Skip to content

Question regarding Hyb output #10

@dstrib

Description

@dstrib

Hi! I am creating a new reference dataset for Hyb for use with my project, and I have a question about hybrids that are present with the original hOH7 database but are missing from my new output.

For the hOH7 the ".blast" output from the hyb pipeline contains the following records (and others):

405_1    ENSG00000055609_ENST00000262189_MLL3_mRNA   100.00  32  0   0   44  75  1174    1205    4.3e-09 60.2
405_1    MIMAT0000244_MirBase_miR-30c_microRNA   100.00  22  0   0   23  44  1   22  0.0016  41.7

Result:
405_1 AAAAAAGTGTGTGTGTGTGTATTGTAAACATCCTACACTCTCAGATTTCAGTCACATCTTCCTGCTTTGTCCAGA . MIMAT0000244_MirBase_miR-30c_microRNA 23 44 1 22 0.0016 ENSG00000055609_ENST00000262189_MLL3_mRNA 44 75 1174 1205 4.3e-09

For the updated database, the ".blast" output from the hyb pipeline contains the following records (and others):

405_1    ENSG00000055609_ENST00000262189_KMT2C_mRNA  100.00  32  0   0   44  75  1172    1203    1.2e-08 60.2
405_1    MIMAT0000244_miRBase_hsa-miR-30c-5p_microRNA    100.00  22  0   0   23  44  1   22  0.0044  41.7

Result: no hybrid 405_1 is included in the output.

To make sure the e-val is not a problem, I used a setting of hval=100.0 when running hyb.
Presumably I would expect the second library to also provide a hybrid for the provided sequence given that there are compatible blast results in both cases. Is there some other selection criteria I am missing that would prevent outputting of a record in the second case? If not, why would I not expect a hybrid output here?

Thanks much!

Metadata

Metadata

Assignees

No one assigned

    Labels

    No labels
    No labels

    Projects

    No projects

    Milestone

    No milestone

    Relationships

    None yet

    Development

    No branches or pull requests

    Issue actions