' #end for -#elif $action.action_selector == "translate": - translate - --code $genetic_code - --reading-frame $reading_frame - --out-format $translate_out_format -#elif $action.action_selector == "trim": - trim - --trim-fraction $trim_fraction - #if str($retain_parsimony) == "true": - --retain-only-parsimony-sites - #end if - --out-format $trim_out_format #end if --in-files #for $f in $input_files @@ -95,7 +83,7 @@ python -m amas.AMAS - + From 582d254c3739ef9d3d3cca87950ca0ee142f12b4 Mon Sep 17 00:00:00 2001 From: jch Date: Tue, 11 Nov 2025 22:04:07 +1100 Subject: [PATCH 20/77] refactor: move 'split' subcommand into separate tool --- tools/amas/amas_split.xml | 103 ++++++++++++++++++++++++++++++++++++++ 1 file changed, 103 insertions(+) create mode 100644 tools/amas/amas_split.xml diff --git a/tools/amas/amas_split.xml b/tools/amas/amas_split.xml new file mode 100644 index 00000000000..c7d5decb6a0 --- /dev/null +++ b/tools/amas/amas_split.xml @@ -0,0 +1,103 @@ + + split multiple alignments + + + macros.xml + + + + amas + + + + + + + + + + + + + + + + + + + + + + + + out_format == "fasta" + + + + + out_format == "phylip" or out_format == "phylip-int" + + + + + out_format == "nexus" or out_format == "nexus-int" + + + + + + + + + + + + + + + + + + + + + + + \ No newline at end of file From bc9bebd4e3abd138b76fa3c29a543a4605d4d363 Mon Sep 17 00:00:00 2001 From: jch Date: Tue, 11 Nov 2025 23:21:54 +1100 Subject: [PATCH 21/77] refactor: change output pattern --- tools/amas/amas_split.xml | 10 +++++----- 1 file changed, 5 insertions(+), 5 deletions(-) diff --git a/tools/amas/amas_split.xml b/tools/amas/amas_split.xml index c7d5decb6a0..449bed8f3b9 100644 --- a/tools/amas/amas_split.xml +++ b/tools/amas/amas_split.xml @@ -53,17 +53,17 @@ - + out_format == "fasta" - + out_format == "phylip" or out_format == "phylip-int" - + out_format == "nexus" or out_format == "nexus-int" @@ -78,8 +78,8 @@ - - + + From dc15ac165c3a28f55a3589cf405778e827151f02 Mon Sep 17 00:00:00 2001 From: jch Date: Tue, 11 Nov 2025 23:30:39 +1100 Subject: [PATCH 22/77] refactor: move 'replicate' subcommand into separate tool --- tools/amas/amas_replicate.xml | 107 ++++++++++++++++++++++++++++++++++ 1 file changed, 107 insertions(+) create mode 100644 tools/amas/amas_replicate.xml diff --git a/tools/amas/amas_replicate.xml b/tools/amas/amas_replicate.xml new file mode 100644 index 00000000000..7229f03f3c0 --- /dev/null +++ b/tools/amas/amas_replicate.xml @@ -0,0 +1,107 @@ + + replicate multiple alignments + + + macros.xml + + + + amas + + + + + + + + + + + + + + + + + + + + + + + + out_format == "fasta" + + + + + out_format == "phylip" or out_format == "phylip-int" + + + + + out_format == "nexus" or out_format == "nexus-int" + + + + + + + + + + + + + + + + + + + + + + + \ No newline at end of file From a279552dcd66dc73578355671bb2d529cae64592 Mon Sep 17 00:00:00 2001 From: jch Date: Tue, 11 Nov 2025 23:35:04 +1100 Subject: [PATCH 23/77] docs: add more help to explain what partitions are --- tools/amas/amas_split.xml | 30 ++++++++++++++++++++++++++++-- 1 file changed, 28 insertions(+), 2 deletions(-) diff --git a/tools/amas/amas_split.xml b/tools/amas/amas_split.xml index 449bed8f3b9..ba223460a20 100644 --- a/tools/amas/amas_split.xml +++ b/tools/amas/amas_split.xml @@ -41,8 +41,9 @@ - - + + @@ -89,6 +90,31 @@ * **split** — divide a concatenated alignment using a partitions file (format `unspecified`, `nexus`, or `raxml`) and optionally drop taxa that are entirely missing within a partition. + **What is a partitions file?** + + A partitions file defines how a concatenated alignment should be split into separate regions (genes, loci, or other features). + + **Format examples:** + + Unspecified format:: + + gene1 = 1-500 + gene2 = 501-1200 + + RAxML format:: + + DNA, gene1 = 1-500 + DNA, gene2 = 501-1200 + + NEXUS format:: + + charset gene1 = 1-500; + charset gene2 = 501-1200; + + An example for your data can be generated using the AMAS concat tool + + Each partition will be written as a separate output file. + Common arguments: 1. `--in-files` (multi-select parameter in Galaxy). From 1d901f5f3126e0236c88330a067447c407549a25 Mon Sep 17 00:00:00 2001 From: jch Date: Wed, 12 Nov 2025 11:10:01 +1100 Subject: [PATCH 24/77] refactor: move 'summary' subcommand into separate tool --- tools/amas/amas_summary.xml | 93 +++++++++++++++++++++++++++++++++++++ 1 file changed, 93 insertions(+) create mode 100644 tools/amas/amas_summary.xml diff --git a/tools/amas/amas_summary.xml b/tools/amas/amas_summary.xml new file mode 100644 index 00000000000..7493525a045 --- /dev/null +++ b/tools/amas/amas_summary.xml @@ -0,0 +1,93 @@ + + summarise multiple alignments + + + macros.xml + + + + amas + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + -seq-summary.txt` files. + + Common arguments: + + 1. `--in-files` (multi-select parameter in Galaxy). + 2. `--in-format` — `fasta`, `phylip`, `nexus`, `phylip-int`, or `nexus-int`. + 3. `--data-type` — `dna` or `aa`. + 4. `--check-align` verifies that sequences are aligned (disabled by default for performance). + + AMAS source code and manual: https://github.com/marekborowiec/AMAS + ]]> + + + \ No newline at end of file From 77241c3d073c89da7ccbaf1d147b8c9ef00565a4 Mon Sep 17 00:00:00 2001 From: jch Date: Wed, 12 Nov 2025 11:30:52 +1100 Subject: [PATCH 25/77] temp: move 'remove' subcommand into separate tool --- tools/amas/amas_remove.xml | 118 +++++++++++++++++++++++++++++++++++++ 1 file changed, 118 insertions(+) create mode 100644 tools/amas/amas_remove.xml diff --git a/tools/amas/amas_remove.xml b/tools/amas/amas_remove.xml new file mode 100644 index 00000000000..469281a3e78 --- /dev/null +++ b/tools/amas/amas_remove.xml @@ -0,0 +1,118 @@ + + remove taxa from multiple alignments + + + macros.xml + + + + amas + + + + + + + + + + + + + + + + + + + + + + + + + + out_format == "fasta" + + + + + out_format == "phylip" or out_format == "phylip-int" + + + + + out_format == "nexus" or out_format == "nexus-int" + + + + + + + + + + + + + + + + + + + + + + + + + + + \ No newline at end of file From 17c02f2a4c0cfac9544ee81433846eebdacc7a9a Mon Sep 17 00:00:00 2001 From: jch Date: Wed, 12 Nov 2025 11:31:34 +1100 Subject: [PATCH 26/77] fix: change version to correct token --- tools/amas/amas_concat.xml | 2 +- tools/amas/amas_replicate.xml | 2 +- tools/amas/amas_split.xml | 2 +- tools/amas/amas_summary.xml | 2 +- tools/amas/macros.xml | 62 +---------------------------------- 5 files changed, 5 insertions(+), 65 deletions(-) diff --git a/tools/amas/amas_concat.xml b/tools/amas/amas_concat.xml index 643f98a137c..89e686d1114 100644 --- a/tools/amas/amas_concat.xml +++ b/tools/amas/amas_concat.xml @@ -1,4 +1,4 @@ - + concatenate multiple alignments diff --git a/tools/amas/amas_replicate.xml b/tools/amas/amas_replicate.xml index 7229f03f3c0..b0e0c0dc660 100644 --- a/tools/amas/amas_replicate.xml +++ b/tools/amas/amas_replicate.xml @@ -1,4 +1,4 @@ - + replicate multiple alignments diff --git a/tools/amas/amas_split.xml b/tools/amas/amas_split.xml index ba223460a20..171b5630e1a 100644 --- a/tools/amas/amas_split.xml +++ b/tools/amas/amas_split.xml @@ -1,4 +1,4 @@ - + split multiple alignments diff --git a/tools/amas/amas_summary.xml b/tools/amas/amas_summary.xml index 7493525a045..49115900f6a 100644 --- a/tools/amas/amas_summary.xml +++ b/tools/amas/amas_summary.xml @@ -1,4 +1,4 @@ - + summarise multiple alignments diff --git a/tools/amas/macros.xml b/tools/amas/macros.xml index 4b09981b1a9..a011fdbf969 100644 --- a/tools/amas/macros.xml +++ b/tools/amas/macros.xml @@ -1,6 +1,6 @@ 1.0 - 1 + 0 @@ -12,66 +12,6 @@ python -m amas.AMAS -h - - - - From 91c5fe30e409cf39c9e6befcf57d2af47378d8d5 Mon Sep 17 00:00:00 2001 From: jch Date: Wed, 12 Nov 2025 11:34:51 +1100 Subject: [PATCH 27/77] refactor: remove redundant xmls --- tools/amas/amas.xml | 177 ------------------------------------------- tools/amas/info.xml | 38 ---------- tools/amas/tests.xml | 166 ---------------------------------------- 3 files changed, 381 deletions(-) delete mode 100644 tools/amas/amas.xml delete mode 100644 tools/amas/info.xml delete mode 100644 tools/amas/tests.xml diff --git a/tools/amas/amas.xml b/tools/amas/amas.xml deleted file mode 100644 index afbbb2edd66..00000000000 --- a/tools/amas/amas.xml +++ /dev/null @@ -1,177 +0,0 @@ - - - High-throughput alignment manipulation and statistics for large phylogenomics - - info.xml - macros.xml - tests.xml - - - - amas - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - action["action_selector"] == "concat" - - - - - - - - - - action["action_selector"] == "concat" - - - - action["action_selector"] == "summary" - - - - action["action_selector"] == "summary" and action.get("by_taxon", False) - - - - - action["action_selector"] == "convert" - - - - - action["action_selector"] == "replicate" - - - - - action["action_selector"] == "split" - - - - - action["action_selector"] == "remove" - - - - - action["action_selector"] == "translate" - - - - - action["action_selector"] == "trim" - - - - - - - - \ No newline at end of file diff --git a/tools/amas/info.xml b/tools/amas/info.xml deleted file mode 100644 index 7340834bb08..00000000000 --- a/tools/amas/info.xml +++ /dev/null @@ -1,38 +0,0 @@ - - - 1.0 - 1 - - - -seq-summary.txt` files. -* **convert** — re-encode each alignment as fasta/phylip/nexus (sequential or interleaved) using AMAS’ native `-out.` naming. -* **replicate** — generate phylogenetic jack-knife replicates by sampling loci; users set the number of replicates and loci per replicate. -* **split** — divide a concatenated alignment using a partitions file (format `unspecified`, `nexus`, or `raxml`) and optionally drop taxa that are entirely missing within a partition. -* **remove** — drop one or more taxa by name, prefixing resulting files with `reduced_` unless a custom prefix is supplied. -* **translate** — translate DNA alignments to amino acids with the chosen NCBI genetic code (1, 2, 3, 4, 5, 6, 9, 10, 11, 12, 13, 14, 16, 21, 22, 23, 24, 25, 26) and reading frame. -* **trim** — prune columns with occupancy below the nominated threshold and optionally retain only parsimony-informative sites (`AMAS trim` behaviour). Output files are named `trimmed_-out.`. - -Common arguments: - -1. `--in-files` (multi-select parameter in Galaxy). -2. `--in-format` — `fasta`, `phylip`, `nexus`, `phylip-int`, or `nexus-int`. -3. `--data-type` — `dna` or `aa`. -4. `--check-align` verifies that sequences are aligned (disabled by default for performance). -5. `--cores` controls the multiprocessing pool used when summarising alignments (set to 1 for deterministic Galaxy tests). - -Regression expectations from the upstream `amas/tests/tests.py` suite (e.g., `summary.txt`, `fasta1.fas-seq-summary.txt`) are bundled under `test-data/outputs/` so this wrapper stays in lock-step with the reference implementation. - -AMAS source code and manual: https://github.com/marekborowiec/AMAS - ]]> - - - - - 10.7717/peerj.1660 - - - \ No newline at end of file diff --git a/tools/amas/tests.xml b/tools/amas/tests.xml deleted file mode 100644 index e7023e0edb9..00000000000 --- a/tools/amas/tests.xml +++ /dev/null @@ -1,166 +0,0 @@ - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - \ No newline at end of file From 62a9bce4e86ea5b112d40a7560f8ab6f95019806 Mon Sep 17 00:00:00 2001 From: jch Date: Wed, 12 Nov 2025 11:42:42 +1100 Subject: [PATCH 28/77] refactor: remove/add reused/redundant macros --- tools/amas/amas_concat.xml | 8 +++++++- tools/amas/amas_remove.xml | 15 +-------------- tools/amas/amas_replicate.xml | 17 ++--------------- tools/amas/amas_split.xml | 15 +-------------- tools/amas/macros.xml | 23 +++++++++++++++-------- 5 files changed, 26 insertions(+), 52 deletions(-) diff --git a/tools/amas/amas_concat.xml b/tools/amas/amas_concat.xml index 89e686d1114..6d69ba4b006 100644 --- a/tools/amas/amas_concat.xml +++ b/tools/amas/amas_concat.xml @@ -63,7 +63,13 @@ - + + + + + + + diff --git a/tools/amas/amas_remove.xml b/tools/amas/amas_remove.xml index 469281a3e78..8729ef75945 100644 --- a/tools/amas/amas_remove.xml +++ b/tools/amas/amas_remove.xml @@ -63,20 +63,7 @@ - - - out_format == "fasta" - - - - - out_format == "phylip" or out_format == "phylip-int" - - - - - out_format == "nexus" or out_format == "nexus-int" - + diff --git a/tools/amas/amas_replicate.xml b/tools/amas/amas_replicate.xml index b0e0c0dc660..7e25c094e64 100644 --- a/tools/amas/amas_replicate.xml +++ b/tools/amas/amas_replicate.xml @@ -56,22 +56,9 @@ - - - out_format == "fasta" - - - - - out_format == "phylip" or out_format == "phylip-int" - - - - - out_format == "nexus" or out_format == "nexus-int" - + - + diff --git a/tools/amas/amas_split.xml b/tools/amas/amas_split.xml index 171b5630e1a..a6160f374fb 100644 --- a/tools/amas/amas_split.xml +++ b/tools/amas/amas_split.xml @@ -53,20 +53,7 @@ - - - out_format == "fasta" - - - - - out_format == "phylip" or out_format == "phylip-int" - - - - - out_format == "nexus" or out_format == "nexus-int" - + diff --git a/tools/amas/macros.xml b/tools/amas/macros.xml index a011fdbf969..b48fa85f92c 100644 --- a/tools/amas/macros.xml +++ b/tools/amas/macros.xml @@ -32,14 +32,21 @@ - - - - - - - - + + + + out_format == "fasta" + + + + + out_format == "phylip" or out_format == "phylip-int" + + + + + out_format == "nexus" or out_format == "nexus-int" + From a12ab968f1030b03b195dbb2e266de970eda8723 Mon Sep 17 00:00:00 2001 From: jch Date: Wed, 12 Nov 2025 12:06:12 +1100 Subject: [PATCH 29/77] docs: update help/documentation --- tools/amas/amas_concat.xml | 62 +++++++++++++++++++++++++++++------ tools/amas/amas_remove.xml | 42 ++++++++++++++++-------- tools/amas/amas_replicate.xml | 40 +++++++++++++++++----- tools/amas/amas_split.xml | 42 +++++++++++++++++------- tools/amas/amas_summary.xml | 49 ++++++++++++++++++++++----- tools/amas/macros.xml | 1 - 6 files changed, 182 insertions(+), 54 deletions(-) diff --git a/tools/amas/amas_concat.xml b/tools/amas/amas_concat.xml index 6d69ba4b006..cbf891bca1b 100644 --- a/tools/amas/amas_concat.xml +++ b/tools/amas/amas_concat.xml @@ -46,10 +46,12 @@ ]]> - + - + @@ -98,18 +100,58 @@ diff --git a/tools/amas/amas_remove.xml b/tools/amas/amas_remove.xml index 8729ef75945..aa4ee03c83f 100644 --- a/tools/amas/amas_remove.xml +++ b/tools/amas/amas_remove.xml @@ -29,7 +29,6 @@ python -m amas.AMAS remove - --out-prefix '$out_prefix' --out-format $out_format --taxa-to-remove #for $taxon in $taxa_to_remove @@ -48,13 +47,13 @@ ]]> - + - @@ -75,30 +74,47 @@ - - + diff --git a/tools/amas/amas_replicate.xml b/tools/amas/amas_replicate.xml index 7e25c094e64..9edbad3a167 100644 --- a/tools/amas/amas_replicate.xml +++ b/tools/amas/amas_replicate.xml @@ -58,7 +58,7 @@ - + @@ -76,18 +76,40 @@ diff --git a/tools/amas/amas_split.xml b/tools/amas/amas_split.xml index a6160f374fb..713b0056224 100644 --- a/tools/amas/amas_split.xml +++ b/tools/amas/amas_split.xml @@ -39,7 +39,7 @@ ]]> - + diff --git a/tools/amas/amas_summary.xml b/tools/amas/amas_summary.xml index 49115900f6a..955fbf46e08 100644 --- a/tools/amas/amas_summary.xml +++ b/tools/amas/amas_summary.xml @@ -42,7 +42,8 @@ ]]> - + @@ -75,18 +76,48 @@ -seq-summary.txt` files. + AMAS Summary calculates comprehensive statistics for sequence alignments, providing quality control metrics essential for phylogenomic analyses. - Common arguments: + **Inputs** - 1. `--in-files` (multi-select parameter in Galaxy). - 2. `--in-format` — `fasta`, `phylip`, `nexus`, `phylip-int`, or `nexus-int`. - 3. `--data-type` — `dna` or `aa`. - 4. `--check-align` verifies that sequences are aligned (disabled by default for performance). + - **Alignment files**: One or more pre-aligned sequence files (FASTA, PHYLIP, or NEXUS format) + - **Input format**: Specify the format of your input files + - **Data type**: Choose DNA for nucleotide sequences or Protein for amino acid sequences + - **Generate per-taxon summaries**: Optionally create detailed statistics for each sequence - AMAS source code and manual: https://github.com/marekborowiec/AMAS + **Outputs** + + 1. **Summary table** (``summary.txt``): Overall statistics for each alignment including: + - Number of taxa and alignment length + - Total matrix cells and proportion of missing data + - Variable sites and parsimony-informative sites + - GC content (DNA) or amino acid composition (protein) + + 2. **Per-taxon summaries** (optional): Individual statistics for each sequence showing taxon-specific missing data and character frequencies + + **Statistics explained** + + - **Variable sites**: Positions with more than one character state (measures sequence diversity) + - **Parsimony-informative sites**: Positions useful for phylogenetic inference (at least 2 taxa share each of 2+ states) + - **Missing data**: Proportion of gaps, N's (DNA), or X's (protein) + - **Matrix completeness**: Percentage of positions with actual sequence data + + **Use cases** + + - **Quality control**: Identify alignments with excessive missing data + - **Alignment comparison**: Compare statistics across multiple genes/loci + - **Taxon filtering**: Find sequences with poor coverage + - **Publication reporting**: Generate standardized alignment statistics for methods sections + + **About AMAS** + + AMAS (Alignment Manipulation And Summary) is designed for modern phylogenomics workflows involving hundreds of taxa and thousands of loci. + + Citation: Borowiec ML. 2016. AMAS: a fast tool for alignment manipulation and computing of summary statistics. PeerJ 4:e1660 + + Source code and manual: https://github.com/marekborowiec/AMAS ]]> diff --git a/tools/amas/macros.xml b/tools/amas/macros.xml index b48fa85f92c..a7969158798 100644 --- a/tools/amas/macros.xml +++ b/tools/amas/macros.xml @@ -54,5 +54,4 @@ 10.7717/peerj.1660 - \ No newline at end of file From f071907815d50dbe155f744383e1e20ea5650a39 Mon Sep 17 00:00:00 2001 From: jch Date: Wed, 12 Nov 2025 12:07:19 +1100 Subject: [PATCH 30/77] docs: update help --- tools/amas/amas_replicate.xml | 3 ++- 1 file changed, 2 insertions(+), 1 deletion(-) diff --git a/tools/amas/amas_replicate.xml b/tools/amas/amas_replicate.xml index 9edbad3a167..2e31ac712ab 100644 --- a/tools/amas/amas_replicate.xml +++ b/tools/amas/amas_replicate.xml @@ -43,7 +43,8 @@ ]]> - + From 0bb5c40843a54e5d1bd163f18f4cc8f8b96ae952 Mon Sep 17 00:00:00 2001 From: jch Date: Wed, 12 Nov 2025 12:07:47 +1100 Subject: [PATCH 31/77] test: remove tests no longer needed --- tools/amas/test-data/inputs/aa_alignment1.faa | 6 ------ tools/amas/test-data/inputs/aa_alignment1.int-phy | 6 ------ tools/amas/test-data/inputs/aa_alignment2.faa | 6 ------ tools/amas/test-data/inputs/aa_alignment2.int-phy | 6 ------ tools/amas/test-data/inputs/translate_input.fas | 6 ------ tools/amas/test-data/inputs/trim_input.fas | 8 -------- .../outputs/expected_convert_aa_alignment1.int-nex | 14 -------------- .../outputs/expected_convert_aa_alignment2.int-nex | 14 -------------- .../outputs/expected_translate_phylip.phy | 4 ---- .../outputs/expected_trimmed_phylip_int.int-phy | 2 -- 10 files changed, 72 deletions(-) delete mode 100644 tools/amas/test-data/inputs/aa_alignment1.faa delete mode 100644 tools/amas/test-data/inputs/aa_alignment1.int-phy delete mode 100644 tools/amas/test-data/inputs/aa_alignment2.faa delete mode 100644 tools/amas/test-data/inputs/aa_alignment2.int-phy delete mode 100644 tools/amas/test-data/inputs/translate_input.fas delete mode 100644 tools/amas/test-data/inputs/trim_input.fas delete mode 100644 tools/amas/test-data/outputs/expected_convert_aa_alignment1.int-nex delete mode 100644 tools/amas/test-data/outputs/expected_convert_aa_alignment2.int-nex delete mode 100644 tools/amas/test-data/outputs/expected_translate_phylip.phy delete mode 100644 tools/amas/test-data/outputs/expected_trimmed_phylip_int.int-phy diff --git a/tools/amas/test-data/inputs/aa_alignment1.faa b/tools/amas/test-data/inputs/aa_alignment1.faa deleted file mode 100644 index f292704cace..00000000000 --- a/tools/amas/test-data/inputs/aa_alignment1.faa +++ /dev/null @@ -1,6 +0,0 @@ ->Spec1 -ACDEFGHIKLMN ->Spec2 -ACDEYGHIKLMN ->Spec3 -ACDEFGHIKLMQ diff --git a/tools/amas/test-data/inputs/aa_alignment1.int-phy b/tools/amas/test-data/inputs/aa_alignment1.int-phy deleted file mode 100644 index aab718f6ef2..00000000000 --- a/tools/amas/test-data/inputs/aa_alignment1.int-phy +++ /dev/null @@ -1,6 +0,0 @@ -3 12 - -Spec1 ACDEFGHIKLMN -Spec2 ACDEYGHIKLMN -Spec3 ACDEFGHIKLMQ - diff --git a/tools/amas/test-data/inputs/aa_alignment2.faa b/tools/amas/test-data/inputs/aa_alignment2.faa deleted file mode 100644 index 270fd2004f5..00000000000 --- a/tools/amas/test-data/inputs/aa_alignment2.faa +++ /dev/null @@ -1,6 +0,0 @@ ->SpecA -MSTNPKPQRKST ->SpecB -MSTNPKPQRKSA ->SpecC -MSTDPKPQRKST diff --git a/tools/amas/test-data/inputs/aa_alignment2.int-phy b/tools/amas/test-data/inputs/aa_alignment2.int-phy deleted file mode 100644 index c9713e7b469..00000000000 --- a/tools/amas/test-data/inputs/aa_alignment2.int-phy +++ /dev/null @@ -1,6 +0,0 @@ -3 12 - -SpecA MSTNPKPQRKST -SpecB MSTNPKPQRKSA -SpecC MSTDPKPQRKST - diff --git a/tools/amas/test-data/inputs/translate_input.fas b/tools/amas/test-data/inputs/translate_input.fas deleted file mode 100644 index b202aeafcd9..00000000000 --- a/tools/amas/test-data/inputs/translate_input.fas +++ /dev/null @@ -1,6 +0,0 @@ ->Seq1 -ATGGCCTTTAAA ->Seq2 -ATGGCCCTTAAC ->Seq3 -ATGGCCCTTAAA diff --git a/tools/amas/test-data/inputs/trim_input.fas b/tools/amas/test-data/inputs/trim_input.fas deleted file mode 100644 index d9d6aa4735d..00000000000 --- a/tools/amas/test-data/inputs/trim_input.fas +++ /dev/null @@ -1,8 +0,0 @@ ->tax1 -ACGTACGT---- ->tax2 -A-GTAC-TNNNN ->tax3 -AC-TACGT---- ->tax4 -----ACGTACGT diff --git a/tools/amas/test-data/outputs/expected_convert_aa_alignment1.int-nex b/tools/amas/test-data/outputs/expected_convert_aa_alignment1.int-nex deleted file mode 100644 index 0c86475ab11..00000000000 --- a/tools/amas/test-data/outputs/expected_convert_aa_alignment1.int-nex +++ /dev/null @@ -1,14 +0,0 @@ -#NEXUS - -BEGIN DATA; - DIMENSIONS NTAX=3 NCHAR=12; - FORMAT INTERLEAVE DATATYPE=PROTEIN GAP = - MISSING = ?; - MATRIX -Spec1 ACDEFGHIKLMN -Spec2 ACDEYGHIKLMN -Spec3 ACDEFGHIKLMQ - - -; - -END; \ No newline at end of file diff --git a/tools/amas/test-data/outputs/expected_convert_aa_alignment2.int-nex b/tools/amas/test-data/outputs/expected_convert_aa_alignment2.int-nex deleted file mode 100644 index 97a214415db..00000000000 --- a/tools/amas/test-data/outputs/expected_convert_aa_alignment2.int-nex +++ /dev/null @@ -1,14 +0,0 @@ -#NEXUS - -BEGIN DATA; - DIMENSIONS NTAX=3 NCHAR=12; - FORMAT INTERLEAVE DATATYPE=PROTEIN GAP = - MISSING = ?; - MATRIX -SpecA MSTNPKPQRKST -SpecB MSTNPKPQRKSA -SpecC MSTDPKPQRKST - - -; - -END; \ No newline at end of file diff --git a/tools/amas/test-data/outputs/expected_translate_phylip.phy b/tools/amas/test-data/outputs/expected_translate_phylip.phy deleted file mode 100644 index 455afa97d8d..00000000000 --- a/tools/amas/test-data/outputs/expected_translate_phylip.phy +++ /dev/null @@ -1,4 +0,0 @@ -3 3 -Seq1 WPL -Seq2 WPL -Seq3 WPL diff --git a/tools/amas/test-data/outputs/expected_trimmed_phylip_int.int-phy b/tools/amas/test-data/outputs/expected_trimmed_phylip_int.int-phy deleted file mode 100644 index 0e4ab097844..00000000000 --- a/tools/amas/test-data/outputs/expected_trimmed_phylip_int.int-phy +++ /dev/null @@ -1,2 +0,0 @@ -4 0 - From 653c992d0ff20a2de0aeac7325b76ae3b2f75069 Mon Sep 17 00:00:00 2001 From: jch Date: Wed, 12 Nov 2025 12:20:29 +1100 Subject: [PATCH 32/77] refactor: change 'remove' repeat to text + regex validator --- tools/amas/amas_remove.xml | 21 ++++++++------------- 1 file changed, 8 insertions(+), 13 deletions(-) diff --git a/tools/amas/amas_remove.xml b/tools/amas/amas_remove.xml index aa4ee03c83f..537c8df7432 100644 --- a/tools/amas/amas_remove.xml +++ b/tools/amas/amas_remove.xml @@ -29,10 +29,9 @@ python -m amas.AMAS remove - --out-format $out_format --taxa-to-remove - #for $taxon in $taxa_to_remove - '$taxon.taxon' + #for $taxon in $taxa_to_remove.split() + '$taxon' #end for --out-format $out_format --in-files @@ -51,9 +50,10 @@ help="Provide pre-aligned FASTA/PHYLIP/NEXUS files (DNA or protein); mixes of unaligned reads or contigs will produce meaningless results." /> - - - + + [A-Za-z0-9_.\-]+(\s+[A-Za-z0-9_.\-]+)* + @@ -68,12 +68,7 @@ - - - - - - + @@ -92,7 +87,7 @@ **Inputs** - **Alignment files**: One or more pre-aligned sequence files (FASTA, PHYLIP, or NEXUS format) - - **Taxa to remove**: List of sequence names to exclude (one per line) + - **Taxa to remove**: Space-separated list of sequence names to exclude (e.g., 'OTU9 OTU10 Sample_A') - **Input format**: Specify the format of your input files - **Data type**: Choose DNA for nucleotide sequences or Protein for amino acid sequences - **Output format**: Select the desired format for the reduced alignments From 178d5cc3d6574e205f8c3bcbfe21cf1e13ee8251 Mon Sep 17 00:00:00 2001 From: jch Date: Wed, 12 Nov 2025 12:22:06 +1100 Subject: [PATCH 33/77] fix: fix misplaced end param tag --- tools/amas/amas_concat.xml | 2 +- 1 file changed, 1 insertion(+), 1 deletion(-) diff --git a/tools/amas/amas_concat.xml b/tools/amas/amas_concat.xml index cbf891bca1b..bc2ac72407f 100644 --- a/tools/amas/amas_concat.xml +++ b/tools/amas/amas_concat.xml @@ -51,7 +51,7 @@ + help="A file defining how the concatenated alignment is split into separate gene/locus regions. Each line specifies a partition name and its position range (e.g., 'gene1 = 1-500' or 'DNA, gene1 = 1-500' for RAxML format)."> From 81cbb66d7c863d8c402583d606a513ce8b0523a1 Mon Sep 17 00:00:00 2001 From: jch Date: Wed, 12 Nov 2025 12:27:43 +1100 Subject: [PATCH 34/77] docs: updated help for 'remove' --- tools/amas/amas_remove.xml | 2 ++ 1 file changed, 2 insertions(+) diff --git a/tools/amas/amas_remove.xml b/tools/amas/amas_remove.xml index 537c8df7432..92092f44206 100644 --- a/tools/amas/amas_remove.xml +++ b/tools/amas/amas_remove.xml @@ -96,6 +96,8 @@ A collection of alignment files with specified taxa removed. Each output file contains the same alignment as the input, minus the excluded sequences. + **Tip:** You may want to realign your files after taxon removal. + **Use cases** - Remove sequences with excessive missing data From 8f32f1d2e3a1c41953150d76c12da9f99ae202dd Mon Sep 17 00:00:00 2001 From: jch Date: Wed, 12 Nov 2025 12:49:30 +1100 Subject: [PATCH 35/77] docs: update help info --- tools/amas/amas_concat.xml | 4 ++-- tools/amas/amas_remove.xml | 9 +++++---- tools/amas/amas_replicate.xml | 4 +--- tools/amas/amas_split.xml | 4 +--- tools/amas/amas_summary.xml | 4 +--- 5 files changed, 10 insertions(+), 15 deletions(-) diff --git a/tools/amas/amas_concat.xml b/tools/amas/amas_concat.xml index bc2ac72407f..5cff7ca0c21 100644 --- a/tools/amas/amas_concat.xml +++ b/tools/amas/amas_concat.xml @@ -102,7 +102,7 @@ diff --git a/tools/amas/amas_remove.xml b/tools/amas/amas_remove.xml index 92092f44206..72d083dec71 100644 --- a/tools/amas/amas_remove.xml +++ b/tools/amas/amas_remove.xml @@ -51,7 +51,7 @@ + help="Space-separated list of taxon names to remove (e.g., 'OTU9 OTU10 Sample_A'). Note: AMAS converts spaces to underscores and strips quotes from sequence names, so use 'Species_1' to remove a taxon named 'Species 1'."> [A-Za-z0-9_.\-]+(\s+[A-Za-z0-9_.\-]+)* @@ -88,6 +88,9 @@ - **Alignment files**: One or more pre-aligned sequence files (FASTA, PHYLIP, or NEXUS format) - **Taxa to remove**: Space-separated list of sequence names to exclude (e.g., 'OTU9 OTU10 Sample_A') + + **Important**: AMAS converts spaces to underscores and strips quotes from sequence names during processing. If your input file contains a taxon named 'Species 1' or '"Species 1"', you must specify it as 'Species_1' in the taxa to remove list. + - **Input format**: Specify the format of your input files - **Data type**: Choose DNA for nucleotide sequences or Protein for amino acid sequences - **Output format**: Select the desired format for the reduced alignments @@ -107,9 +110,7 @@ **About AMAS** - AMAS (Alignment Manipulation And Summary) is designed for modern phylogenomics workflows involving hundreds of taxa and thousands of loci. - - Citation: Borowiec ML. 2016. AMAS: a fast tool for alignment manipulation and computing of summary statistics. PeerJ 4:e1660 + AMAS (Alignment manipulation and summary statistics) is designed for modern phylogenomics workflows involving hundreds of taxa and thousands of loci. Source code and manual: https://github.com/marekborowiec/AMAS ]]> diff --git a/tools/amas/amas_replicate.xml b/tools/amas/amas_replicate.xml index 2e31ac712ab..77b18e59d0f 100644 --- a/tools/amas/amas_replicate.xml +++ b/tools/amas/amas_replicate.xml @@ -106,9 +106,7 @@ **About AMAS** - AMAS (Alignment Manipulation And Summary) is designed for modern phylogenomics workflows involving hundreds of taxa and thousands of loci. - - Citation: Borowiec ML. 2016. AMAS: a fast tool for alignment manipulation and computing of summary statistics. PeerJ 4:e1660 + AMAS (Alignment manipulation and summary statistics) is designed for modern phylogenomics workflows involving hundreds of taxa and thousands of loci. Source code and manual: https://github.com/marekborowiec/AMAS ]]> diff --git a/tools/amas/amas_split.xml b/tools/amas/amas_split.xml index 713b0056224..e761144ef65 100644 --- a/tools/amas/amas_split.xml +++ b/tools/amas/amas_split.xml @@ -123,9 +123,7 @@ **About AMAS** - AMAS (Alignment Manipulation And Summary) is designed for modern phylogenomics workflows involving hundreds of taxa and thousands of loci. - - Citation: Borowiec ML. 2016. AMAS: a fast tool for alignment manipulation and computing of summary statistics. PeerJ 4:e1660 + AMAS (Alignment manipulation and summary statistics) is designed for modern phylogenomics workflows involving hundreds of taxa and thousands of loci. Source code and manual: https://github.com/marekborowiec/AMAS ]]> diff --git a/tools/amas/amas_summary.xml b/tools/amas/amas_summary.xml index 955fbf46e08..78fd20a868c 100644 --- a/tools/amas/amas_summary.xml +++ b/tools/amas/amas_summary.xml @@ -113,9 +113,7 @@ **About AMAS** - AMAS (Alignment Manipulation And Summary) is designed for modern phylogenomics workflows involving hundreds of taxa and thousands of loci. - - Citation: Borowiec ML. 2016. AMAS: a fast tool for alignment manipulation and computing of summary statistics. PeerJ 4:e1660 + AMAS (Alignment manipulation and summary statistics) is designed for modern phylogenomics workflows involving hundreds of taxa and thousands of loci. Source code and manual: https://github.com/marekborowiec/AMAS ]]> From 46502d39dcb324dc32868681e0b44372d798ec2d Mon Sep 17 00:00:00 2001 From: jch Date: Wed, 12 Nov 2025 13:46:39 +1100 Subject: [PATCH 36/77] refactor: add profile token to macro; replace in subcommands --- tools/amas/amas_concat.xml | 2 +- tools/amas/amas_remove.xml | 2 +- tools/amas/amas_replicate.xml | 2 +- tools/amas/amas_split.xml | 2 +- tools/amas/amas_summary.xml | 6 +++--- tools/amas/macros.xml | 1 + 6 files changed, 8 insertions(+), 7 deletions(-) diff --git a/tools/amas/amas_concat.xml b/tools/amas/amas_concat.xml index 5cff7ca0c21..64e9e7cc99e 100644 --- a/tools/amas/amas_concat.xml +++ b/tools/amas/amas_concat.xml @@ -1,4 +1,4 @@ - + concatenate multiple alignments diff --git a/tools/amas/amas_remove.xml b/tools/amas/amas_remove.xml index 72d083dec71..43ee8f500eb 100644 --- a/tools/amas/amas_remove.xml +++ b/tools/amas/amas_remove.xml @@ -1,4 +1,4 @@ - + remove taxa from multiple alignments diff --git a/tools/amas/amas_replicate.xml b/tools/amas/amas_replicate.xml index 77b18e59d0f..faea66bea93 100644 --- a/tools/amas/amas_replicate.xml +++ b/tools/amas/amas_replicate.xml @@ -1,4 +1,4 @@ - + replicate multiple alignments diff --git a/tools/amas/amas_split.xml b/tools/amas/amas_split.xml index e761144ef65..37af2b7a9c5 100644 --- a/tools/amas/amas_split.xml +++ b/tools/amas/amas_split.xml @@ -1,4 +1,4 @@ - + split multiple alignments diff --git a/tools/amas/amas_summary.xml b/tools/amas/amas_summary.xml index 78fd20a868c..ca8f4783004 100644 --- a/tools/amas/amas_summary.xml +++ b/tools/amas/amas_summary.xml @@ -1,4 +1,4 @@ - + summarise multiple alignments @@ -38,7 +38,7 @@ --in-format $in_format --data-type $data_type --cores "\${GALAXY_SLOTS:-1}" - $check_align + $--check_align ]]> @@ -50,7 +50,7 @@ - + diff --git a/tools/amas/macros.xml b/tools/amas/macros.xml index a7969158798..647d5d3139a 100644 --- a/tools/amas/macros.xml +++ b/tools/amas/macros.xml @@ -1,6 +1,7 @@ 1.0 0 + 25.0 From 587bb5de01c15867ad6272c0a8080e2ae7eafa78 Mon Sep 17 00:00:00 2001 From: jch Date: Wed, 12 Nov 2025 14:20:04 +1100 Subject: [PATCH 37/77] refactor: change param 'name' to 'argument' for 'boolean' --- tools/amas/amas_concat.xml | 2 +- tools/amas/amas_remove.xml | 2 +- tools/amas/amas_replicate.xml | 2 +- tools/amas/amas_split.xml | 4 ++-- tools/amas/amas_summary.xml | 6 +++--- 5 files changed, 8 insertions(+), 8 deletions(-) diff --git a/tools/amas/amas_concat.xml b/tools/amas/amas_concat.xml index 64e9e7cc99e..fb9ecac09a5 100644 --- a/tools/amas/amas_concat.xml +++ b/tools/amas/amas_concat.xml @@ -60,7 +60,7 @@ - + diff --git a/tools/amas/amas_remove.xml b/tools/amas/amas_remove.xml index 43ee8f500eb..01e56b4b414 100644 --- a/tools/amas/amas_remove.xml +++ b/tools/amas/amas_remove.xml @@ -58,7 +58,7 @@ - + diff --git a/tools/amas/amas_replicate.xml b/tools/amas/amas_replicate.xml index faea66bea93..9eec127765d 100644 --- a/tools/amas/amas_replicate.xml +++ b/tools/amas/amas_replicate.xml @@ -53,7 +53,7 @@ - + diff --git a/tools/amas/amas_split.xml b/tools/amas/amas_split.xml index 37af2b7a9c5..77bb0acb91f 100644 --- a/tools/amas/amas_split.xml +++ b/tools/amas/amas_split.xml @@ -44,12 +44,12 @@ - + - + diff --git a/tools/amas/amas_summary.xml b/tools/amas/amas_summary.xml index ca8f4783004..eba9848834a 100644 --- a/tools/amas/amas_summary.xml +++ b/tools/amas/amas_summary.xml @@ -38,19 +38,19 @@ --in-format $in_format --data-type $data_type --cores "\${GALAXY_SLOTS:-1}" - $--check_align + $check_align ]]> - + - + From 6fc566f884759261d9638f5338c81c601479a41e Mon Sep 17 00:00:00 2001 From: jch Date: Wed, 12 Nov 2025 14:41:55 +1100 Subject: [PATCH 38/77] docs: rename output label so that it is more user friendly --- tools/amas/amas_concat.xml | 2 +- tools/amas/amas_remove.xml | 4 ++-- tools/amas/amas_replicate.xml | 4 ++-- tools/amas/amas_split.xml | 6 +++--- tools/amas/macros.xml | 2 +- 5 files changed, 9 insertions(+), 9 deletions(-) diff --git a/tools/amas/amas_concat.xml b/tools/amas/amas_concat.xml index fb9ecac09a5..e704fdc189e 100644 --- a/tools/amas/amas_concat.xml +++ b/tools/amas/amas_concat.xml @@ -49,7 +49,7 @@ - + diff --git a/tools/amas/amas_remove.xml b/tools/amas/amas_remove.xml index 01e56b4b414..eb8401513d8 100644 --- a/tools/amas/amas_remove.xml +++ b/tools/amas/amas_remove.xml @@ -48,8 +48,8 @@ - - + + [A-Za-z0-9_.\-]+(\s+[A-Za-z0-9_.\-]+)* diff --git a/tools/amas/amas_replicate.xml b/tools/amas/amas_replicate.xml index 9eec127765d..78e571a0461 100644 --- a/tools/amas/amas_replicate.xml +++ b/tools/amas/amas_replicate.xml @@ -45,8 +45,8 @@ - - + + diff --git a/tools/amas/amas_split.xml b/tools/amas/amas_split.xml index 77bb0acb91f..797fd7cbfe4 100644 --- a/tools/amas/amas_split.xml +++ b/tools/amas/amas_split.xml @@ -41,8 +41,8 @@ - - + @@ -112,7 +112,7 @@ charset gene1 = 1-500; charset gene2 = 501-1200; - **Tip:** An example for your data can be generated using the AMAS Concat tool. + **Tip:** An example for your data can be generated using the AMAS concat tool. **Use cases** diff --git a/tools/amas/macros.xml b/tools/amas/macros.xml index 647d5d3139a..99dcb1c0309 100644 --- a/tools/amas/macros.xml +++ b/tools/amas/macros.xml @@ -24,7 +24,7 @@ - + From 5809b0a4b5b694ab7dd2f3727288d7cc1da6d9e0 Mon Sep 17 00:00:00 2001 From: jch Date: Wed, 12 Nov 2025 14:49:18 +1100 Subject: [PATCH 39/77] Revert "docs: rename output label so that it is more user friendly" This reverts commit 6fc566f884759261d9638f5338c81c601479a41e. --- tools/amas/amas_concat.xml | 2 +- tools/amas/amas_remove.xml | 4 ++-- tools/amas/amas_replicate.xml | 4 ++-- tools/amas/amas_split.xml | 6 +++--- tools/amas/macros.xml | 2 +- 5 files changed, 9 insertions(+), 9 deletions(-) diff --git a/tools/amas/amas_concat.xml b/tools/amas/amas_concat.xml index e704fdc189e..fb9ecac09a5 100644 --- a/tools/amas/amas_concat.xml +++ b/tools/amas/amas_concat.xml @@ -49,7 +49,7 @@ - + diff --git a/tools/amas/amas_remove.xml b/tools/amas/amas_remove.xml index eb8401513d8..01e56b4b414 100644 --- a/tools/amas/amas_remove.xml +++ b/tools/amas/amas_remove.xml @@ -48,8 +48,8 @@ - - + + [A-Za-z0-9_.\-]+(\s+[A-Za-z0-9_.\-]+)* diff --git a/tools/amas/amas_replicate.xml b/tools/amas/amas_replicate.xml index 78e571a0461..9eec127765d 100644 --- a/tools/amas/amas_replicate.xml +++ b/tools/amas/amas_replicate.xml @@ -45,8 +45,8 @@ - - + + diff --git a/tools/amas/amas_split.xml b/tools/amas/amas_split.xml index 797fd7cbfe4..77bb0acb91f 100644 --- a/tools/amas/amas_split.xml +++ b/tools/amas/amas_split.xml @@ -41,8 +41,8 @@ - - + @@ -112,7 +112,7 @@ charset gene1 = 1-500; charset gene2 = 501-1200; - **Tip:** An example for your data can be generated using the AMAS concat tool. + **Tip:** An example for your data can be generated using the AMAS Concat tool. **Use cases** diff --git a/tools/amas/macros.xml b/tools/amas/macros.xml index 99dcb1c0309..647d5d3139a 100644 --- a/tools/amas/macros.xml +++ b/tools/amas/macros.xml @@ -24,7 +24,7 @@ - + From e2de21ba5d76cf1854139bd2b1c0737901183e79 Mon Sep 17 00:00:00 2001 From: jch Date: Wed, 12 Nov 2025 14:58:47 +1100 Subject: [PATCH 40/77] docs: rename output label so that it is more user friendly --- tools/amas/amas_concat.xml | 2 +- tools/amas/amas_remove.xml | 4 ++-- tools/amas/amas_replicate.xml | 4 ++-- tools/amas/amas_split.xml | 6 +++--- 4 files changed, 8 insertions(+), 8 deletions(-) diff --git a/tools/amas/amas_concat.xml b/tools/amas/amas_concat.xml index fb9ecac09a5..a8f766019b4 100644 --- a/tools/amas/amas_concat.xml +++ b/tools/amas/amas_concat.xml @@ -49,7 +49,7 @@ - + diff --git a/tools/amas/amas_remove.xml b/tools/amas/amas_remove.xml index 01e56b4b414..f10d08e4bbf 100644 --- a/tools/amas/amas_remove.xml +++ b/tools/amas/amas_remove.xml @@ -48,8 +48,8 @@ - - + + [A-Za-z0-9_.\-]+(\s+[A-Za-z0-9_.\-]+)* diff --git a/tools/amas/amas_replicate.xml b/tools/amas/amas_replicate.xml index 9eec127765d..10606324788 100644 --- a/tools/amas/amas_replicate.xml +++ b/tools/amas/amas_replicate.xml @@ -45,8 +45,8 @@ - - + + diff --git a/tools/amas/amas_split.xml b/tools/amas/amas_split.xml index 77bb0acb91f..2162b23fa0b 100644 --- a/tools/amas/amas_split.xml +++ b/tools/amas/amas_split.xml @@ -41,8 +41,8 @@ - - + @@ -112,7 +112,7 @@ charset gene1 = 1-500; charset gene2 = 501-1200; - **Tip:** An example for your data can be generated using the AMAS Concat tool. + **Tip:** An example for your data can be generated using the AMAS concat tool. **Use cases** From b3c6135a9495d72324bd87d511a824d5446e8170 Mon Sep 17 00:00:00 2001 From: jch Date: Mon, 17 Nov 2025 12:45:54 +1100 Subject: [PATCH 41/77] docs: add auto_tool_repositories and suite to shed.yml --- tools/amas/.shed.yml | 10 +++++++++- 1 file changed, 9 insertions(+), 1 deletion(-) diff --git a/tools/amas/.shed.yml b/tools/amas/.shed.yml index 61761aa5a15..5753399e060 100644 --- a/tools/amas/.shed.yml +++ b/tools/amas/.shed.yml @@ -8,4 +8,12 @@ long_description: Handle expansive phylogenomic data sets by concatenating, remo replicating, splitting, and summarising large nucleotide or amino acid alignments. name: amas owner: iuc -remote_repository_url: https://github.com/galaxyproject/tools-iuc/tree/main/tools/amas \ No newline at end of file +remote_repository_url: https://github.com/galaxyproject/tools-iuc/tree/main/tools/amas +auto_tool_repositories: + name_template: "{{ tool_id }}" + description_template: "Wrapper for amas functions: {{ tool_name }}." +suite: + name: "suite_amas" + description: "A suite of tools that brings the amas project into Galaxy." + long_description: Handle expansive phylogenomic data sets by concatenating, removing, + replicating, splitting, and summarising large nucleotide or amino acid alignments. \ No newline at end of file From 4b43895c6d758228b3d573f372b93c33e1523b58 Mon Sep 17 00:00:00 2001 From: jch Date: Mon, 17 Nov 2025 13:44:00 +1100 Subject: [PATCH 42/77] refactor: run everything in ./; added ftype to tests --- tools/amas/amas_concat.xml | 28 +++++++++++++++------------- tools/amas/amas_remove.xml | 9 ++------- tools/amas/amas_replicate.xml | 11 +++-------- tools/amas/amas_split.xml | 19 +++++++++---------- tools/amas/amas_summary.xml | 13 ++++--------- tools/amas/macros.xml | 6 +++--- 6 files changed, 36 insertions(+), 50 deletions(-) diff --git a/tools/amas/amas_concat.xml b/tools/amas/amas_concat.xml index a8f766019b4..f09d66c9c43 100644 --- a/tools/amas/amas_concat.xml +++ b/tools/amas/amas_concat.xml @@ -16,18 +16,13 @@ #import re set -eu; - rm -rf "run_dir/action"; - mkdir -p "run_dir/action"; - ## Create symlinks with original filename for consistent tests because ## input filenames are used as str vars in the partitions.txt output #for $f in $input_files #set $safename_input = re.sub('[^\w\-_\.]', '_', $f.element_identifier) - ln -s '${f}' "run_dir/action/${safename_input}"; + ln -s '${f}' '${safename_input}'; #end for - cd "run_dir/action"; - python -m amas.AMAS concat --concat-part partitions.txt @@ -64,7 +59,7 @@ - + @@ -73,7 +68,7 @@ - + @@ -84,8 +79,8 @@ - - + + @@ -94,8 +89,8 @@ - - + + @@ -137,7 +132,14 @@ - **Unspecified**: ``gene1 = 1-500`` - **RAxML**: ``DNA, gene1 = 1-500`` - - **NEXUS**: ``charset gene1 = 1-500;`` + - **NEXUS**: + ``` + #NEXUS + + Begin sets; + charset gene1 = 1-500; + End; + ``` **Use cases** diff --git a/tools/amas/amas_remove.xml b/tools/amas/amas_remove.xml index f10d08e4bbf..88efe3e722f 100644 --- a/tools/amas/amas_remove.xml +++ b/tools/amas/amas_remove.xml @@ -16,17 +16,12 @@ #import re set -eu; - rm -rf "run_dir/action"; - mkdir -p "run_dir/action"; - ## Create symlinks with original filename for consistent tests #for $f in $input_files #set $safename_input = re.sub('[^\w\-_\.]', '_', $f.element_identifier) - ln -s '${f}' "run_dir/action/${safename_input}"; + ln -s '${f}' "${safename_input}"; #end for - cd "run_dir/action"; - python -m amas.AMAS remove --taxa-to-remove @@ -74,7 +69,7 @@ - + diff --git a/tools/amas/amas_replicate.xml b/tools/amas/amas_replicate.xml index 10606324788..6e630333fc3 100644 --- a/tools/amas/amas_replicate.xml +++ b/tools/amas/amas_replicate.xml @@ -16,17 +16,12 @@ #import re set -eu; - rm -rf "run_dir/action"; - mkdir -p "run_dir/action"; - ## Create symlinks with original filename for consistent tests #for $f in $input_files #set $safename_input = re.sub('[^\w\-_\.]', '_', $f.element_identifier) - ln -s '${f}' "run_dir/action/${safename_input}"; + ln -s '${f}' "${safename_input}"; #end for - cd "run_dir/action"; - python -m amas.AMAS replicate --rep-aln $replicate_replicates $replicate_loci @@ -70,8 +65,8 @@ - - + + diff --git a/tools/amas/amas_split.xml b/tools/amas/amas_split.xml index 2162b23fa0b..74d49266762 100644 --- a/tools/amas/amas_split.xml +++ b/tools/amas/amas_split.xml @@ -16,15 +16,10 @@ #import re set -eu; - rm -rf "run_dir/action"; - mkdir -p "run_dir/action"; - ## Create symlinks with original filename for consistent tests because ## input filenames are used as str vars #set $safename_input = re.sub('[^\w\-_\.]', '_', $input_file.element_identifier) - ln -s '${input_file}' "run_dir/action/${safename_input}"; - - cd "run_dir/action"; + ln -s '${input_file}' "${safename_input}"; python -m amas.AMAS split @@ -66,8 +61,8 @@ - - + + @@ -109,8 +104,12 @@ NEXUS format:: - charset gene1 = 1-500; - charset gene2 = 501-1200; + #NEXUS + + Begin sets; + charset gene1 = 1-500; + charset gene2 = 501-1200; + End; **Tip:** An example for your data can be generated using the AMAS concat tool. diff --git a/tools/amas/amas_summary.xml b/tools/amas/amas_summary.xml index eba9848834a..60e91984ba9 100644 --- a/tools/amas/amas_summary.xml +++ b/tools/amas/amas_summary.xml @@ -16,17 +16,12 @@ #import re set -eu; - rm -rf "run_dir/action"; - mkdir -p "run_dir/action"; - ## Create symlinks with original filename for consistent tests #for $f in $input_files #set $safename_input = re.sub('[^\w\-_\.]', '_', $f.element_identifier) - ln -s '${f}' "run_dir/action/${safename_input}"; + ln -s '${f}' '${safename_input}'; #end for - cd "run_dir/action"; - python -m amas.AMAS summary $by_taxon @@ -54,10 +49,10 @@ - + - + @@ -70,7 +65,7 @@ - + diff --git a/tools/amas/macros.xml b/tools/amas/macros.xml index 647d5d3139a..387a40242cb 100644 --- a/tools/amas/macros.xml +++ b/tools/amas/macros.xml @@ -35,17 +35,17 @@ - + out_format == "fasta" - + out_format == "phylip" or out_format == "phylip-int" - + out_format == "nexus" or out_format == "nexus-int" From f6a85d5ecb1cef04d5077f3df47027a56459217e Mon Sep 17 00:00:00 2001 From: jch Date: Mon, 17 Nov 2025 13:51:36 +1100 Subject: [PATCH 43/77] refactor: changed check_align and data_type to macro --- tools/amas/amas_concat.xml | 7 ++----- tools/amas/amas_remove.xml | 7 ++----- tools/amas/amas_replicate.xml | 7 ++----- tools/amas/amas_split.xml | 7 ++----- tools/amas/amas_summary.xml | 7 ++----- tools/amas/macros.xml | 11 +++++++++++ 6 files changed, 21 insertions(+), 25 deletions(-) diff --git a/tools/amas/amas_concat.xml b/tools/amas/amas_concat.xml index f09d66c9c43..d8ddb8eccab 100644 --- a/tools/amas/amas_concat.xml +++ b/tools/amas/amas_concat.xml @@ -51,11 +51,8 @@ - - - - - + + diff --git a/tools/amas/amas_remove.xml b/tools/amas/amas_remove.xml index 88efe3e722f..23811ff3df5 100644 --- a/tools/amas/amas_remove.xml +++ b/tools/amas/amas_remove.xml @@ -49,11 +49,8 @@ help="Space-separated list of taxon names to remove (e.g., 'OTU9 OTU10 Sample_A'). Note: AMAS converts spaces to underscores and strips quotes from sequence names, so use 'Species_1' to remove a taxon named 'Species 1'."> [A-Za-z0-9_.\-]+(\s+[A-Za-z0-9_.\-]+)* - - - - - + + diff --git a/tools/amas/amas_replicate.xml b/tools/amas/amas_replicate.xml index 6e630333fc3..e5751b194d0 100644 --- a/tools/amas/amas_replicate.xml +++ b/tools/amas/amas_replicate.xml @@ -44,11 +44,8 @@ - - - - - + + diff --git a/tools/amas/amas_split.xml b/tools/amas/amas_split.xml index 74d49266762..134aea3acbb 100644 --- a/tools/amas/amas_split.xml +++ b/tools/amas/amas_split.xml @@ -40,11 +40,8 @@ - - - - - + + diff --git a/tools/amas/amas_summary.xml b/tools/amas/amas_summary.xml index 60e91984ba9..5e78695ab53 100644 --- a/tools/amas/amas_summary.xml +++ b/tools/amas/amas_summary.xml @@ -41,11 +41,8 @@ help="Provide pre-aligned FASTA/PHYLIP/NEXUS files (DNA or protein); mixes of unaligned reads or contigs will produce meaningless results." /> - - - - - + + diff --git a/tools/amas/macros.xml b/tools/amas/macros.xml index 387a40242cb..5ed4b974e9e 100644 --- a/tools/amas/macros.xml +++ b/tools/amas/macros.xml @@ -33,6 +33,17 @@ + + + + + + + + + + + From 08bd74db0256549b4f560dabe3d93f99f5257dc7 Mon Sep 17 00:00:00 2001 From: jch Date: Mon, 17 Nov 2025 14:09:34 +1100 Subject: [PATCH 44/77] refactor: moved shared commands to macro tokens --- tools/amas/amas_concat.xml | 12 ++---------- tools/amas/amas_remove.xml | 11 ++--------- tools/amas/amas_replicate.xml | 11 ++--------- tools/amas/amas_split.xml | 2 +- tools/amas/amas_summary.xml | 11 ++--------- tools/amas/macros.xml | 15 +++++++++++++++ 6 files changed, 24 insertions(+), 38 deletions(-) diff --git a/tools/amas/amas_concat.xml b/tools/amas/amas_concat.xml index d8ddb8eccab..00a67f16579 100644 --- a/tools/amas/amas_concat.xml +++ b/tools/amas/amas_concat.xml @@ -16,12 +16,7 @@ #import re set -eu; - ## Create symlinks with original filename for consistent tests because - ## input filenames are used as str vars in the partitions.txt output - #for $f in $input_files - #set $safename_input = re.sub('[^\w\-_\.]', '_', $f.element_identifier) - ln -s '${f}' '${safename_input}'; - #end for + @SYMLINK_INPUTS@ python -m amas.AMAS concat @@ -30,10 +25,7 @@ --part-format $part_format --out-format $out_format --in-files - #for $f in $input_files - #set $safename_input = re.sub('[^\w\-_\.]', '_', $f.element_identifier) - '${safename_input}' - #end for + @INPUT_FILENAMES@ --in-format $in_format --data-type $data_type --cores "\${GALAXY_SLOTS:-1}" diff --git a/tools/amas/amas_remove.xml b/tools/amas/amas_remove.xml index 23811ff3df5..31286bebcd0 100644 --- a/tools/amas/amas_remove.xml +++ b/tools/amas/amas_remove.xml @@ -16,11 +16,7 @@ #import re set -eu; - ## Create symlinks with original filename for consistent tests - #for $f in $input_files - #set $safename_input = re.sub('[^\w\-_\.]', '_', $f.element_identifier) - ln -s '${f}' "${safename_input}"; - #end for + @SYMLINK_INPUTS@ python -m amas.AMAS remove @@ -30,10 +26,7 @@ #end for --out-format $out_format --in-files - #for $f in $input_files - #set $safename_input = re.sub('[^\w\-_\.]', '_', $f.element_identifier) - '${safename_input}' - #end for + @INPUT_FILENAMES@ --in-format $in_format --data-type $data_type --cores "\${GALAXY_SLOTS:-1}" diff --git a/tools/amas/amas_replicate.xml b/tools/amas/amas_replicate.xml index e5751b194d0..9c56c418842 100644 --- a/tools/amas/amas_replicate.xml +++ b/tools/amas/amas_replicate.xml @@ -16,21 +16,14 @@ #import re set -eu; - ## Create symlinks with original filename for consistent tests - #for $f in $input_files - #set $safename_input = re.sub('[^\w\-_\.]', '_', $f.element_identifier) - ln -s '${f}' "${safename_input}"; - #end for + @SYMLINK_INPUTS@ python -m amas.AMAS replicate --rep-aln $replicate_replicates $replicate_loci --out-format $out_format --in-files - #for $f in $input_files - #set $safename_input = re.sub('[^\w\-_\.]', '_', $f.element_identifier) - '${safename_input}' - #end for + @INPUT_FILENAMES@ --in-format $in_format --data-type $data_type --cores "\${GALAXY_SLOTS:-1}" diff --git a/tools/amas/amas_split.xml b/tools/amas/amas_split.xml index 134aea3acbb..4a578500aac 100644 --- a/tools/amas/amas_split.xml +++ b/tools/amas/amas_split.xml @@ -19,7 +19,7 @@ ## Create symlinks with original filename for consistent tests because ## input filenames are used as str vars #set $safename_input = re.sub('[^\w\-_\.]', '_', $input_file.element_identifier) - ln -s '${input_file}' "${safename_input}"; + ln -s '${input_file}' '${safename_input}'; python -m amas.AMAS split diff --git a/tools/amas/amas_summary.xml b/tools/amas/amas_summary.xml index 5e78695ab53..81f7f336662 100644 --- a/tools/amas/amas_summary.xml +++ b/tools/amas/amas_summary.xml @@ -16,20 +16,13 @@ #import re set -eu; - ## Create symlinks with original filename for consistent tests - #for $f in $input_files - #set $safename_input = re.sub('[^\w\-_\.]', '_', $f.element_identifier) - ln -s '${f}' '${safename_input}'; - #end for + @SYMLINK_INPUTS@ python -m amas.AMAS summary $by_taxon --in-files - #for $f in $input_files - #set $safename_input = re.sub('[^\w\-_\.]', '_', $f.element_identifier) - '${safename_input}' - #end for + @INPUT_FILENAMES@ --in-format $in_format --data-type $data_type --cores "\${GALAXY_SLOTS:-1}" diff --git a/tools/amas/macros.xml b/tools/amas/macros.xml index 5ed4b974e9e..8e820948e09 100644 --- a/tools/amas/macros.xml +++ b/tools/amas/macros.xml @@ -13,6 +13,21 @@ python -m amas.AMAS -h + + + + From b19d9b7c467b820718df022250c5d317bb7e84d5 Mon Sep 17 00:00:00 2001 From: jch Date: Mon, 17 Nov 2025 14:19:11 +1100 Subject: [PATCH 45/77] refactor/docs: moved shared help to macro token --- tools/amas/amas_concat.xml | 19 +++++++------------ tools/amas/amas_remove.xml | 6 +----- tools/amas/amas_replicate.xml | 6 +----- tools/amas/amas_split.xml | 6 +----- tools/amas/amas_summary.xml | 6 +----- tools/amas/macros.xml | 8 ++++++++ 6 files changed, 19 insertions(+), 32 deletions(-) diff --git a/tools/amas/amas_concat.xml b/tools/amas/amas_concat.xml index 00a67f16579..51413024fa0 100644 --- a/tools/amas/amas_concat.xml +++ b/tools/amas/amas_concat.xml @@ -121,14 +121,13 @@ - **Unspecified**: ``gene1 = 1-500`` - **RAxML**: ``DNA, gene1 = 1-500`` - - **NEXUS**: - ``` - #NEXUS + - **NEXUS**:: + + #NEXUS - Begin sets; - charset gene1 = 1-500; - End; - ``` + Begin sets; + charset gene1 = 1-500; + End; **Use cases** @@ -138,11 +137,7 @@ - **Increased phylogenetic signal**: Leverage information from multiple loci to resolve difficult nodes - **Comparative analyses**: Prepare datasets for testing hypotheses across multiple genomic regions - **About AMAS** - - AMAS (Alignment manipulation and summary statistics) is designed for modern phylogenomics workflows involving hundreds of taxa and thousands of loci. - - Source code and manual: https://github.com/marekborowiec/AMAS + @AMAS_SHARED_HELP@ ]]> diff --git a/tools/amas/amas_remove.xml b/tools/amas/amas_remove.xml index 31286bebcd0..a8dbe1b4b1d 100644 --- a/tools/amas/amas_remove.xml +++ b/tools/amas/amas_remove.xml @@ -93,11 +93,7 @@ - Create taxon subsets for sensitivity analyses - Remove outgroups after tree rooting - **About AMAS** - - AMAS (Alignment manipulation and summary statistics) is designed for modern phylogenomics workflows involving hundreds of taxa and thousands of loci. - - Source code and manual: https://github.com/marekborowiec/AMAS + @AMAS_SHARED_HELP@ ]]> diff --git a/tools/amas/amas_replicate.xml b/tools/amas/amas_replicate.xml index 9c56c418842..5efa6eab2c5 100644 --- a/tools/amas/amas_replicate.xml +++ b/tools/amas/amas_replicate.xml @@ -89,11 +89,7 @@ From 100 input genes, create 10 replicates each containing 50 randomly sampled genes. Each replicate can then be used to build a phylogenetic tree, and consistency across replicates indicates robust phylogenetic signal. - **About AMAS** - - AMAS (Alignment manipulation and summary statistics) is designed for modern phylogenomics workflows involving hundreds of taxa and thousands of loci. - - Source code and manual: https://github.com/marekborowiec/AMAS + @AMAS_SHARED_HELP@ ]]> diff --git a/tools/amas/amas_split.xml b/tools/amas/amas_split.xml index 4a578500aac..8186389c0bb 100644 --- a/tools/amas/amas_split.xml +++ b/tools/amas/amas_split.xml @@ -117,11 +117,7 @@ - Apply gene-specific filtering or trimming - Recover original locus alignments from published concatenated datasets - **About AMAS** - - AMAS (Alignment manipulation and summary statistics) is designed for modern phylogenomics workflows involving hundreds of taxa and thousands of loci. - - Source code and manual: https://github.com/marekborowiec/AMAS + @AMAS_SHARED_HELP@ ]]> diff --git a/tools/amas/amas_summary.xml b/tools/amas/amas_summary.xml index 81f7f336662..b4288b3ae1a 100644 --- a/tools/amas/amas_summary.xml +++ b/tools/amas/amas_summary.xml @@ -96,11 +96,7 @@ - **Taxon filtering**: Find sequences with poor coverage - **Publication reporting**: Generate standardized alignment statistics for methods sections - **About AMAS** - - AMAS (Alignment manipulation and summary statistics) is designed for modern phylogenomics workflows involving hundreds of taxa and thousands of loci. - - Source code and manual: https://github.com/marekborowiec/AMAS + @AMAS_SHARED_HELP@ ]]> diff --git a/tools/amas/macros.xml b/tools/amas/macros.xml index 8e820948e09..b1d9ef606d0 100644 --- a/tools/amas/macros.xml +++ b/tools/amas/macros.xml @@ -76,6 +76,14 @@ + + 10.7717/peerj.1660 From b61f0ff012295c01c2ae65a42794ade5548784c9 Mon Sep 17 00:00:00 2001 From: jch Date: Mon, 17 Nov 2025 14:36:34 +1100 Subject: [PATCH 46/77] refactor: added ${tool.name} on ${on_string} to output labels --- tools/amas/amas_concat.xml | 6 +++--- tools/amas/amas_remove.xml | 2 +- tools/amas/amas_replicate.xml | 2 +- tools/amas/amas_split.xml | 4 ++-- tools/amas/amas_summary.xml | 4 ++-- tools/amas/macros.xml | 6 +++--- 6 files changed, 12 insertions(+), 12 deletions(-) diff --git a/tools/amas/amas_concat.xml b/tools/amas/amas_concat.xml index 51413024fa0..cb3641effd3 100644 --- a/tools/amas/amas_concat.xml +++ b/tools/amas/amas_concat.xml @@ -48,7 +48,7 @@ - + @@ -57,7 +57,7 @@ - + @@ -122,7 +122,7 @@ - **Unspecified**: ``gene1 = 1-500`` - **RAxML**: ``DNA, gene1 = 1-500`` - **NEXUS**:: - + #NEXUS Begin sets; diff --git a/tools/amas/amas_remove.xml b/tools/amas/amas_remove.xml index a8dbe1b4b1d..2241a6ba85d 100644 --- a/tools/amas/amas_remove.xml +++ b/tools/amas/amas_remove.xml @@ -47,7 +47,7 @@ - + diff --git a/tools/amas/amas_replicate.xml b/tools/amas/amas_replicate.xml index 5efa6eab2c5..d8bf0ab1d2b 100644 --- a/tools/amas/amas_replicate.xml +++ b/tools/amas/amas_replicate.xml @@ -42,7 +42,7 @@ - + diff --git a/tools/amas/amas_split.xml b/tools/amas/amas_split.xml index 8186389c0bb..3ec08ef1379 100644 --- a/tools/amas/amas_split.xml +++ b/tools/amas/amas_split.xml @@ -38,14 +38,14 @@ + help="A file defining how to split the concatenated alignment into separate gene/locus regions. Each line specifies a partition name and its position range (e.g., 'gene1 = 1-500' for unspecified format). See the help section for more information about partitions." /> - + diff --git a/tools/amas/amas_summary.xml b/tools/amas/amas_summary.xml index b4288b3ae1a..d28677c39e1 100644 --- a/tools/amas/amas_summary.xml +++ b/tools/amas/amas_summary.xml @@ -39,9 +39,9 @@ - + - + diff --git a/tools/amas/macros.xml b/tools/amas/macros.xml index b1d9ef606d0..8052a0009f7 100644 --- a/tools/amas/macros.xml +++ b/tools/amas/macros.xml @@ -60,17 +60,17 @@ - + out_format == "fasta" - + out_format == "phylip" or out_format == "phylip-int" - + out_format == "nexus" or out_format == "nexus-int" From 846b254de2264170d0a3ea820acc449e0c47b540 Mon Sep 17 00:00:00 2001 From: jch Date: Mon, 17 Nov 2025 14:46:13 +1100 Subject: [PATCH 47/77] docs: updated file format formatting to be more consistent --- tools/amas/macros.xml | 12 ++++++------ 1 file changed, 6 insertions(+), 6 deletions(-) diff --git a/tools/amas/macros.xml b/tools/amas/macros.xml index 8052a0009f7..7bc260439dd 100644 --- a/tools/amas/macros.xml +++ b/tools/amas/macros.xml @@ -31,18 +31,18 @@ - - - - + + + + - - + + From eec06201ba4c60fad7b3fb74bd4be263d992eeeb Mon Sep 17 00:00:00 2001 From: jch Date: Mon, 17 Nov 2025 14:50:33 +1100 Subject: [PATCH 48/77] style: removed single quotes --- tools/amas/amas_split.xml | 2 +- 1 file changed, 1 insertion(+), 1 deletion(-) diff --git a/tools/amas/amas_split.xml b/tools/amas/amas_split.xml index 3ec08ef1379..3abe569aea2 100644 --- a/tools/amas/amas_split.xml +++ b/tools/amas/amas_split.xml @@ -23,7 +23,7 @@ python -m amas.AMAS split - --split-by '$split_by' + --split-by $split_by $remove_empty --out-format $out_format --in-files $safename_input From 8364cfee11eb9f303507772bbfac61437674eca8 Mon Sep 17 00:00:00 2001 From: jch Date: Mon, 17 Nov 2025 14:59:34 +1100 Subject: [PATCH 49/77] docs: updated docs to include info on sequential vs interleaved; fixed some formatting --- tools/amas/amas_concat.xml | 9 +++++---- tools/amas/amas_summary.xml | 10 +++++----- tools/amas/macros.xml | 29 ++++++++++++++++++++++++++++- 3 files changed, 38 insertions(+), 10 deletions(-) diff --git a/tools/amas/amas_concat.xml b/tools/amas/amas_concat.xml index cb3641effd3..7c403696b69 100644 --- a/tools/amas/amas_concat.xml +++ b/tools/amas/amas_concat.xml @@ -106,10 +106,11 @@ **Example:** - If you concatenate three genes: - - gene1.fasta (500 bp) - - gene2.fasta (700 bp) - - gene3.fasta (400 bp) + If you concatenate three genes:: + + gene1.fasta (500 bp) + gene2.fasta (700 bp) + gene3.fasta (400 bp) The partitions file (unspecified format) will contain:: diff --git a/tools/amas/amas_summary.xml b/tools/amas/amas_summary.xml index d28677c39e1..d201152eb24 100644 --- a/tools/amas/amas_summary.xml +++ b/tools/amas/amas_summary.xml @@ -74,11 +74,11 @@ **Outputs** - 1. **Summary table** (``summary.txt``): Overall statistics for each alignment including: - - Number of taxa and alignment length - - Total matrix cells and proportion of missing data - - Variable sites and parsimony-informative sites - - GC content (DNA) or amino acid composition (protein) + 1. **Summary table** - Overall statistics for each alignment including: + - Number of taxa and alignment length + - Total matrix cells and proportion of missing data + - Variable sites and parsimony-informative sites + - GC content (DNA) or amino acid composition (protein) 2. **Per-taxon summaries** (optional): Individual statistics for each sequence showing taxon-specific missing data and character frequencies diff --git a/tools/amas/macros.xml b/tools/amas/macros.xml index 7bc260439dd..7fc65867468 100644 --- a/tools/amas/macros.xml +++ b/tools/amas/macros.xml @@ -29,7 +29,7 @@ ]]> - + @@ -77,6 +77,33 @@ Date: Mon, 17 Nov 2025 15:07:21 +1100 Subject: [PATCH 50/77] docs: moved partitions help to macro token --- tools/amas/amas_concat.xml | 30 +----------------------- tools/amas/amas_split.xml | 25 +------------------- tools/amas/macros.xml | 47 ++++++++++++++++++++++++++++++++++++++ 3 files changed, 49 insertions(+), 53 deletions(-) diff --git a/tools/amas/amas_concat.xml b/tools/amas/amas_concat.xml index 7c403696b69..cb3ed055e57 100644 --- a/tools/amas/amas_concat.xml +++ b/tools/amas/amas_concat.xml @@ -100,35 +100,7 @@ 1. **Concatenated alignment**: A single file containing all input alignments joined end-to-end 2. **Partitions file**: Defines the boundaries of each original alignment within the concatenated file - **What is a partitions file?** - - The partitions file maps each gene/locus to its position in the concatenated alignment. This is essential for downstream phylogenetic analyses (e.g., RAxML, IQ-TREE) that can apply different evolutionary models to different partitions. - - **Example:** - - If you concatenate three genes:: - - gene1.fasta (500 bp) - gene2.fasta (700 bp) - gene3.fasta (400 bp) - - The partitions file (unspecified format) will contain:: - - gene1 = 1-500 - gene2 = 501-1200 - gene3 = 1201-1600 - - **Partition formats:** - - - **Unspecified**: ``gene1 = 1-500`` - - **RAxML**: ``DNA, gene1 = 1-500`` - - **NEXUS**:: - - #NEXUS - - Begin sets; - charset gene1 = 1-500; - End; + @PARTITIONS_HELP@ **Use cases** diff --git a/tools/amas/amas_split.xml b/tools/amas/amas_split.xml index 3abe569aea2..c745d974717 100644 --- a/tools/amas/amas_split.xml +++ b/tools/amas/amas_split.xml @@ -83,30 +83,7 @@ A collection of alignment files, one per partition/gene defined in your partitions file. - **What is a partitions file?** - - A partitions file maps each gene/locus to its position range in the concatenated alignment. - - **Format examples:** - - Unspecified format:: - - gene1 = 1-500 - gene2 = 501-1200 - - RAxML format:: - - DNA, gene1 = 1-500 - DNA, gene2 = 501-1200 - - NEXUS format:: - - #NEXUS - - Begin sets; - charset gene1 = 1-500; - charset gene2 = 501-1200; - End; + @PARTITIONS_HELP@ **Tip:** An example for your data can be generated using the AMAS concat tool. diff --git a/tools/amas/macros.xml b/tools/amas/macros.xml index 7fc65867468..b77f0f0dfdd 100644 --- a/tools/amas/macros.xml +++ b/tools/amas/macros.xml @@ -76,6 +76,53 @@ + + Date: Wed, 19 Nov 2025 12:21:12 +1100 Subject: [PATCH 51/77] refactor: set format depending on part_format --- tools/amas/amas_concat.xml | 10 ++++++++-- 1 file changed, 8 insertions(+), 2 deletions(-) diff --git a/tools/amas/amas_concat.xml b/tools/amas/amas_concat.xml index cb3ed055e57..9461b4b6981 100644 --- a/tools/amas/amas_concat.xml +++ b/tools/amas/amas_concat.xml @@ -39,9 +39,9 @@ + - @@ -57,7 +57,13 @@ - + + + + + + + From 0e62561ce272668455961a5717f75f02387c90a9 Mon Sep 17 00:00:00 2001 From: jch Date: Wed, 19 Nov 2025 12:23:43 +1100 Subject: [PATCH 52/77] style: changed formatting of output files --- tools/amas/amas_concat.xml | 4 ++-- tools/amas/amas_summary.xml | 4 ++-- tools/amas/macros.xml | 6 +++--- 3 files changed, 7 insertions(+), 7 deletions(-) diff --git a/tools/amas/amas_concat.xml b/tools/amas/amas_concat.xml index 9461b4b6981..9df080ddade 100644 --- a/tools/amas/amas_concat.xml +++ b/tools/amas/amas_concat.xml @@ -48,7 +48,7 @@ - + @@ -57,7 +57,7 @@ - + diff --git a/tools/amas/amas_summary.xml b/tools/amas/amas_summary.xml index d201152eb24..1768ea4bf86 100644 --- a/tools/amas/amas_summary.xml +++ b/tools/amas/amas_summary.xml @@ -39,9 +39,9 @@ - + - + diff --git a/tools/amas/macros.xml b/tools/amas/macros.xml index b77f0f0dfdd..4460bc76123 100644 --- a/tools/amas/macros.xml +++ b/tools/amas/macros.xml @@ -60,17 +60,17 @@ - + out_format == "fasta" - + out_format == "phylip" or out_format == "phylip-int" - + out_format == "nexus" or out_format == "nexus-int" From 4af9562f844f1ed88b1627e1a75c05c7a39a1b32 Mon Sep 17 00:00:00 2001 From: jch Date: Wed, 19 Nov 2025 12:24:16 +1100 Subject: [PATCH 53/77] fix: updated version command --- tools/amas/macros.xml | 2 +- 1 file changed, 1 insertion(+), 1 deletion(-) diff --git a/tools/amas/macros.xml b/tools/amas/macros.xml index 4460bc76123..543732eda1c 100644 --- a/tools/amas/macros.xml +++ b/tools/amas/macros.xml @@ -10,7 +10,7 @@ - python -m amas.AMAS -h + python -c "import amas; print(amas.__version__)" Date: Wed, 19 Nov 2025 12:38:01 +1100 Subject: [PATCH 54/77] tests: changed concat test from sim size to exact --- tools/amas/amas_concat.xml | 4 ++-- 1 file changed, 2 insertions(+), 2 deletions(-) diff --git a/tools/amas/amas_concat.xml b/tools/amas/amas_concat.xml index 9df080ddade..6663f969931 100644 --- a/tools/amas/amas_concat.xml +++ b/tools/amas/amas_concat.xml @@ -74,7 +74,7 @@ - + @@ -84,7 +84,7 @@ - + From d4b84ac422b85c38007207136d7aa095b402dd3a Mon Sep 17 00:00:00 2001 From: jch Date: Wed, 19 Nov 2025 12:45:57 +1100 Subject: [PATCH 55/77] refactor: simplified change_format --- tools/amas/amas_concat.xml | 2 -- 1 file changed, 2 deletions(-) diff --git a/tools/amas/amas_concat.xml b/tools/amas/amas_concat.xml index 6663f969931..ff62516668b 100644 --- a/tools/amas/amas_concat.xml +++ b/tools/amas/amas_concat.xml @@ -59,9 +59,7 @@ - - From 51bb36e83382b1165c6c0a0106f3afab4a452114 Mon Sep 17 00:00:00 2001 From: jch Date: Wed, 19 Nov 2025 15:07:04 +1100 Subject: [PATCH 56/77] fix: updated/fixed concat test --- tools/amas/amas_concat.xml | 4 ++-- tools/amas/test-data/outputs/expected_concat.phylip | 4 ++-- .../{expected_partitions.txt => expected_partitions.nex} | 0 3 files changed, 4 insertions(+), 4 deletions(-) rename tools/amas/test-data/outputs/{expected_partitions.txt => expected_partitions.nex} (100%) diff --git a/tools/amas/amas_concat.xml b/tools/amas/amas_concat.xml index ff62516668b..50443153d96 100644 --- a/tools/amas/amas_concat.xml +++ b/tools/amas/amas_concat.xml @@ -59,7 +59,7 @@ - + @@ -73,7 +73,7 @@ - + diff --git a/tools/amas/test-data/outputs/expected_concat.phylip b/tools/amas/test-data/outputs/expected_concat.phylip index 5ce3ce2d664..6b03683296f 100644 --- a/tools/amas/test-data/outputs/expected_concat.phylip +++ b/tools/amas/test-data/outputs/expected_concat.phylip @@ -1,4 +1,4 @@ -10 200 +3 200 OTU1 ?ACCATGTTTGTTGTAGGAGTCAACTTAGAAGCTTATGACCCATCCTATAAAGTCATCTCCAATGCCTCGTGCACAACCAACTGCTTAGCTCCACTCGCT?ACCATGTTTGTTGTAGGAGTCAACTTAGAAGCTTATGACCCATCCTATAAAGTCATCTCCAATGCCTCGTGCACAACCAACTGCTTAGCTCCACTCGCT OTU10 AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAATTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTT -OTU2 ACCCATGTTTGTTGTAGGAGTCAACTTAGAAGCTTATGACCCATCCTATAAAGTCATCTCCAATGCCTCGTGCACAACCAACTGCTTAGCTCCACTCGCTACCCATGTTTGTTGTAGGAGTCAACTTAGAAGCTTATGACCCATCCTATAAAGTCATCTCCAATGCCTCGTGCACAACCAACTGCTTAGCTCCACTCGCT \ No newline at end of file +OTU2 ACCCATGTTTGTTGTAGGAGTCAACTTAGAAGCTTATGACCCATCCTATAAAGTCATCTCCAATGCCTCGTGCACAACCAACTGCTTAGCTCCACTCGCTACCCATGTTTGTTGTAGGAGTCAACTTAGAAGCTTATGACCCATCCTATAAAGTCATCTCCAATGCCTCGTGCACAACCAACTGCTTAGCTCCACTCGCT diff --git a/tools/amas/test-data/outputs/expected_partitions.txt b/tools/amas/test-data/outputs/expected_partitions.nex similarity index 100% rename from tools/amas/test-data/outputs/expected_partitions.txt rename to tools/amas/test-data/outputs/expected_partitions.nex From ff762fb02cf473a8330a7f08121f314c2304c0dd Mon Sep 17 00:00:00 2001 From: jch Date: Wed, 19 Nov 2025 16:09:10 +1100 Subject: [PATCH 57/77] fix: added nex format to allowed inputs for partitions --- tools/amas/amas_split.xml | 5 ++--- 1 file changed, 2 insertions(+), 3 deletions(-) diff --git a/tools/amas/amas_split.xml b/tools/amas/amas_split.xml index c745d974717..9ab63186d9d 100644 --- a/tools/amas/amas_split.xml +++ b/tools/amas/amas_split.xml @@ -37,7 +37,7 @@ - @@ -72,8 +72,7 @@ **Inputs** - **Concatenated alignment**: A single alignment file containing multiple genes/loci joined end-to-end - - **Partitions file**: Defines the boundaries of each gene/locus (can be generated by AMAS Concat) - - **Partition format**: Unspecified, RAxML, or NEXUS format + - **Partitions file**: Defines the boundaries of each gene/locus (can be either a .txt file containing Unspecified, RAxML, or NEXUS formatting, or a .nex file containing NEXUS formatting) - **Input format**: Specify the format of your concatenated alignment - **Data type**: Choose DNA for nucleotide sequences or Protein for amino acid sequences - **Output format**: Select the desired format for the split alignment files From 3d9424b339ddbb55fc33bdf431cf3f450f511b45 Mon Sep 17 00:00:00 2001 From: jch Date: Wed, 19 Nov 2025 16:15:06 +1100 Subject: [PATCH 58/77] docs: updated help --- tools/amas/amas_concat.xml | 1 + tools/amas/amas_remove.xml | 5 ++--- 2 files changed, 3 insertions(+), 3 deletions(-) diff --git a/tools/amas/amas_concat.xml b/tools/amas/amas_concat.xml index 50443153d96..d02fa02dab1 100644 --- a/tools/amas/amas_concat.xml +++ b/tools/amas/amas_concat.xml @@ -96,6 +96,7 @@ - **Multiple alignment files**: Select 2 or more pre-aligned sequence files (FASTA, PHYLIP, or NEXUS format) - **Input format**: Specify the format of your input files + - **Partition format**: Specify how you want the partition file to be formatted (Unspecified, RAxML, NEXUS) - **Data type**: Choose DNA for nucleotide sequences or Protein for amino acid sequences - **Output format**: Select the desired format for the concatenated alignment diff --git a/tools/amas/amas_remove.xml b/tools/amas/amas_remove.xml index 2241a6ba85d..133c5feb92f 100644 --- a/tools/amas/amas_remove.xml +++ b/tools/amas/amas_remove.xml @@ -73,9 +73,8 @@ - **Alignment files**: One or more pre-aligned sequence files (FASTA, PHYLIP, or NEXUS format) - **Taxa to remove**: Space-separated list of sequence names to exclude (e.g., 'OTU9 OTU10 Sample_A') - - **Important**: AMAS converts spaces to underscores and strips quotes from sequence names during processing. If your input file contains a taxon named 'Species 1' or '"Species 1"', you must specify it as 'Species_1' in the taxa to remove list. - + **Important**: AMAS converts spaces to underscores and strips quotes from sequence names during processing. If your input file contains a taxon named 'Species 1' or '"Species 1"', you must specify it as 'Species_1' in the taxa to remove list. + - **Input format**: Specify the format of your input files - **Data type**: Choose DNA for nucleotide sequences or Protein for amino acid sequences - **Output format**: Select the desired format for the reduced alignments From 18a8396f40ac725014eb08786d20985fff7d73a0 Mon Sep 17 00:00:00 2001 From: jch Date: Wed, 19 Nov 2025 16:23:53 +1100 Subject: [PATCH 59/77] style: fix lint --- tools/amas/amas_remove.xml | 1 + 1 file changed, 1 insertion(+) diff --git a/tools/amas/amas_remove.xml b/tools/amas/amas_remove.xml index 133c5feb92f..ac15a00de97 100644 --- a/tools/amas/amas_remove.xml +++ b/tools/amas/amas_remove.xml @@ -73,6 +73,7 @@ - **Alignment files**: One or more pre-aligned sequence files (FASTA, PHYLIP, or NEXUS format) - **Taxa to remove**: Space-separated list of sequence names to exclude (e.g., 'OTU9 OTU10 Sample_A') + **Important**: AMAS converts spaces to underscores and strips quotes from sequence names during processing. If your input file contains a taxon named 'Species 1' or '"Species 1"', you must specify it as 'Species_1' in the taxa to remove list. - **Input format**: Specify the format of your input files From bd9a81891a4c4ed4d79a60be88839f321cfbbdd2 Mon Sep 17 00:00:00 2001 From: jch Date: Wed, 19 Nov 2025 17:45:39 +1100 Subject: [PATCH 60/77] fix: split subcommand does not work with RAxML or NEXUS formatted partitions; removed with note and more info --- tools/amas/amas_split.xml | 6 ++++-- 1 file changed, 4 insertions(+), 2 deletions(-) diff --git a/tools/amas/amas_split.xml b/tools/amas/amas_split.xml index 9ab63186d9d..9c5d36884bb 100644 --- a/tools/amas/amas_split.xml +++ b/tools/amas/amas_split.xml @@ -37,7 +37,7 @@ - @@ -72,7 +72,7 @@ **Inputs** - **Concatenated alignment**: A single alignment file containing multiple genes/loci joined end-to-end - - **Partitions file**: Defines the boundaries of each gene/locus (can be either a .txt file containing Unspecified, RAxML, or NEXUS formatting, or a .nex file containing NEXUS formatting) + - **Partitions file**: Defines the boundaries of each gene/locus (.txt file containing Unspecified formatting) - **Input format**: Specify the format of your concatenated alignment - **Data type**: Choose DNA for nucleotide sequences or Protein for amino acid sequences - **Output format**: Select the desired format for the split alignment files @@ -84,6 +84,8 @@ @PARTITIONS_HELP@ + **IMPORTANT**: A .txt file containing RAxML, or NEXUS formatting, or a .nex file containing NEXUS formatting that are produced using AMAS Concat will not work. + **Tip:** An example for your data can be generated using the AMAS concat tool. **Use cases** From 0aae4cbff03e7a295837c207ceddc653bf75f349 Mon Sep 17 00:00:00 2001 From: jch Date: Thu, 20 Nov 2025 14:36:16 +1100 Subject: [PATCH 61/77] docs: added some comments for future --- tools/amas/amas_concat.xml | 1 + tools/amas/amas_split.xml | 1 + tools/amas/macros.xml | 1 + 3 files changed, 3 insertions(+) diff --git a/tools/amas/amas_concat.xml b/tools/amas/amas_concat.xml index d02fa02dab1..960c1fc930b 100644 --- a/tools/amas/amas_concat.xml +++ b/tools/amas/amas_concat.xml @@ -59,6 +59,7 @@ + diff --git a/tools/amas/amas_split.xml b/tools/amas/amas_split.xml index 9c5d36884bb..adfdf840107 100644 --- a/tools/amas/amas_split.xml +++ b/tools/amas/amas_split.xml @@ -37,6 +37,7 @@ + diff --git a/tools/amas/macros.xml b/tools/amas/macros.xml index 543732eda1c..35e41981964 100644 --- a/tools/amas/macros.xml +++ b/tools/amas/macros.xml @@ -59,6 +59,7 @@ + From 96395ca969d6c6b842997dc830c996ae10c2be56 Mon Sep 17 00:00:00 2001 From: jch Date: Thu, 20 Nov 2025 14:47:57 +1100 Subject: [PATCH 62/77] style: cleaned up indenting --- tools/amas/amas_concat.xml | 2 +- tools/amas/amas_remove.xml | 2 +- tools/amas/amas_replicate.xml | 2 +- tools/amas/amas_split.xml | 2 +- tools/amas/amas_summary.xml | 2 +- tools/amas/macros.xml | 8 ++++---- 6 files changed, 9 insertions(+), 9 deletions(-) diff --git a/tools/amas/amas_concat.xml b/tools/amas/amas_concat.xml index 960c1fc930b..ed4343eb24c 100644 --- a/tools/amas/amas_concat.xml +++ b/tools/amas/amas_concat.xml @@ -30,7 +30,7 @@ --data-type $data_type --cores "\${GALAXY_SLOTS:-1}" $check_align - ]]> + ]]> + ]]> + ]]> + ]]> diff --git a/tools/amas/amas_summary.xml b/tools/amas/amas_summary.xml index 1768ea4bf86..127baf63213 100644 --- a/tools/amas/amas_summary.xml +++ b/tools/amas/amas_summary.xml @@ -27,7 +27,7 @@ --data-type $data_type --cores "\${GALAXY_SLOTS:-1}" $check_align - ]]> + ]]> From 0318c991953e2eb5db2521a4f81ffa7945039a5a Mon Sep 17 00:00:00 2001 From: jch Date: Thu, 27 Nov 2025 23:08:12 +1100 Subject: [PATCH 63/77] draft: added small helper script to check interleave --- tools/amas/amas_concat.xml | 15 ++- tools/amas/check_interleaved.py | 120 ++++++++++++++++++ tools/amas/macros.xml | 23 +++- .../amas/test-data/inputs/concat_int_1.phylip | 12 ++ .../amas/test-data/inputs/concat_int_2.phylip | 12 ++ .../test-data/outputs/expected_concat_int.nex | 18 +++ .../outputs/expected_partitions_int.txt | 2 + 7 files changed, 200 insertions(+), 2 deletions(-) create mode 100644 tools/amas/check_interleaved.py create mode 100644 tools/amas/test-data/inputs/concat_int_1.phylip create mode 100644 tools/amas/test-data/inputs/concat_int_2.phylip create mode 100644 tools/amas/test-data/outputs/expected_concat_int.nex create mode 100644 tools/amas/test-data/outputs/expected_partitions_int.txt diff --git a/tools/amas/amas_concat.xml b/tools/amas/amas_concat.xml index ed4343eb24c..5489d3e64cf 100644 --- a/tools/amas/amas_concat.xml +++ b/tools/amas/amas_concat.xml @@ -16,6 +16,8 @@ #import re set -eu; + @CHECK_INTERLEAVED@ + @SYMLINK_INPUTS@ python -m amas.AMAS @@ -26,7 +28,7 @@ --out-format $out_format --in-files @INPUT_FILENAMES@ - --in-format $in_format + --in-format "\${IN_FORMAT}" --data-type $data_type --cores "\${GALAXY_SLOTS:-1}" $check_align @@ -86,6 +88,17 @@ + + + + + + + + + + + ntax: + return True + + return False + +def check_nexus_interleaved(filepath): + """Check if NEXUS file is interleaved.""" + with io.open(filepath, 'r') as f: + content = f.read().lower() + + # Primary check: Look for explicit interleave keyword + # Matches: 'interleave', 'interleave;', 'interleave=yes' + # Not match: 'interleave=no' + # NOTE: may be other ways interleave can be expressed in Format + pattern = r'\binterleave(;|=yes)?\b' + if re.search(pattern, content): + return True + + # Backup check: Parse dimensions and count data lines + # Look for dimensions: "Dimensions ntax=10 nchar=234" + dim_match = re.search(r'dimensions\s+ntax=(\d+)\s+nchar=(\d+)', + content) + if not dim_match: + return False + + ntax = int(dim_match.group(1)) + + # Find Matrix section + matrix_match = re.search(r'\bmatrix\b', content) + if not matrix_match: + return False + + matrix_start = matrix_match.end() + + # Find END; after matrix + end_match = re.search(r'\bend\s*;', content[matrix_start:]) + if not end_match: + return False + + matrix_end = matrix_start + end_match.start() + + matrix_content = content[matrix_start:matrix_end] + + lines = matrix_content.split('\n') + data_line_count = 0 + for line in lines: + stripped = line.strip() + if stripped and stripped != ';': + data_line_count += 1 + + # If more data lines than ntax, it's interleaved + return data_line_count > ntax + +def check_fasta_interleaved(filepath): + """FASTA files are not interleaved.""" + return False + +def main(): + parser = argparse.ArgumentParser( + description='Check if AMAS input files are interleaved' + ) + parser.add_argument('input_files', nargs='+', help='Input sequence files') + parser.add_argument('--format', required=True, + choices=['fasta', 'phylip', 'nexus'], + help='Input format') + + args = parser.parse_args() + + # Check all files + interleaved_status = [] + for filepath in args.input_files: + if args.format == 'phylip': + is_interleaved = check_phylip_interleaved(filepath) + elif args.format == 'nexus': + is_interleaved = check_nexus_interleaved(filepath) + else: # fasta + is_interleaved = check_fasta_interleaved(filepath) + + interleaved_status.append(is_interleaved) + + # Determine overall status + if all(interleaved_status): + print("True") + return 0 + else: + print("False") + return 0 + +if __name__ == '__main__': + sys.exit(main()) \ No newline at end of file diff --git a/tools/amas/macros.xml b/tools/amas/macros.xml index 553e259fd0e..1a249ba59c0 100644 --- a/tools/amas/macros.xml +++ b/tools/amas/macros.xml @@ -13,11 +13,32 @@ python -c "import amas; print(amas.__version__)" + &2; + + ## Determine input format with -int suffix if needed + if [ "\$INTERLEAVED" = "True" ]; then + IN_FORMAT="${in_format}-int"; + else + IN_FORMAT="${in_format}"; + fi; + + echo "\$IN_FORMAT" >&2; + ]]> + diff --git a/tools/amas/test-data/inputs/concat_int_1.phylip b/tools/amas/test-data/inputs/concat_int_1.phylip new file mode 100644 index 00000000000..d65b3f611d0 --- /dev/null +++ b/tools/amas/test-data/inputs/concat_int_1.phylip @@ -0,0 +1,12 @@ +3 300 +Taxon_A ATGCATGCATATGCATGCATATGCATGCATATGCATGCATATGCATGCATATGCATGCATATGCATGCATATGCATGCATATGCATGCATATGCATGCAT +Taxon_B GCTAGCTAGTGCTAGCTAGTGCTAGCTAGTGCTAGCTAGTGCTAGCTAGTGCTAGCTAGTGCTAGCTAGTGCTAGCTAGTGCTAGCTAGTGCTAGCTAGT +Taxon_C TTAGCTAGCTTTAGCTAGCTTTAGCTAGCTTTAGCTAGCTTTAGCTAGCTTTAGCTAGCTTTAGCTAGCTTTAGCTAGCTTTAGCTAGCTTTAGCTAGCT + +ATGCATGCATATGCATGCATATGCATGCATATGCATGCATATGCATGCATATGCATGCATATGCATGCATATGCATGCATATGCATGCATATGCATGCAT +GCTAGCTAGTGCTAGCTAGTGCTAGCTAGTGCTAGCTAGTGCTAGCTAGTGCTAGCTAGTGCTAGCTAGTGCTAGCTAGTGCTAGCTAGTGCTAGCTAGT +TTAGCTAGCTTTAGCTAGCTTTAGCTAGCTTTAGCTAGCTTTAGCTAGCTTTAGCTAGCTTTAGCTAGCTTTAGCTAGCTTTAGCTAGCTTTAGCTAGCT + +ATGCATGCATATGCATGCATATGCATGCATATGCATGCATATGCATGCATATGCATGCATATGCATGCATATGCATGCATATGCATGCATATGCATGCAT +GCTAGCTAGTGCTAGCTAGTGCTAGCTAGTGCTAGCTAGTGCTAGCTAGTGCTAGCTAGTGCTAGCTAGTGCTAGCTAGTGCTAGCTAGTGCTAGCTAGT +TTAGCTAGCTTTAGCTAGCTTTAGCTAGCTTTAGCTAGCTTTAGCTAGCTTTAGCTAGCTTTAGCTAGCTTTAGCTAGCTTTAGCTAGCTTTAGCTAGCT \ No newline at end of file diff --git a/tools/amas/test-data/inputs/concat_int_2.phylip b/tools/amas/test-data/inputs/concat_int_2.phylip new file mode 100644 index 00000000000..4a2c0545524 --- /dev/null +++ b/tools/amas/test-data/inputs/concat_int_2.phylip @@ -0,0 +1,12 @@ +3 300 +Taxon_A AAAAACCCCCAAAAACCCCCAAAAACCCCCAAAAACCCCCAAAAACCCCCAAAAACCCCCAAAAACCCCCAAAAACCCCCAAAAACCCCCAAAAACCCCC +Taxon_B GGGGGAAAAAGGGGGAAAAAGGGGGAAAAAGGGGGAAAAAGGGGGAAAAAGGGGGAAAAAGGGGGAAAAAGGGGGAAAAAGGGGGAAAAAGGGGGAAAAA +Taxon_C TTTTTGGGGGTTTTTGGGGGTTTTTGGGGGTTTTTGGGGGTTTTTGGGGGTTTTTGGGGGTTTTTGGGGGTTTTTGGGGGTTTTTGGGGGTTTTTGGGGG + +GGGGGTTTTTGGGGGTTTTTGGGGGTTTTTGGGGGTTTTTGGGGGTTTTTGGGGGTTTTTGGGGGTTTTTGGGGGTTTTTGGGGGTTTTTGGGGGTTTTT +CCCCCTTTTTCCCCCTTTTTCCCCCTTTTTCCCCCTTTTTCCCCCTTTTTCCCCCTTTTTCCCCCTTTTTCCCCCTTTTTCCCCCTTTTTCCCCCTTTTT +AAAAACCCCCAAAAACCCCCAAAAACCCCCAAAAACCCCCAAAAACCCCCAAAAACCCCCAAAAACCCCCAAAAACCCCCAAAAACCCCCAAAAACCCCC + +AAAAACCCCCAAAAACCCCCAAAAACCCCCAAAAACCCCCAAAAACCCCCAAAAACCCCCAAAAACCCCCAAAAACCCCCAAAAACCCCCAAAAACCCCC +GGGGGAAAAAGGGGGAAAAAGGGGGAAAAAGGGGGAAAAAGGGGGAAAAAGGGGGAAAAAGGGGGAAAAAGGGGGAAAAAGGGGGAAAAAGGGGGAAAAA +TTTTTGGGGGTTTTTGGGGGTTTTTGGGGGTTTTTGGGGGTTTTTGGGGGTTTTTGGGGGTTTTTGGGGGTTTTTGGGGGTTTTTGGGGGTTTTTGGGGG \ No newline at end of file diff --git a/tools/amas/test-data/outputs/expected_concat_int.nex b/tools/amas/test-data/outputs/expected_concat_int.nex new file mode 100644 index 00000000000..009f0421886 --- /dev/null +++ b/tools/amas/test-data/outputs/expected_concat_int.nex @@ -0,0 +1,18 @@ +#NEXUS + +BEGIN DATA; + DIMENSIONS NTAX=3 NCHAR=600; + FORMAT INTERLEAVE DATATYPE=DNA GAP = - MISSING = ?; + MATRIX +Taxon_A ATGCATGCATATGCATGCATATGCATGCATATGCATGCATATGCATGCATATGCATGCATATGCATGCATATGCATGCATATGCATGCATATGCATGCATATGCATGCATATGCATGCATATGCATGCATATGCATGCATATGCATGCATATGCATGCATATGCATGCATATGCATGCATATGCATGCATATGCATGCATATGCATGCATATGCATGCATATGCATGCATATGCATGCATATGCATGCATATGCATGCATATGCATGCATATGCATGCATATGCATGCATATGCATGCATAAAAACCCCCAAAAACCCCCAAAAACCCCCAAAAACCCCCAAAAACCCCCAAAAACCCCCAAAAACCCCCAAAAACCCCCAAAAACCCCCAAAAACCCCCGGGGGTTTTTGGGGGTTTTTGGGGGTTTTTGGGGGTTTTTGGGGGTTTTTGGGGGTTTTTGGGGGTTTTTGGGGGTTTTTGGGGGTTTTTGGGGGTTTTT +Taxon_B GCTAGCTAGTGCTAGCTAGTGCTAGCTAGTGCTAGCTAGTGCTAGCTAGTGCTAGCTAGTGCTAGCTAGTGCTAGCTAGTGCTAGCTAGTGCTAGCTAGTGCTAGCTAGTGCTAGCTAGTGCTAGCTAGTGCTAGCTAGTGCTAGCTAGTGCTAGCTAGTGCTAGCTAGTGCTAGCTAGTGCTAGCTAGTGCTAGCTAGTGCTAGCTAGTGCTAGCTAGTGCTAGCTAGTGCTAGCTAGTGCTAGCTAGTGCTAGCTAGTGCTAGCTAGTGCTAGCTAGTGCTAGCTAGTGCTAGCTAGTGGGGGAAAAAGGGGGAAAAAGGGGGAAAAAGGGGGAAAAAGGGGGAAAAAGGGGGAAAAAGGGGGAAAAAGGGGGAAAAAGGGGGAAAAAGGGGGAAAAACCCCCTTTTTCCCCCTTTTTCCCCCTTTTTCCCCCTTTTTCCCCCTTTTTCCCCCTTTTTCCCCCTTTTTCCCCCTTTTTCCCCCTTTTTCCCCCTTTTT +Taxon_C TTAGCTAGCTTTAGCTAGCTTTAGCTAGCTTTAGCTAGCTTTAGCTAGCTTTAGCTAGCTTTAGCTAGCTTTAGCTAGCTTTAGCTAGCTTTAGCTAGCTTTAGCTAGCTTTAGCTAGCTTTAGCTAGCTTTAGCTAGCTTTAGCTAGCTTTAGCTAGCTTTAGCTAGCTTTAGCTAGCTTTAGCTAGCTTTAGCTAGCTTTAGCTAGCTTTAGCTAGCTTTAGCTAGCTTTAGCTAGCTTTAGCTAGCTTTAGCTAGCTTTAGCTAGCTTTAGCTAGCTTTAGCTAGCTTTAGCTAGCTTTTTTGGGGGTTTTTGGGGGTTTTTGGGGGTTTTTGGGGGTTTTTGGGGGTTTTTGGGGGTTTTTGGGGGTTTTTGGGGGTTTTTGGGGGTTTTTGGGGGAAAAACCCCCAAAAACCCCCAAAAACCCCCAAAAACCCCCAAAAACCCCCAAAAACCCCCAAAAACCCCCAAAAACCCCCAAAAACCCCCAAAAACCCCC + +AAAAACCCCCAAAAACCCCCAAAAACCCCCAAAAACCCCCAAAAACCCCCAAAAACCCCCAAAAACCCCCAAAAACCCCCAAAAACCCCCAAAAACCCCC +GGGGGAAAAAGGGGGAAAAAGGGGGAAAAAGGGGGAAAAAGGGGGAAAAAGGGGGAAAAAGGGGGAAAAAGGGGGAAAAAGGGGGAAAAAGGGGGAAAAA +TTTTTGGGGGTTTTTGGGGGTTTTTGGGGGTTTTTGGGGGTTTTTGGGGGTTTTTGGGGGTTTTTGGGGGTTTTTGGGGGTTTTTGGGGGTTTTTGGGGG + + +; + +END; \ No newline at end of file diff --git a/tools/amas/test-data/outputs/expected_partitions_int.txt b/tools/amas/test-data/outputs/expected_partitions_int.txt new file mode 100644 index 00000000000..167a478b3c1 --- /dev/null +++ b/tools/amas/test-data/outputs/expected_partitions_int.txt @@ -0,0 +1,2 @@ +p1_concat_int_1 = 1-300 +p2_concat_int_2 = 301-600 From 6d18f6b0862b3381b7617b19317518c4d3d31995 Mon Sep 17 00:00:00 2001 From: jch Date: Thu, 27 Nov 2025 23:17:14 +1100 Subject: [PATCH 64/77] draft: cleaner but less informative --- tools/amas/check_interleaved.py | 6 ++---- tools/amas/macros.xml | 12 ++---------- 2 files changed, 4 insertions(+), 14 deletions(-) diff --git a/tools/amas/check_interleaved.py b/tools/amas/check_interleaved.py index 125e4edf0b8..c16a566d1f9 100644 --- a/tools/amas/check_interleaved.py +++ b/tools/amas/check_interleaved.py @@ -110,11 +110,9 @@ def main(): # Determine overall status if all(interleaved_status): - print("True") - return 0 + return 0 # Exit code 0 = interleaved else: - print("False") - return 0 + return 1 # Exit code 1 = sequential if __name__ == '__main__': sys.exit(main()) \ No newline at end of file diff --git a/tools/amas/macros.xml b/tools/amas/macros.xml index 1a249ba59c0..03cf9807bd2 100644 --- a/tools/amas/macros.xml +++ b/tools/amas/macros.xml @@ -15,23 +15,15 @@ &2; - - ## Determine input format with -int suffix if needed - if [ "\$INTERLEAVED" = "True" ]; then + --format $in_format; then IN_FORMAT="${in_format}-int"; else IN_FORMAT="${in_format}"; fi; - - echo "\$IN_FORMAT" >&2; ]]> Date: Thu, 27 Nov 2025 23:43:09 +1100 Subject: [PATCH 65/77] draft: removed interleave from input formats --- tools/amas/macros.xml | 6 ++---- 1 file changed, 2 insertions(+), 4 deletions(-) diff --git a/tools/amas/macros.xml b/tools/amas/macros.xml index 03cf9807bd2..1214eef31c0 100644 --- a/tools/amas/macros.xml +++ b/tools/amas/macros.xml @@ -44,10 +44,8 @@ - - - - + + From 71a5be4921431a8136fd55e563bc6f98f96e6a74 Mon Sep 17 00:00:00 2001 From: jch Date: Fri, 28 Nov 2025 13:52:24 +1100 Subject: [PATCH 66/77] draft: changed python script to iterate line by line instead of loading whole file --- tools/amas/amas_concat.xml | 13 +++- tools/amas/check_interleaved.py | 126 ++++++++++++++------------------ 2 files changed, 68 insertions(+), 71 deletions(-) diff --git a/tools/amas/amas_concat.xml b/tools/amas/amas_concat.xml index 5489d3e64cf..91ec49f438a 100644 --- a/tools/amas/amas_concat.xml +++ b/tools/amas/amas_concat.xml @@ -88,8 +88,8 @@ + - @@ -99,6 +99,17 @@ + + + + + + + + + + + ntax: + return True + else: + if line.strip(): + seq_lines += 1 + return False - - data_lines = lines[1:] - - # If we have more data lines than ntax, it's interleaved - if len(data_lines) > ntax: - return True - - return False def check_nexus_interleaved(filepath): """Check if NEXUS file is interleaved.""" + block_flag = False + seq_flag = False + seq_lines = 0 + with io.open(filepath, 'r') as f: - content = f.read().lower() - - # Primary check: Look for explicit interleave keyword - # Matches: 'interleave', 'interleave;', 'interleave=yes' - # Not match: 'interleave=no' - # NOTE: may be other ways interleave can be expressed in Format - pattern = r'\binterleave(;|=yes)?\b' - if re.search(pattern, content): - return True - - # Backup check: Parse dimensions and count data lines - # Look for dimensions: "Dimensions ntax=10 nchar=234" - dim_match = re.search(r'dimensions\s+ntax=(\d+)\s+nchar=(\d+)', - content) - if not dim_match: - return False - - ntax = int(dim_match.group(1)) - - # Find Matrix section - matrix_match = re.search(r'\bmatrix\b', content) - if not matrix_match: - return False - - matrix_start = matrix_match.end() - - # Find END; after matrix - end_match = re.search(r'\bend\s*;', content[matrix_start:]) - if not end_match: - return False - - matrix_end = matrix_start + end_match.start() - - matrix_content = content[matrix_start:matrix_end] - - lines = matrix_content.split('\n') - data_line_count = 0 - for line in lines: - stripped = line.strip() - if stripped and stripped != ';': - data_line_count += 1 - - # If more data lines than ntax, it's interleaved - return data_line_count > ntax + for line in f: + content = line.lower().strip() + + if not content: + continue + + if seq_flag: + # Could shorten this to just `if content == 'end;':` + if content == 'end;' and (seq_lines == ntax): + return False + if content and content != ';': + seq_lines += 1 + if seq_lines > ntax: + return True + + split_content = content.split() + + if block_flag: + if split_content[0] == 'dimensions': + # Will check for 'ntax=(int)'; position may not always be the same + ntax = int(re.search(r'ntax=(\d+)', content).group(1)) + + elif split_content[0] == 'format': + # NOTE: may be other ways interleave can be expressed in Format + # Will match 'interleave', 'interleave;', 'interleave=yes', 'interleave=yes;' + if re.search(r'\binterleave(;|=yes|=yes;)?\b', content): + return True + + elif split_content[0] == 'matrix': + seq_flag = True + + # Need to make sure the block isn't a TAXA block that contains taxa info but no sequence info + if split_content[0] == 'begin': + if (split_content[1] == 'data;') or (split_content[1] == 'characters;'): + block_flag = True + def check_fasta_interleaved(filepath): """FASTA files are not interleaved.""" @@ -96,19 +83,18 @@ def main(): args = parser.parse_args() - # Check all files interleaved_status = [] for filepath in args.input_files: if args.format == 'phylip': is_interleaved = check_phylip_interleaved(filepath) elif args.format == 'nexus': is_interleaved = check_nexus_interleaved(filepath) - else: # fasta + else: is_interleaved = check_fasta_interleaved(filepath) interleaved_status.append(is_interleaved) - # Determine overall status + # NOTE: Do we need to check all files? if all(interleaved_status): return 0 # Exit code 0 = interleaved else: From e40a22ed768f4c16bb2e0ae16d6abd9cd13f88a8 Mon Sep 17 00:00:00 2001 From: jch Date: Fri, 28 Nov 2025 13:52:44 +1100 Subject: [PATCH 67/77] draft: added test data for nexus interleave check --- tools/amas/test-data/inputs/concat_int_1.nex | 22 +++++++++++++++++++ tools/amas/test-data/inputs/concat_int_2.nex | 19 ++++++++++++++++ tools/amas/test-data/inputs/concat_int_3.nex | 16 ++++++++++++++ .../outputs/expected_concat_int_multi.nex | 18 +++++++++++++++ .../outputs/expected_partitions_int_multi.txt | 3 +++ 5 files changed, 78 insertions(+) create mode 100644 tools/amas/test-data/inputs/concat_int_1.nex create mode 100644 tools/amas/test-data/inputs/concat_int_2.nex create mode 100644 tools/amas/test-data/inputs/concat_int_3.nex create mode 100644 tools/amas/test-data/outputs/expected_concat_int_multi.nex create mode 100644 tools/amas/test-data/outputs/expected_partitions_int_multi.txt diff --git a/tools/amas/test-data/inputs/concat_int_1.nex b/tools/amas/test-data/inputs/concat_int_1.nex new file mode 100644 index 00000000000..a70889bfe2a --- /dev/null +++ b/tools/amas/test-data/inputs/concat_int_1.nex @@ -0,0 +1,22 @@ +#NEXUS + +BEGIN DATA; + DIMENSIONS NTAX=3 NCHAR=300; + FORMAT INTERLEAVE DATATYPE=DNA GAP = - MISSING = ?; + MATRIX +Taxon_A ATGCATGCATATGCATGCATATGCATGCATATGCATGCATATGCATGCATATGCATGCATATGCATGCATATGCATGCATATGCATGCATATGCATGCAT +Taxon_B GCTAGCTAGTGCTAGCTAGTGCTAGCTAGTGCTAGCTAGTGCTAGCTAGTGCTAGCTAGTGCTAGCTAGTGCTAGCTAGTGCTAGCTAGTGCTAGCTAGT +Taxon_C TTAGCTAGCTTTAGCTAGCTTTAGCTAGCTTTAGCTAGCTTTAGCTAGCTTTAGCTAGCTTTAGCTAGCTTTAGCTAGCTTTAGCTAGCTTTAGCTAGCT + +Taxon_A ATGCATGCATATGCATGCATATGCATGCATATGCATGCATATGCATGCATATGCATGCATATGCATGCATATGCATGCATATGCATGCATATGCATGCAT +Taxon_B GCTAGCTAGTGCTAGCTAGTGCTAGCTAGTGCTAGCTAGTGCTAGCTAGTGCTAGCTAGTGCTAGCTAGTGCTAGCTAGTGCTAGCTAGTGCTAGCTAGT +Taxon_C TTAGCTAGCTTTAGCTAGCTTTAGCTAGCTTTAGCTAGCTTTAGCTAGCTTTAGCTAGCTTTAGCTAGCTTTAGCTAGCTTTAGCTAGCTTTAGCTAGCT + +Taxon_A ATGCATGCATATGCATGCATATGCATGCATATGCATGCATATGCATGCATATGCATGCATATGCATGCATATGCATGCATATGCATGCATATGCATGCAT +Taxon_B GCTAGCTAGTGCTAGCTAGTGCTAGCTAGTGCTAGCTAGTGCTAGCTAGTGCTAGCTAGTGCTAGCTAGTGCTAGCTAGTGCTAGCTAGTGCTAGCTAGT +Taxon_C TTAGCTAGCTTTAGCTAGCTTTAGCTAGCTTTAGCTAGCTTTAGCTAGCTTTAGCTAGCTTTAGCTAGCTTTAGCTAGCTTTAGCTAGCTTTAGCTAGCT + + +; + +END; \ No newline at end of file diff --git a/tools/amas/test-data/inputs/concat_int_2.nex b/tools/amas/test-data/inputs/concat_int_2.nex new file mode 100644 index 00000000000..c8291be9700 --- /dev/null +++ b/tools/amas/test-data/inputs/concat_int_2.nex @@ -0,0 +1,19 @@ +#NEXUS + +Begin data; + Dimensions Nchar=300 Ntax=3; + Format Datatype=DNA Gap = - Missing = ? Interleave=yes; + matrix +Taxon_A AAAAACCCCCAAAAACCCCCAAAAACCCCCAAAAACCCCCAAAAACCCCCAAAAACCCCCAAAAACCCCCAAAAACCCCCAAAAACCCCCAAAAACCCCC +Taxon_B GGGGGAAAAAGGGGGAAAAAGGGGGAAAAAGGGGGAAAAAGGGGGAAAAAGGGGGAAAAAGGGGGAAAAAGGGGGAAAAAGGGGGAAAAAGGGGGAAAAA +Taxon_C TTTTTGGGGGTTTTTGGGGGTTTTTGGGGGTTTTTGGGGGTTTTTGGGGGTTTTTGGGGGTTTTTGGGGGTTTTTGGGGGTTTTTGGGGGTTTTTGGGGG + +Taxon_A GGGGGTTTTTGGGGGTTTTTGGGGGTTTTTGGGGGTTTTTGGGGGTTTTTGGGGGTTTTTGGGGGTTTTTGGGGGTTTTTGGGGGTTTTTGGGGGTTTTT +Taxon_B CCCCCTTTTTCCCCCTTTTTCCCCCTTTTTCCCCCTTTTTCCCCCTTTTTCCCCCTTTTTCCCCCTTTTTCCCCCTTTTTCCCCCTTTTTCCCCCTTTTT +Taxon_C AAAAACCCCCAAAAACCCCCAAAAACCCCCAAAAACCCCCAAAAACCCCCAAAAACCCCCAAAAACCCCCAAAAACCCCCAAAAACCCCCAAAAACCCCC + +Taxon_A AAAAACCCCCAAAAACCCCCAAAAACCCCCAAAAACCCCCAAAAACCCCCAAAAACCCCCAAAAACCCCCAAAAACCCCCAAAAACCCCCAAAAACCCCC +Taxon_B GGGGGAAAAAGGGGGAAAAAGGGGGAAAAAGGGGGAAAAAGGGGGAAAAAGGGGGAAAAAGGGGGAAAAAGGGGGAAAAAGGGGGAAAAAGGGGGAAAAA +Taxon_C TTTTTGGGGGTTTTTGGGGGTTTTTGGGGGTTTTTGGGGGTTTTTGGGGGTTTTTGGGGGTTTTTGGGGGTTTTTGGGGGTTTTTGGGGGTTTTTGGGGG +; +End; \ No newline at end of file diff --git a/tools/amas/test-data/inputs/concat_int_3.nex b/tools/amas/test-data/inputs/concat_int_3.nex new file mode 100644 index 00000000000..fa3883a5db3 --- /dev/null +++ b/tools/amas/test-data/inputs/concat_int_3.nex @@ -0,0 +1,16 @@ +#NEXUS + +begin data; + dimensions nchar=200 ntax=3; + format datatype=DNA gap = - missing = ?; + matrix +Taxon_A AAAAACCCCCAAAAACCCCCAAAAACCCCCAAAAACCCCCAAAAACCCCCAAAAACCCCCAAAAACCCCCAAAAACCCCCAAAAACCCCCAAAAACCCCC +Taxon_B GGGGGAAAAAGGGGGAAAAAGGGGGAAAAAGGGGGAAAAAGGGGGAAAAAGGGGGAAAAAGGGGGAAAAAGGGGGAAAAAGGGGGAAAAAGGGGGAAAAA +Taxon_C TTTTTGGGGGTTTTTGGGGGTTTTTGGGGGTTTTTGGGGGTTTTTGGGGGTTTTTGGGGGTTTTTGGGGGTTTTTGGGGGTTTTTGGGGGTTTTTGGGGG + +Taxon_A GGGGGTTTTTGGGGGTTTTTGGGGGTTTTTGGGGGTTTTTGGGGGTTTTTGGGGGTTTTTGGGGGTTTTTGGGGGTTTTTGGGGGTTTTTGGGGGTTTTT +Taxon_B CCCCCTTTTTCCCCCTTTTTCCCCCTTTTTCCCCCTTTTTCCCCCTTTTTCCCCCTTTTTCCCCCTTTTTCCCCCTTTTTCCCCCTTTTTCCCCCTTTTT +Taxon_C AAAAACCCCCAAAAACCCCCAAAAACCCCCAAAAACCCCCAAAAACCCCCAAAAACCCCCAAAAACCCCCAAAAACCCCCAAAAACCCCCAAAAACCCCC + +; +end; \ No newline at end of file diff --git a/tools/amas/test-data/outputs/expected_concat_int_multi.nex b/tools/amas/test-data/outputs/expected_concat_int_multi.nex new file mode 100644 index 00000000000..ed23b62e3e0 --- /dev/null +++ b/tools/amas/test-data/outputs/expected_concat_int_multi.nex @@ -0,0 +1,18 @@ +#NEXUS + +BEGIN DATA; + DIMENSIONS NTAX=3 NCHAR=800; + FORMAT INTERLEAVE DATATYPE=DNA GAP = - MISSING = ?; + MATRIX +Taxon_A ATGCATGCATATGCATGCATATGCATGCATATGCATGCATATGCATGCATATGCATGCATATGCATGCATATGCATGCATATGCATGCATATGCATGCATATGCATGCATATGCATGCATATGCATGCATATGCATGCATATGCATGCATATGCATGCATATGCATGCATATGCATGCATATGCATGCATATGCATGCATATGCATGCATATGCATGCATATGCATGCATATGCATGCATATGCATGCATATGCATGCATATGCATGCATATGCATGCATATGCATGCATATGCATGCATAAAAACCCCCAAAAACCCCCAAAAACCCCCAAAAACCCCCAAAAACCCCCAAAAACCCCCAAAAACCCCCAAAAACCCCCAAAAACCCCCAAAAACCCCCGGGGGTTTTTGGGGGTTTTTGGGGGTTTTTGGGGGTTTTTGGGGGTTTTTGGGGGTTTTTGGGGGTTTTTGGGGGTTTTTGGGGGTTTTTGGGGGTTTTT +Taxon_B GCTAGCTAGTGCTAGCTAGTGCTAGCTAGTGCTAGCTAGTGCTAGCTAGTGCTAGCTAGTGCTAGCTAGTGCTAGCTAGTGCTAGCTAGTGCTAGCTAGTGCTAGCTAGTGCTAGCTAGTGCTAGCTAGTGCTAGCTAGTGCTAGCTAGTGCTAGCTAGTGCTAGCTAGTGCTAGCTAGTGCTAGCTAGTGCTAGCTAGTGCTAGCTAGTGCTAGCTAGTGCTAGCTAGTGCTAGCTAGTGCTAGCTAGTGCTAGCTAGTGCTAGCTAGTGCTAGCTAGTGCTAGCTAGTGCTAGCTAGTGGGGGAAAAAGGGGGAAAAAGGGGGAAAAAGGGGGAAAAAGGGGGAAAAAGGGGGAAAAAGGGGGAAAAAGGGGGAAAAAGGGGGAAAAAGGGGGAAAAACCCCCTTTTTCCCCCTTTTTCCCCCTTTTTCCCCCTTTTTCCCCCTTTTTCCCCCTTTTTCCCCCTTTTTCCCCCTTTTTCCCCCTTTTTCCCCCTTTTT +Taxon_C TTAGCTAGCTTTAGCTAGCTTTAGCTAGCTTTAGCTAGCTTTAGCTAGCTTTAGCTAGCTTTAGCTAGCTTTAGCTAGCTTTAGCTAGCTTTAGCTAGCTTTAGCTAGCTTTAGCTAGCTTTAGCTAGCTTTAGCTAGCTTTAGCTAGCTTTAGCTAGCTTTAGCTAGCTTTAGCTAGCTTTAGCTAGCTTTAGCTAGCTTTAGCTAGCTTTAGCTAGCTTTAGCTAGCTTTAGCTAGCTTTAGCTAGCTTTAGCTAGCTTTAGCTAGCTTTAGCTAGCTTTAGCTAGCTTTAGCTAGCTTTTTTGGGGGTTTTTGGGGGTTTTTGGGGGTTTTTGGGGGTTTTTGGGGGTTTTTGGGGGTTTTTGGGGGTTTTTGGGGGTTTTTGGGGGTTTTTGGGGGAAAAACCCCCAAAAACCCCCAAAAACCCCCAAAAACCCCCAAAAACCCCCAAAAACCCCCAAAAACCCCCAAAAACCCCCAAAAACCCCCAAAAACCCCC + +AAAAACCCCCAAAAACCCCCAAAAACCCCCAAAAACCCCCAAAAACCCCCAAAAACCCCCAAAAACCCCCAAAAACCCCCAAAAACCCCCAAAAACCCCCAAAAACCCCCAAAAACCCCCAAAAACCCCCAAAAACCCCCAAAAACCCCCAAAAACCCCCAAAAACCCCCAAAAACCCCCAAAAACCCCCAAAAACCCCCGGGGGTTTTTGGGGGTTTTTGGGGGTTTTTGGGGGTTTTTGGGGGTTTTTGGGGGTTTTTGGGGGTTTTTGGGGGTTTTTGGGGGTTTTTGGGGGTTTTT +GGGGGAAAAAGGGGGAAAAAGGGGGAAAAAGGGGGAAAAAGGGGGAAAAAGGGGGAAAAAGGGGGAAAAAGGGGGAAAAAGGGGGAAAAAGGGGGAAAAAGGGGGAAAAAGGGGGAAAAAGGGGGAAAAAGGGGGAAAAAGGGGGAAAAAGGGGGAAAAAGGGGGAAAAAGGGGGAAAAAGGGGGAAAAAGGGGGAAAAACCCCCTTTTTCCCCCTTTTTCCCCCTTTTTCCCCCTTTTTCCCCCTTTTTCCCCCTTTTTCCCCCTTTTTCCCCCTTTTTCCCCCTTTTTCCCCCTTTTT +TTTTTGGGGGTTTTTGGGGGTTTTTGGGGGTTTTTGGGGGTTTTTGGGGGTTTTTGGGGGTTTTTGGGGGTTTTTGGGGGTTTTTGGGGGTTTTTGGGGGTTTTTGGGGGTTTTTGGGGGTTTTTGGGGGTTTTTGGGGGTTTTTGGGGGTTTTTGGGGGTTTTTGGGGGTTTTTGGGGGTTTTTGGGGGTTTTTGGGGGAAAAACCCCCAAAAACCCCCAAAAACCCCCAAAAACCCCCAAAAACCCCCAAAAACCCCCAAAAACCCCCAAAAACCCCCAAAAACCCCCAAAAACCCCC + + +; + +END; \ No newline at end of file diff --git a/tools/amas/test-data/outputs/expected_partitions_int_multi.txt b/tools/amas/test-data/outputs/expected_partitions_int_multi.txt new file mode 100644 index 00000000000..5eb6fc53fe3 --- /dev/null +++ b/tools/amas/test-data/outputs/expected_partitions_int_multi.txt @@ -0,0 +1,3 @@ +p1_concat_int_1 = 1-300 +p2_concat_int_2 = 301-600 +p3_concat_int_3 = 601-800 From ae8d82582b5c8a0476c3411702614d57f6aba654 Mon Sep 17 00:00:00 2001 From: jch Date: Fri, 28 Nov 2025 14:33:13 +1100 Subject: [PATCH 68/77] draft: refactor to make more clean/efficient --- tools/amas/check_interleaved.py | 90 ++++++++++++++++----------------- 1 file changed, 44 insertions(+), 46 deletions(-) diff --git a/tools/amas/check_interleaved.py b/tools/amas/check_interleaved.py index 6d5321da18c..24d8c7c0dcb 100644 --- a/tools/amas/check_interleaved.py +++ b/tools/amas/check_interleaved.py @@ -8,65 +8,63 @@ def check_phylip_interleaved(filepath): """Check if PHYLIP file is interleaved.""" - seq_lines = 0 + with io.open(filepath) as f: + # First line is header: ntax nchar + header = next(f).strip().split() + ntax = int(header[0]) + + for idx, line in enumerate(f, 1): + if line.strip(): + if idx > ntax: + return True - with io.open(filepath, 'r') as f: - for i, line in enumerate(f): - # First line is header: ntax nchar - if i==0: - header = line[0].split() - ntax = int(header[0]) - elif seq_lines > ntax: - return True - else: - if line.strip(): - seq_lines += 1 - return False def check_nexus_interleaved(filepath): """Check if NEXUS file is interleaved.""" - block_flag = False - seq_flag = False + in_data_block = False + in_matrix = False + ntax = None seq_lines = 0 - + with io.open(filepath, 'r') as f: for line in f: - content = line.lower().strip() - + content = line.strip().lower() + if not content: continue - - if seq_flag: - # Could shorten this to just `if content == 'end;':` - if content == 'end;' and (seq_lines == ntax): - return False - if content and content != ';': + + if in_matrix: + if content == 'end;': + return seq_lines != ntax if ntax else False + + if content != ';': seq_lines += 1 - if seq_lines > ntax: - return True - - split_content = content.split() - - if block_flag: - if split_content[0] == 'dimensions': - # Will check for 'ntax=(int)'; position may not always be the same - ntax = int(re.search(r'ntax=(\d+)', content).group(1)) - - elif split_content[0] == 'format': - # NOTE: may be other ways interleave can be expressed in Format - # Will match 'interleave', 'interleave;', 'interleave=yes', 'interleave=yes;' - if re.search(r'\binterleave(;|=yes|=yes;)?\b', content): + if ntax and seq_lines > ntax: return True - - elif split_content[0] == 'matrix': - seq_flag = True + continue - # Need to make sure the block isn't a TAXA block that contains taxa info but no sequence info - if split_content[0] == 'begin': - if (split_content[1] == 'data;') or (split_content[1] == 'characters;'): - block_flag = True - + if not in_data_block: + if content.startswith('begin'): + words = content.split() + if len(words) > 1 and (words[1].startswith('data') or + words[1].startswith('characters')): + in_data_block = True + continue + + if content.startswith('dimensions') and ntax is None: + match = re.search(r'ntax=(\d+)', content) + if match: + ntax = int(match.group(1)) + + elif content.startswith('format'): + if re.search(r'\binterleave(?:;|=yes;?)?\b', content): + return True + + elif content.startswith('matrix'): + in_matrix = True + + return False def check_fasta_interleaved(filepath): """FASTA files are not interleaved.""" From 2ea8f01818465c6398de1426df5ce24b9054f505 Mon Sep 17 00:00:00 2001 From: jch Date: Fri, 28 Nov 2025 14:43:00 +1100 Subject: [PATCH 69/77] draft: fix python flake8 lint --- tools/amas/check_interleaved.py | 42 +++++++++++++++++++-------------- 1 file changed, 24 insertions(+), 18 deletions(-) diff --git a/tools/amas/check_interleaved.py b/tools/amas/check_interleaved.py index 24d8c7c0dcb..578453eedc8 100644 --- a/tools/amas/check_interleaved.py +++ b/tools/amas/check_interleaved.py @@ -6,6 +6,7 @@ import re import sys + def check_phylip_interleaved(filepath): """Check if PHYLIP file is interleaved.""" with io.open(filepath) as f: @@ -20,67 +21,71 @@ def check_phylip_interleaved(filepath): return False + def check_nexus_interleaved(filepath): """Check if NEXUS file is interleaved.""" in_data_block = False in_matrix = False ntax = None seq_lines = 0 - + with io.open(filepath, 'r') as f: for line in f: content = line.strip().lower() - + if not content: continue - + if in_matrix: if content == 'end;': return seq_lines != ntax if ntax else False - + if content != ';': seq_lines += 1 if ntax and seq_lines > ntax: return True continue - + if not in_data_block: if content.startswith('begin'): words = content.split() - if len(words) > 1 and (words[1].startswith('data') or - words[1].startswith('characters')): + if len(words) > 1 and ( + words[1].startswith('data') or + words[1].startswith('characters')): in_data_block = True continue - + if content.startswith('dimensions') and ntax is None: match = re.search(r'ntax=(\d+)', content) if match: ntax = int(match.group(1)) - + elif content.startswith('format'): if re.search(r'\binterleave(?:;|=yes;?)?\b', content): return True - + elif content.startswith('matrix'): in_matrix = True - + return False + def check_fasta_interleaved(filepath): """FASTA files are not interleaved.""" return False + def main(): parser = argparse.ArgumentParser( description='Check if AMAS input files are interleaved' ) parser.add_argument('input_files', nargs='+', help='Input sequence files') parser.add_argument('--format', required=True, - choices=['fasta', 'phylip', 'nexus'], - help='Input format') - + choices=['fasta', 'phylip', 'nexus'], + help='Input format') + args = parser.parse_args() - + interleaved_status = [] for filepath in args.input_files: if args.format == 'phylip': @@ -89,14 +94,15 @@ def main(): is_interleaved = check_nexus_interleaved(filepath) else: is_interleaved = check_fasta_interleaved(filepath) - + interleaved_status.append(is_interleaved) - + # NOTE: Do we need to check all files? if all(interleaved_status): return 0 # Exit code 0 = interleaved else: return 1 # Exit code 1 = sequential + if __name__ == '__main__': - sys.exit(main()) \ No newline at end of file + sys.exit(main()) From 9db5d83a7f94377e18980c8a10ada90cfa0777ca Mon Sep 17 00:00:00 2001 From: jch Date: Fri, 28 Nov 2025 15:07:40 +1100 Subject: [PATCH 70/77] draft: fix python flake8 w504 lint --- tools/amas/check_interleaved.py | 4 ++-- 1 file changed, 2 insertions(+), 2 deletions(-) diff --git a/tools/amas/check_interleaved.py b/tools/amas/check_interleaved.py index 578453eedc8..f73bae8f4a3 100644 --- a/tools/amas/check_interleaved.py +++ b/tools/amas/check_interleaved.py @@ -50,8 +50,8 @@ def check_nexus_interleaved(filepath): if content.startswith('begin'): words = content.split() if len(words) > 1 and ( - words[1].startswith('data') or - words[1].startswith('characters')): + words[1].startswith('data') + or words[1].startswith('characters')): in_data_block = True continue From ce8812f752b753530ffba2d6052a9d8ad399ce5c Mon Sep 17 00:00:00 2001 From: jch Date: Fri, 28 Nov 2025 15:38:56 +1100 Subject: [PATCH 71/77] draft: removed io usage and added utf-8 encoding --- tools/amas/check_interleaved.py | 5 ++--- 1 file changed, 2 insertions(+), 3 deletions(-) diff --git a/tools/amas/check_interleaved.py b/tools/amas/check_interleaved.py index f73bae8f4a3..766ce32de81 100644 --- a/tools/amas/check_interleaved.py +++ b/tools/amas/check_interleaved.py @@ -2,14 +2,13 @@ Helper script to check if AMAS input files are interleaved. """ import argparse -import io import re import sys def check_phylip_interleaved(filepath): """Check if PHYLIP file is interleaved.""" - with io.open(filepath) as f: + with open(filepath, encoding='utf-8') as f: # First line is header: ntax nchar header = next(f).strip().split() ntax = int(header[0]) @@ -29,7 +28,7 @@ def check_nexus_interleaved(filepath): ntax = None seq_lines = 0 - with io.open(filepath, 'r') as f: + with open(filepath, encoding='utf-8') as f: for line in f: content = line.strip().lower() From db929eb0ddbbe6825a199df6b1dd0ba8f5200e67 Mon Sep 17 00:00:00 2001 From: jch Date: Mon, 1 Dec 2025 17:21:57 +1100 Subject: [PATCH 72/77] feat: added check for interleaved files --- tools/amas/check_interleaved.py | 13 +++++++++---- tools/amas/macros.xml | 8 ++------ 2 files changed, 11 insertions(+), 10 deletions(-) diff --git a/tools/amas/check_interleaved.py b/tools/amas/check_interleaved.py index 766ce32de81..102c64713da 100644 --- a/tools/amas/check_interleaved.py +++ b/tools/amas/check_interleaved.py @@ -96,11 +96,16 @@ def main(): interleaved_status.append(is_interleaved) - # NOTE: Do we need to check all files? - if all(interleaved_status): - return 0 # Exit code 0 = interleaved + interleaved_status = list(set(interleaved_status)) + if len(interleaved_status) > 1: + raise Exception("Error: Input files are a mix of interleaved/sequential formats") + + if interleaved_status[0]: + print(f"{args.format}-int") else: - return 1 # Exit code 1 = sequential + print(args.format) + + return 0 if __name__ == '__main__': diff --git a/tools/amas/macros.xml b/tools/amas/macros.xml index 1214eef31c0..6db5d497828 100644 --- a/tools/amas/macros.xml +++ b/tools/amas/macros.xml @@ -15,15 +15,11 @@ Date: Mon, 1 Dec 2025 17:27:23 +1100 Subject: [PATCH 73/77] feat: added interleaved check to all subcommands --- tools/amas/amas_remove.xml | 2 ++ tools/amas/amas_replicate.xml | 2 ++ tools/amas/amas_split.xml | 5 +++++ tools/amas/amas_summary.xml | 2 ++ 4 files changed, 11 insertions(+) diff --git a/tools/amas/amas_remove.xml b/tools/amas/amas_remove.xml index e7fa7bad8e7..c8b755ec549 100644 --- a/tools/amas/amas_remove.xml +++ b/tools/amas/amas_remove.xml @@ -16,6 +16,8 @@ #import re set -eu; + @CHECK_INTERLEAVED@ + @SYMLINK_INPUTS@ python -m amas.AMAS diff --git a/tools/amas/amas_replicate.xml b/tools/amas/amas_replicate.xml index 03ebd3cd6c1..ba58b05590d 100644 --- a/tools/amas/amas_replicate.xml +++ b/tools/amas/amas_replicate.xml @@ -16,6 +16,8 @@ #import re set -eu; + @CHECK_INTERLEAVED@ + @SYMLINK_INPUTS@ python -m amas.AMAS diff --git a/tools/amas/amas_split.xml b/tools/amas/amas_split.xml index e588484fc3d..69714760cd2 100644 --- a/tools/amas/amas_split.xml +++ b/tools/amas/amas_split.xml @@ -16,6 +16,11 @@ #import re set -eu; + ## Check if inputs are interleaved + IN_FORMAT=\$(python '$__tool_directory__/check_interleaved.py' + '${input_file}' + --format $in_format) && + ## Create symlinks with original filename for consistent tests because ## input filenames are used as str vars #set $safename_input = re.sub('[^\w\-_\.]', '_', $input_file.element_identifier) diff --git a/tools/amas/amas_summary.xml b/tools/amas/amas_summary.xml index 127baf63213..9ae15fd920c 100644 --- a/tools/amas/amas_summary.xml +++ b/tools/amas/amas_summary.xml @@ -16,6 +16,8 @@ #import re set -eu; + @CHECK_INTERLEAVED@ + @SYMLINK_INPUTS@ python -m amas.AMAS From 882c57620986b6bc4bd1eddd687a4b8e5f8f3b2b Mon Sep 17 00:00:00 2001 From: jch Date: Tue, 2 Dec 2025 18:55:13 +1100 Subject: [PATCH 74/77] fix: remove input format macro --- tools/amas/amas_concat.xml | 5 ----- tools/amas/amas_remove.xml | 1 - tools/amas/amas_replicate.xml | 1 - tools/amas/amas_split.xml | 1 - tools/amas/amas_summary.xml | 1 - tools/amas/macros.xml | 14 +++++--------- 6 files changed, 5 insertions(+), 18 deletions(-) diff --git a/tools/amas/amas_concat.xml b/tools/amas/amas_concat.xml index 91ec49f438a..2287e2ea263 100644 --- a/tools/amas/amas_concat.xml +++ b/tools/amas/amas_concat.xml @@ -37,7 +37,6 @@ - @@ -72,7 +71,6 @@ - @@ -82,7 +80,6 @@ - @@ -93,7 +90,6 @@ - @@ -104,7 +100,6 @@ - diff --git a/tools/amas/amas_remove.xml b/tools/amas/amas_remove.xml index c8b755ec549..d3765b3be98 100644 --- a/tools/amas/amas_remove.xml +++ b/tools/amas/amas_remove.xml @@ -38,7 +38,6 @@ - diff --git a/tools/amas/amas_replicate.xml b/tools/amas/amas_replicate.xml index ba58b05590d..c59e735635e 100644 --- a/tools/amas/amas_replicate.xml +++ b/tools/amas/amas_replicate.xml @@ -35,7 +35,6 @@ - diff --git a/tools/amas/amas_split.xml b/tools/amas/amas_split.xml index 69714760cd2..3776cc3be41 100644 --- a/tools/amas/amas_split.xml +++ b/tools/amas/amas_split.xml @@ -40,7 +40,6 @@ - - diff --git a/tools/amas/macros.xml b/tools/amas/macros.xml index 6db5d497828..751809f2b30 100644 --- a/tools/amas/macros.xml +++ b/tools/amas/macros.xml @@ -15,11 +15,15 @@ - - - - - - - - From 1e28a2707002bbd8b1d75663503168056c79a350 Mon Sep 17 00:00:00 2001 From: jch Date: Tue, 2 Dec 2025 19:25:05 +1100 Subject: [PATCH 75/77] fix: fixed phylip split test input file --- tools/amas/amas_split.xml | 14 +++++++++++--- 1 file changed, 11 insertions(+), 3 deletions(-) diff --git a/tools/amas/amas_split.xml b/tools/amas/amas_split.xml index 3776cc3be41..79534f613b6 100644 --- a/tools/amas/amas_split.xml +++ b/tools/amas/amas_split.xml @@ -16,10 +16,19 @@ #import re set -eu; + ## Debug: Show what Galaxy detected + echo "Input file: ${input_file}" && + echo "Input file ext: ${input_file.ext}" && + ## Check if inputs are interleaved + #set $in_format = $input_file.ext + #if $in_format == 'nex' + #set $in_format = 'nexus' + #end if + echo '$in_format' && IN_FORMAT=\$(python '$__tool_directory__/check_interleaved.py' '${input_file}' - --format $in_format) && + --format '${in_format}') && ## Create symlinks with original filename for consistent tests because ## input filenames are used as str vars @@ -32,7 +41,7 @@ $remove_empty --out-format $out_format --in-files $safename_input - --in-format $in_format + --in-format "\${IN_FORMAT}" --data-type $data_type --cores "\${GALAXY_SLOTS:-1}" $check_align @@ -59,7 +68,6 @@ - From e454c89202a61d2af9edd26ca065bb741e71cfea Mon Sep 17 00:00:00 2001 From: jch Date: Tue, 2 Dec 2025 19:26:19 +1100 Subject: [PATCH 76/77] fix: updated subcommands to use galaxy sniffer; removed input_format macro and from tests --- tools/amas/amas_remove.xml | 3 +-- tools/amas/amas_replicate.xml | 3 +-- tools/amas/amas_split.xml | 5 ----- tools/amas/amas_summary.xml | 3 +-- tools/amas/macros.xml | 4 ++-- tools/amas/test-data/inputs/concat_result.phylip | 2 +- 6 files changed, 6 insertions(+), 14 deletions(-) diff --git a/tools/amas/amas_remove.xml b/tools/amas/amas_remove.xml index d3765b3be98..964998797fc 100644 --- a/tools/amas/amas_remove.xml +++ b/tools/amas/amas_remove.xml @@ -29,7 +29,7 @@ --out-format $out_format --in-files @INPUT_FILENAMES@ - --in-format $in_format + --in-format "\${IN_FORMAT}" --data-type $data_type --cores "\${GALAXY_SLOTS:-1}" $check_align @@ -56,7 +56,6 @@ - diff --git a/tools/amas/amas_replicate.xml b/tools/amas/amas_replicate.xml index c59e735635e..7902dd1c6f3 100644 --- a/tools/amas/amas_replicate.xml +++ b/tools/amas/amas_replicate.xml @@ -26,7 +26,7 @@ --out-format $out_format --in-files @INPUT_FILENAMES@ - --in-format $in_format + --in-format "\${IN_FORMAT}" --data-type $data_type --cores "\${GALAXY_SLOTS:-1}" $check_align @@ -52,7 +52,6 @@ - diff --git a/tools/amas/amas_split.xml b/tools/amas/amas_split.xml index 79534f613b6..5fb322425e1 100644 --- a/tools/amas/amas_split.xml +++ b/tools/amas/amas_split.xml @@ -16,16 +16,11 @@ #import re set -eu; - ## Debug: Show what Galaxy detected - echo "Input file: ${input_file}" && - echo "Input file ext: ${input_file.ext}" && - ## Check if inputs are interleaved #set $in_format = $input_file.ext #if $in_format == 'nex' #set $in_format = 'nexus' #end if - echo '$in_format' && IN_FORMAT=\$(python '$__tool_directory__/check_interleaved.py' '${input_file}' --format '${in_format}') && diff --git a/tools/amas/amas_summary.xml b/tools/amas/amas_summary.xml index 30cbd8790c0..fef7e240ef6 100644 --- a/tools/amas/amas_summary.xml +++ b/tools/amas/amas_summary.xml @@ -25,7 +25,7 @@ $by_taxon --in-files @INPUT_FILENAMES@ - --in-format $in_format + --in-format "\${IN_FORMAT}" --data-type $data_type --cores "\${GALAXY_SLOTS:-1}" $check_align @@ -51,7 +51,6 @@ - diff --git a/tools/amas/macros.xml b/tools/amas/macros.xml index 751809f2b30..caef470f4dc 100644 --- a/tools/amas/macros.xml +++ b/tools/amas/macros.xml @@ -15,9 +15,9 @@ Date: Tue, 2 Dec 2025 19:32:28 +1100 Subject: [PATCH 77/77] refactor: moved sniff to separate macro --- tools/amas/amas_concat.xml | 2 ++ tools/amas/amas_remove.xml | 2 ++ tools/amas/amas_replicate.xml | 2 ++ tools/amas/amas_split.xml | 4 +++- tools/amas/amas_summary.xml | 2 ++ tools/amas/macros.xml | 7 +++++-- 6 files changed, 16 insertions(+), 3 deletions(-) diff --git a/tools/amas/amas_concat.xml b/tools/amas/amas_concat.xml index 2287e2ea263..84b4c68416a 100644 --- a/tools/amas/amas_concat.xml +++ b/tools/amas/amas_concat.xml @@ -16,6 +16,8 @@ #import re set -eu; + @SNIFF_INPUT_FORMAT@ + @CHECK_INTERLEAVED@ @SYMLINK_INPUTS@ diff --git a/tools/amas/amas_remove.xml b/tools/amas/amas_remove.xml index 964998797fc..14a0376b8fa 100644 --- a/tools/amas/amas_remove.xml +++ b/tools/amas/amas_remove.xml @@ -16,6 +16,8 @@ #import re set -eu; + @SNIFF_INPUT_FORMAT@ + @CHECK_INTERLEAVED@ @SYMLINK_INPUTS@ diff --git a/tools/amas/amas_replicate.xml b/tools/amas/amas_replicate.xml index 7902dd1c6f3..4dec81d3ded 100644 --- a/tools/amas/amas_replicate.xml +++ b/tools/amas/amas_replicate.xml @@ -16,6 +16,8 @@ #import re set -eu; + @SNIFF_INPUT_FORMAT@ + @CHECK_INTERLEAVED@ @SYMLINK_INPUTS@ diff --git a/tools/amas/amas_split.xml b/tools/amas/amas_split.xml index 5fb322425e1..5e114fc8060 100644 --- a/tools/amas/amas_split.xml +++ b/tools/amas/amas_split.xml @@ -16,11 +16,13 @@ #import re set -eu; - ## Check if inputs are interleaved + ## Let galaxy sniff input format #set $in_format = $input_file.ext #if $in_format == 'nex' #set $in_format = 'nexus' #end if + + ## Check if inputs are interleaved IN_FORMAT=\$(python '$__tool_directory__/check_interleaved.py' '${input_file}' --format '${in_format}') && diff --git a/tools/amas/amas_summary.xml b/tools/amas/amas_summary.xml index fef7e240ef6..f3f5a516758 100644 --- a/tools/amas/amas_summary.xml +++ b/tools/amas/amas_summary.xml @@ -16,6 +16,8 @@ #import re set -eu; + @SNIFF_INPUT_FORMAT@ + @CHECK_INTERLEAVED@ @SYMLINK_INPUTS@ diff --git a/tools/amas/macros.xml b/tools/amas/macros.xml index caef470f4dc..5d23a6c5d15 100644 --- a/tools/amas/macros.xml +++ b/tools/amas/macros.xml @@ -13,12 +13,15 @@ python -c "import amas; print(amas.__version__)" - + +