Support for trimming multiple adapter sequences

[sup27606]

Hi again,
Our library prep guidelines indicate that there are three different adapter sequences at the 3’ end of the reads that need to be trimmed in cutadapt. I was wondering if your pipeline has support for providing multiple sequences to the — adapter_threeprime parameter. If yes, how should we do it?

Our library prep guidelines (Diagenode D-Plex small RNA-Seq kit) suggest using cutadapt with the following command line:

cutadapt --trim-n --match-read-wildcards -u 16
-n 4 –a AGATCGGAAGAGCACACGTCTG -a AAAAAAAA -a
GAACTCCAGTCAC -e 0.2 --nextseq-trim 20 -m 15 –o
trimmed_reads.fastq.gz raw_reads_w_umi.fastq.gz

Thank you very much!

[iraiosub]

Hi! Sorry for the long delay, I missed this one earlier.
About your question:
Yes, the pipeline supports multiple 3′ adapters using the existing --adapter_threeprime parameter. You can pass multiple adapters using native Cutadapt syntax, for example:

--adapter_threeprime "AGATCGGAAGAGCACACGTCTG -a AAAAAAAA -a GAACTCCAGTCAC". Note that the first adapter doesn't need its own -a in front. And you can set --times_trimmed to 4.
Cutadapt will receive all three -a flags and trim them correctly, matching the Diagenode recommendations.
I may look into adding a cleaner syntax in the future, but for now the existing parameter already supports multiple adapters without any new features.