diff --git a/revdep/README.md b/revdep/README.md
index c8aaff235..7c15eed9b 100644
--- a/revdep/README.md
+++ b/revdep/README.md
@@ -1,102 +1,135 @@
# Revdeps
-## Failed to check (34)
+## New problems (128)
-|package |version |error |warning |note |
-|:-------------------|:---------|:-----|:-------|:----|
-|arealDB |0.9.4 |1 | | |
-|arules |? | | | |
-|atom4R |0.3-3 |1 | | |
-|bayesdfa |1.3.4 |1 | | |
-|ctsem |3.10.4 |1 | |1 |
-|dataone |2.2.2 |1 | | |
-|datapack |1.4.1 |1 | | |
-|DSMolgenisArmadillo |? | | | |
-|dsTidyverse |? | | | |
-|dsTidyverseClient |? | | | |
-|EcoEnsemble |1.1.2 |1 | | |
-|FAfA |0.3 |1 | | |
-|FAIRmaterials |0.4.2.1 |1 | | |
-|fdaPDE |1.1-21 |1 | | |
-|fio |0.1.6 |1 | | |
-|geess |? | | | |
-|gllvm |2.0.5 |1 | | |
-|gpboost |1.6.1 |1 | | |
-|gpuR |2.0.6 |1 | | |
-|loon.shiny |? | | | |
-|loon.tourr |? | | | |
-|metajam |0.3.1 |1 | | |
-|multinma |0.8.1 |1 | | |
-|OpenMx |? | | | |
-|rdflib |0.2.9 |1 | | |
-|recommenderlab |? | | | |
-|redland |1.0.17-18 |1 | | |
-|rstanarm |2.32.1 |1 | | |
-|SQLFormatteR |0.0.2 |1 | | |
-|string2path |0.2.2 |1 | | |
-|TestAnaAPP |1.1.2 |1 | | |
-|TriDimRegression |1.0.2 |1 | | |
-|xactonomial |1.0.3 |1 | | |
-|zen4R |0.10.2 |1 | | |
-
-## New problems (56)
-
-|package |version |error |warning |note |
-|:------------------|:-------|:--------|:-------|:------|
-|[aws.comprehend](problems.md#awscomprehend)|0.2.1 |__+1__ | | |
-|[bcRP](problems.md#bcrp)|1.0.1 |__+1__ | | |
-|[bindr](problems.md#bindr)|0.1.2 |__+1__ | | |
-|[conflr](problems.md#conflr)|0.1.1 |__+1__ | |2 |
-|[countdown](problems.md#countdown)|0.4.0 |__+1__ | |1 |
-|[covr](problems.md#covr)|3.6.4 |__+1__ | | |
-|[datarobot](problems.md#datarobot)|2.18.6 |__+1__ | | |
-|[digitize](problems.md#digitize)|0.0.4 |__+1__ | | |
-|[distro](problems.md#distro)|0.1.0 |__+1__ | |1 |
-|[esci](problems.md#esci)|1.0.7 | | |__+1__ |
-|[gen3sis](problems.md#gen3sis)|1.5.11 |__+1__ | |1 |
-|[geomorph](problems.md#geomorph)|4.0.10 | | |__+1__ |
-|[graphhopper](problems.md#graphhopper)|0.1.2 |__+1__ | |1 |
-|[handwriterRF](problems.md#handwriterrf)|1.1.1 |__+1__ | | |
-|[humanize](problems.md#humanize)|0.2.0 |__+1__ | |1 |
-|[ipaddress](problems.md#ipaddress)|1.0.2 |__+1__ | |1 |
-|[leaflet.minicharts](problems.md#leafletminicharts)|0.6.2 |__+1__ | | |
-|[learnr](problems.md#learnr)|0.11.5 |__+1__ | | |
-|[MakefileR](problems.md#makefiler)|1.0 |__+1__ | |1 |
-|[manipulateWidget](problems.md#manipulatewidget)|0.11.1 |__+1__ | |2 |
-|[mbbe](problems.md#mbbe)|0.1.0 |__+1__ | | |
-|[metaDigitise](problems.md#metadigitise)|1.0.1 |__+1__ | |1 |
-|[mknapsack](problems.md#mknapsack)|0.1.0 |__+1__ | | |
-|[mockery](problems.md#mockery)|0.4.4 |__+3__ | | |
-|[moexer](problems.md#moexer)|0.3.0 |__+1__ | | |
-|[MolgenisArmadillo](problems.md#molgenisarmadillo)|2.9.1 |__+1__ | | |
-|[NasdaqDataLink](problems.md#nasdaqdatalink)|1.0.0 |__+1__ | | |
-|[nhlapi](problems.md#nhlapi)|0.1.4 |__+1__ | |1 |
-|[owmr](problems.md#owmr)|0.8.2 |__+1__ | | |
-|[oxcAAR](problems.md#oxcaar)|1.1.1 |1 __+1__ | | |
-|[parameters](problems.md#parameters)|0.27.0 | | |__+1__ |
-|[passport](problems.md#passport)|0.3.0 |__+1__ | | |
-|[pocketapi](problems.md#pocketapi)|0.1 |__+1__ | |2 |
-|[projmgr](problems.md#projmgr)|0.1.1 |__+1__ | | |
-|[PubChemR](problems.md#pubchemr)|2.1.4 |1 __+1__ | |1 |
-|[Quandl](problems.md#quandl)|2.11.0 |__+1__ | | |
-|[REddyProc](problems.md#reddyproc)|1.3.3 | | |__+1__ |
-|[regmedint](problems.md#regmedint)|1.0.1 |__+1__ | |1 |
-|[Rexperigen](problems.md#rexperigen)|0.2.1 |__+1__ | |1 |
-|[rosetteApi](problems.md#rosetteapi)|1.14.4 |__+1__ | | |
-|[Rpolyhedra](problems.md#rpolyhedra)|0.5.6 |__+1__ | | |
-|[RPresto](problems.md#rpresto)|1.4.7 |__+1__ | | |
-|[RTD](problems.md#rtd)|0.4.1 |__+1__ | |1 |
-|[Ryacas0](problems.md#ryacas0)|0.4.4 |__+1__ | |2 |
-|[shiny.benchmark](problems.md#shinybenchmark)|0.1.1 |__+1__ | | |
-|[shinyShortcut](problems.md#shinyshortcut)|0.1.0 |__+1__ | |1 |
-|[skimr](problems.md#skimr)|2.1.5 |__+1__ | | |
-|[spaero](problems.md#spaero)|0.6.0 |__+1__ | |4 |
-|[starwarsdb](problems.md#starwarsdb)|0.1.2 |__+1__ | |1 |
-|[tangles](problems.md#tangles)|2.0.1 |__+1__ | | |
-|[texreg](problems.md#texreg)|1.39.4 |__+1__ |1 |2 |
-|[ThankYouStars](problems.md#thankyoustars)|0.2.0 |__+1__ | |1 |
-|[tinyProject](problems.md#tinyproject)|0.6.1 |__+1__ | | |
-|[tryCatchLog](problems.md#trycatchlog)|1.3.1 |__+1__ | |1 |
-|[WhatIf](problems.md#whatif)|1.5-10 |__+1__ | | |
-|[ZillowR](problems.md#zillowr)|1.0.0 |__+1__ | | |
+|package |version |error |warning |note |
+|:------------------|:-------|:--------|:-------|:----|
+|[adjclust](problems.md#adjclust)|0.6.10 |__+1__ | |1 |
+|[APackOfTheClones](problems.md#apackoftheclones)|1.3.0 |__+1__ | |1 |
+|[autodb](problems.md#autodb)|3.0.0 |__+1__ | | |
+|[aws.comprehend](problems.md#awscomprehend)|0.2.1 |__+1__ | | |
+|[bgmfiles](problems.md#bgmfiles)|0.0.6 |__+1__ | | |
+|[bindr](problems.md#bindr)|0.1.2 |__+1__ | | |
+|[caretEnsemble](problems.md#caretensemble)|4.0.1 |__+1__ | | |
+|[clinDataReview](problems.md#clindatareview)|1.6.2 |__+1__ | |1 |
+|[cnd](problems.md#cnd)|0.1.0 |__+1__ | | |
+|[coenocliner](problems.md#coenocliner)|0.2-3 |__+1__ | | |
+|[conflr](problems.md#conflr)|0.1.1 |__+1__ | |2 |
+|[countdown](problems.md#countdown)|0.4.0 |__+1__ | |1 |
+|[covdepGE](problems.md#covdepge)|1.0.1 |__+1__ | |1 |
+|[covr](problems.md#covr)|3.6.4 |__+1__ | | |
+|[datarobot](problems.md#datarobot)|2.18.6 |__+1__ | | |
+|[DiceKriging](problems.md#dicekriging)|1.6.0 |__+1__ | | |
+|[dictionar6](problems.md#dictionar6)|0.1.3 |__+1__ | | |
+|[difNLR](problems.md#difnlr)|1.5.1-4 |__+1__ | | |
+|[digitize](problems.md#digitize)|0.0.4 |__+1__ | | |
+|[disprofas](problems.md#disprofas)|0.2.1 |__+1__ | | |
+|[distances](problems.md#distances)|0.1.12 |__+1__ | | |
+|[distro](problems.md#distro)|0.1.0 |__+1__ | |1 |
+|[EDISON](problems.md#edison)|1.1.1 |__+1__ | | |
+|[ergm](problems.md#ergm)|4.10.1 |__+1__ | |1 |
+|[expstudy](problems.md#expstudy)|2.0.0 |__+1__ | | |
+|[fabletools](problems.md#fabletools)|0.5.1 |__+1__ | | |
+|[futile.logger](problems.md#futilelogger)|1.4.3 |__+1__ | | |
+|[ggeffects](problems.md#ggeffects)|2.3.1 |__+1__ | | |
+|[ggseg](problems.md#ggseg)|1.6.5 |__+1__ | |1 |
+|[gips](problems.md#gips)|1.2.3 |__+1__ | | |
+|[graphhopper](problems.md#graphhopper)|0.1.2 |__+1__ | |1 |
+|[greeks](problems.md#greeks)|1.4.4 |__+1__ | |1 |
+|[HandTill2001](problems.md#handtill2001)|1.0.2 |__+1__ |1 | |
+|[hdcuremodels](problems.md#hdcuremodels)|0.0.5 |__+1__ | | |
+|[hedgehog](problems.md#hedgehog)|0.1 |__+1__ | | |
+|[htmltools](problems.md#htmltools)|0.5.8.1 |__+1__ | |1 |
+|[httptest](problems.md#httptest)|4.2.2 |__+1__ | | |
+|[httptest2](problems.md#httptest2)|1.2.1 |__+1__ | | |
+|[humanize](problems.md#humanize)|0.2.0 |__+1__ | |1 |
+|[HurreconR](problems.md#hurreconr)|1.1 |__+1__ | | |
+|[IMEC](problems.md#imec)|0.2.0 |__+1__ | |1 |
+|[installr](problems.md#installr)|0.23.4 |__+1__ | |1 |
+|[itan](problems.md#itan)|3.1.1 |__+1__ | | |
+|[latrend](problems.md#latrend)|1.6.2 |__+1__ | | |
+|[leaflet.minicharts](problems.md#leafletminicharts)|0.6.2 |__+1__ | | |
+|[learnr](problems.md#learnr)|0.11.5 |__+1__ | | |
+|[lightr](problems.md#lightr)|1.9.0 |__+1__ | | |
+|[lintr](problems.md#lintr)|3.2.0 |__+1__ | |1 |
+|[luajr](problems.md#luajr)|0.2.0 |__+1__ | |1 |
+|[madrat](problems.md#madrat)|3.15.6 |__+1__ | | |
+|[mailmerge](problems.md#mailmerge)|0.2.5 |__+1__ | | |
+|[MakefileR](problems.md#makefiler)|1.0 |__+1__ | |1 |
+|[manipulateWidget](problems.md#manipulatewidget)|0.11.1 |__+1__ | |2 |
+|[markmyassignment](problems.md#markmyassignment)|0.8.8 |__+1__ | | |
+|[maybe](problems.md#maybe)|1.1.0 |__+1__ | | |
+|[mbbe](problems.md#mbbe)|0.1.0 |__+1__ | | |
+|[MetaComp](problems.md#metacomp)|1.1.2 |__+1__ | |1 |
+|[metaDigitise](problems.md#metadigitise)|1.0.1 |__+1__ | |1 |
+|[mknapsack](problems.md#mknapsack)|0.1.0 |__+1__ | | |
+|[mlr3pipelines](problems.md#mlr3pipelines)|0.9.0 |__+1__ | |1 |
+|[modeltests](problems.md#modeltests)|0.1.7 |__+1__ | |1 |
+|[moexer](problems.md#moexer)|0.3.0 |__+1__ | | |
+|[MolgenisArmadillo](problems.md#molgenisarmadillo)|2.9.1 |__+1__ | | |
+|[multiverse](problems.md#multiverse)|0.6.2 |__+1__ | | |
+|[nanoarrow](problems.md#nanoarrow)|0.7.0 |__+1__ | | |
+|[NasdaqDataLink](problems.md#nasdaqdatalink)|1.0.0 |__+1__ | | |
+|[nettskjemar](problems.md#nettskjemar)|1.0.3 |__+1__ | | |
+|[nhlapi](problems.md#nhlapi)|0.1.4 |__+1__ | |1 |
+|[nodiv](problems.md#nodiv)|1.4.2 |__+1__ | | |
+|[operator.tools](problems.md#operatortools)|1.6.3 |__+1__ | | |
+|[optigrab](problems.md#optigrab)|0.9.2.1 |__+1__ | |1 |
+|[ottr](problems.md#ottr)|1.5.2 |__+1__ | | |
+|[owmr](problems.md#owmr)|0.8.2 |__+1__ | | |
+|[oxcAAR](problems.md#oxcaar)|1.1.1 |1 __+1__ | | |
+|[parquetize](problems.md#parquetize)|0.5.7 |__+1__ | | |
+|[passport](problems.md#passport)|0.3.0 |__+1__ | | |
+|[patrick](problems.md#patrick)|0.3.0 |__+1__ | | |
+|[PCRedux](problems.md#pcredux)|1.2-0 |__+1__ | | |
+|[photon](problems.md#photon)|0.3.5 |__+1__ | | |
+|[pocketapi](problems.md#pocketapi)|0.1 |__+1__ | |2 |
+|[pointblank](problems.md#pointblank)|0.12.2 |__+1__ | |1 |
+|[pollen](problems.md#pollen)|0.82.0 |__+1__ | | |
+|[prism](problems.md#prism)|0.2.3 |__+1__ | | |
+|[productplots](problems.md#productplots)|0.1.1 |__+1__ | | |
+|[projmgr](problems.md#projmgr)|0.1.1 |__+1__ | | |
+|[pyinit](problems.md#pyinit)|1.1.3 |__+1__ | | |
+|[quadmesh](problems.md#quadmesh)|0.5.5 |__+1__ | | |
+|[Quandl](problems.md#quandl)|2.11.0 |__+1__ | | |
+|[r2dii.analysis](problems.md#r2diianalysis)|0.5.2 |__+1__ | | |
+|[r2dii.match](problems.md#r2diimatch)|0.4.1 |__+1__ | | |
+|[r2dii.plot](problems.md#r2diiplot)|0.5.2 |__+1__ | | |
+|[rags2ridges](problems.md#rags2ridges)|2.2.8 |__+1__ | |1 |
+|[rbedrock](problems.md#rbedrock)|0.4.1 |__+1__ | |2 |
+|[regmedint](problems.md#regmedint)|1.0.1 |__+1__ | |1 |
+|[Rexperigen](problems.md#rexperigen)|0.2.1 |__+1__ | |1 |
+|[rjstat](problems.md#rjstat)|0.4.3 |__+1__ | | |
+|[rlang](problems.md#rlang)|1.1.6 |__+1__ | |1 |
+|[rosetteApi](problems.md#rosetteapi)|1.14.4 |__+1__ | | |
+|[Rpolyhedra](problems.md#rpolyhedra)|0.5.6 |__+1__ | | |
+|[RPresto](problems.md#rpresto)|1.4.7 |__+1__ | | |
+|[RTD](problems.md#rtd)|0.4.1 |__+1__ | |1 |
+|[saeSim](problems.md#saesim)|0.11.0 |__+1__ | |1 |
+|[scorematchingad](problems.md#scorematchingad)|0.1.4 |__+1__ | |1 |
+|[seqminer](problems.md#seqminer)|9.7 |__+1__ | |2 |
+|[seriation](problems.md#seriation)|1.5.8 |__+1__ |1 | |
+|[shiny](problems.md#shiny)|1.11.1 |__+1__ | |1 |
+|[shiny.benchmark](problems.md#shinybenchmark)|0.1.1 |__+1__ | | |
+|[shinyShortcut](problems.md#shinyshortcut)|0.1.0 |__+1__ | |1 |
+|[SIAtools](problems.md#siatools)|0.1.3 |__+1__ | | |
+|[SpaDES.tools](problems.md#spadestools)|2.0.7 |__+1__ | | |
+|[spaero](problems.md#spaero)|0.6.0 |__+1__ | |4 |
+|[spatialsample](problems.md#spatialsample)|0.6.0 |__+1__ | | |
+|[spex](problems.md#spex)|0.7.1 |__+1__ | | |
+|[tabularaster](problems.md#tabularaster)|0.7.2 |__+1__ | | |
+|[testdat](problems.md#testdat)|0.4.3 |__+1__ | | |
+|[texreg](problems.md#texreg)|1.39.4 |__+1__ |1 |2 |
+|[ThankYouStars](problems.md#thankyoustars)|0.2.0 |__+1__ | |1 |
+|[tibblify](problems.md#tibblify)|0.3.1 |__+1__ | |1 |
+|[tinyProject](problems.md#tinyproject)|0.6.1 |__+1__ | | |
+|[trip](problems.md#trip)|1.10.0 |__+1__ | | |
+|[tryCatchLog](problems.md#trycatchlog)|1.3.1 |__+1__ | |1 |
+|[vein](problems.md#vein)|1.3.0 |__+1__ | |1 |
+|[WhatIf](problems.md#whatif)|1.5-10 |__+1__ | | |
+|[whirl](problems.md#whirl)|0.3.1 |__+1__ | | |
+|[wk](problems.md#wk)|0.9.4 |__+1__ | |2 |
+|[xpose](problems.md#xpose)|0.4.20 |__+1__ | | |
+|[zephyr](problems.md#zephyr)|0.1.3 |__+1__ | | |
+|[ZillowR](problems.md#zillowr)|1.0.0 |__+1__ | | |
diff --git a/revdep/cran.md b/revdep/cran.md
index 9e785ba56..5a1579542 100644
--- a/revdep/cran.md
+++ b/revdep/cran.md
@@ -1,61 +1,145 @@
## revdepcheck results
-We checked 9592 reverse dependencies (9588 from CRAN + 4 from Bioconductor), comparing R CMD check results across CRAN and dev versions of this package.
+We checked 131 reverse dependencies, comparing R CMD check results across CRAN and dev versions of this package.
- * We saw 56 new problems
- * We failed to check 30 packages
+ * We saw 128 new problems
+ * We failed to check 0 packages
Issues with CRAN packages are summarised below.
### New problems
(This reports the first line of each new failure)
+* adjclust
+ checking tests ... ERROR
+
+* APackOfTheClones
+ checking tests ... ERROR
+
+* autodb
+ checking tests ... ERROR
+
* aws.comprehend
checking tests ... ERROR
-* bcRP
- checking examples ... ERROR
+* bgmfiles
+ checking tests ... ERROR
* bindr
checking tests ... ERROR
+* caretEnsemble
+ checking tests ... ERROR
+
+* clinDataReview
+ checking tests ... ERROR
+
+* cnd
+ checking tests ... ERROR
+
+* coenocliner
+ checking tests ... ERROR
+
* conflr
checking tests ... ERROR
* countdown
checking tests ... ERROR
+* covdepGE
+ checking tests ... ERROR
+
* covr
checking tests ... ERROR
* datarobot
checking tests ... ERROR
+* DiceKriging
+ checking tests ... ERROR
+
+* dictionar6
+ checking tests ... ERROR
+
+* difNLR
+ checking tests ... ERROR
+
* digitize
checking tests ... ERROR
+* disprofas
+ checking tests ... ERROR
+
+* distances
+ checking tests ... ERROR
+
* distro
checking tests ... ERROR
-* esci
- checking installed package size ... NOTE
+* EDISON
+ checking tests ... ERROR
+
+* ergm
+ checking tests ... ERROR
+
+* expstudy
+ checking tests ... ERROR
+
+* fabletools
+ checking tests ... ERROR
+
+* futile.logger
+ checking tests ... ERROR
+
+* ggeffects
+ checking tests ... ERROR
-* gen3sis
+* ggseg
checking tests ... ERROR
-* geomorph
- checking installed package size ... NOTE
+* gips
+ checking tests ... ERROR
* graphhopper
checking tests ... ERROR
-* handwriterRF
+* greeks
+ checking tests ... ERROR
+
+* HandTill2001
+ checking tests ... ERROR
+
+* hdcuremodels
+ checking tests ... ERROR
+
+* hedgehog
+ checking tests ... ERROR
+
+* htmltools
+ checking tests ... ERROR
+
+* httptest
+ checking tests ... ERROR
+
+* httptest2
checking tests ... ERROR
* humanize
checking tests ... ERROR
-* ipaddress
+* HurreconR
+ checking tests ... ERROR
+
+* IMEC
+ checking tests ... ERROR
+
+* installr
+ checking tests ... ERROR
+
+* itan
+ checking tests ... ERROR
+
+* latrend
checking tests ... ERROR
* leaflet.minicharts
@@ -64,25 +148,50 @@ Issues with CRAN packages are summarised below.
* learnr
checking tests ... ERROR
+* lightr
+ checking tests ... ERROR
+
+* lintr
+ checking tests ... ERROR
+
+* luajr
+ checking tests ... ERROR
+
+* madrat
+ checking tests ... ERROR
+
+* mailmerge
+ checking tests ... ERROR
+
* MakefileR
checking tests ... ERROR
* manipulateWidget
checking tests ... ERROR
+* markmyassignment
+ checking tests ... ERROR
+
+* maybe
+ checking tests ... ERROR
+
* mbbe
checking tests ... ERROR
+* MetaComp
+ checking tests ... ERROR
+
* metaDigitise
checking tests ... ERROR
* mknapsack
checking tests ... ERROR
-* mockery
- checking examples ... ERROR
+* mlr3pipelines
+ checking tests ... ERROR
+
+* modeltests
checking tests ... ERROR
- checking re-building of vignette outputs ... ERROR
* moexer
checking tests ... ERROR
@@ -90,38 +199,95 @@ Issues with CRAN packages are summarised below.
* MolgenisArmadillo
checking tests ... ERROR
+* multiverse
+ checking tests ... ERROR
+
+* nanoarrow
+ checking tests ... ERROR
+
* NasdaqDataLink
checking tests ... ERROR
+* nettskjemar
+ checking tests ... ERROR
+
* nhlapi
checking tests ... ERROR
+* nodiv
+ checking tests ... ERROR
+
+* operator.tools
+ checking tests ... ERROR
+
+* optigrab
+ checking tests ... ERROR
+
+* ottr
+ checking tests ... ERROR
+
* owmr
checking tests ... ERROR
* oxcAAR
checking tests ... ERROR
-* parameters
- checking installed package size ... NOTE
+* parquetize
+ checking tests ... ERROR
* passport
checking tests ... ERROR
+* patrick
+ checking tests ... ERROR
+
+* PCRedux
+ checking tests ... ERROR
+
+* photon
+ checking tests ... ERROR
+
* pocketapi
checking tests ... ERROR
+* pointblank
+ checking tests ... ERROR
+
+* pollen
+ checking tests ... ERROR
+
+* prism
+ checking tests ... ERROR
+
+* productplots
+ checking tests ... ERROR
+
* projmgr
checking tests ... ERROR
-* PubChemR
- checking examples ... ERROR
+* pyinit
+ checking tests ... ERROR
+
+* quadmesh
+ checking tests ... ERROR
* Quandl
checking tests ... ERROR
-* REddyProc
- checking installed package size ... NOTE
+* r2dii.analysis
+ checking tests ... ERROR
+
+* r2dii.match
+ checking tests ... ERROR
+
+* r2dii.plot
+ checking tests ... ERROR
+
+* rags2ridges
+ checking tests ... ERROR
+
+* rbedrock
+ checking tests ... ERROR
* regmedint
checking tests ... ERROR
@@ -129,6 +295,12 @@ Issues with CRAN packages are summarised below.
* Rexperigen
checking tests ... ERROR
+* rjstat
+ checking tests ... ERROR
+
+* rlang
+ checking tests ... ERROR
+
* rosetteApi
checking tests ... ERROR
@@ -141,7 +313,19 @@ Issues with CRAN packages are summarised below.
* RTD
checking tests ... ERROR
-* Ryacas0
+* saeSim
+ checking tests ... ERROR
+
+* scorematchingad
+ checking tests ... ERROR
+
+* seqminer
+ checking tests ... ERROR
+
+* seriation
+ checking tests ... ERROR
+
+* shiny
checking tests ... ERROR
* shiny.benchmark
@@ -150,17 +334,26 @@ Issues with CRAN packages are summarised below.
* shinyShortcut
checking tests ... ERROR
-* skimr
+* SIAtools
+ checking tests ... ERROR
+
+* SpaDES.tools
checking tests ... ERROR
* spaero
checking tests ... ERROR
-* starwarsdb
+* spatialsample
checking tests ... ERROR
-* tangles
- checking re-building of vignette outputs ... ERROR
+* spex
+ checking tests ... ERROR
+
+* tabularaster
+ checking tests ... ERROR
+
+* testdat
+ checking tests ... ERROR
* texreg
checking tests ... ERROR
@@ -168,47 +361,36 @@ Issues with CRAN packages are summarised below.
* ThankYouStars
checking tests ... ERROR
+* tibblify
+ checking tests ... ERROR
+
* tinyProject
checking tests ... ERROR
+* trip
+ checking tests ... ERROR
+
* tryCatchLog
checking tests ... ERROR
+* vein
+ checking tests ... ERROR
+
* WhatIf
checking tests ... ERROR
+* whirl
+ checking tests ... ERROR
+
+* wk
+ checking tests ... ERROR
+
+* xpose
+ checking tests ... ERROR
+
+* zephyr
+ checking tests ... ERROR
+
* ZillowR
checking tests ... ERROR
-### Failed to check
-
-* arealDB (NA)
-* atom4R (NA)
-* bayesdfa (NA)
-* ctsem (NA)
-* dataone (NA)
-* datapack (NA)
-* DSMolgenisArmadillo (NA)
-* dsTidyverse (NA)
-* dsTidyverseClient (NA)
-* EcoEnsemble (NA)
-* FAfA (NA)
-* FAIRmaterials (NA)
-* fdaPDE (NA)
-* fio (NA)
-* gllvm (NA)
-* gpboost (NA)
-* gpuR (NA)
-* loon.shiny (NA)
-* loon.tourr (NA)
-* metajam (NA)
-* multinma (NA)
-* rdflib (NA)
-* redland (NA)
-* rstanarm (NA)
-* SQLFormatteR (NA)
-* string2path (NA)
-* TestAnaAPP (NA)
-* TriDimRegression (NA)
-* xactonomial (NA)
-* zen4R (NA)
diff --git a/revdep/failures.md b/revdep/failures.md
index abbb92bf9..9a2073633 100644
--- a/revdep/failures.md
+++ b/revdep/failures.md
@@ -1,2211 +1 @@
-# arealDB
-
-
-
-* Version: 0.9.4
-* GitHub: https://github.com/luckinet/arealDB
-* Source code: https://github.com/cran/arealDB
-* Date/Publication: 2025-01-20 13:40:05 UTC
-* Number of recursive dependencies: 109
-
-Run `revdepcheck::cloud_details(, "arealDB")` for more info
-
-
-
-## In both
-
-* checking whether package ‘arealDB’ can be installed ... ERROR
- ```
- Installation failed.
- See ‘/tmp/workdir/arealDB/new/arealDB.Rcheck/00install.out’ for details.
- ```
-
-## Installation
-
-### Devel
-
-```
-* installing *source* package ‘arealDB’ ...
-** package ‘arealDB’ successfully unpacked and MD5 sums checked
-** using staged installation
-** R
-** data
-*** moving datasets to lazyload DB
-** inst
-** byte-compile and prepare package for lazy loading
-Error in dyn.load(file, DLLpath = DLLpath, ...) :
- unable to load shared object '/usr/local/lib/R/site-library/redland/libs/redland.so':
- librdf.so.0: cannot open shared object file: No such file or directory
-Calls: ... asNamespace -> loadNamespace -> library.dynam -> dyn.load
-Execution halted
-ERROR: lazy loading failed for package ‘arealDB’
-* removing ‘/tmp/workdir/arealDB/new/arealDB.Rcheck/arealDB’
-
-
-```
-### CRAN
-
-```
-* installing *source* package ‘arealDB’ ...
-** package ‘arealDB’ successfully unpacked and MD5 sums checked
-** using staged installation
-** R
-** data
-*** moving datasets to lazyload DB
-** inst
-** byte-compile and prepare package for lazy loading
-Error in dyn.load(file, DLLpath = DLLpath, ...) :
- unable to load shared object '/usr/local/lib/R/site-library/redland/libs/redland.so':
- librdf.so.0: cannot open shared object file: No such file or directory
-Calls: ... asNamespace -> loadNamespace -> library.dynam -> dyn.load
-Execution halted
-ERROR: lazy loading failed for package ‘arealDB’
-* removing ‘/tmp/workdir/arealDB/old/arealDB.Rcheck/arealDB’
-
-
-```
-# arules
-
-
-
-* Version: NA
-* GitHub: NA
-* Source code: https://github.com/cran/arules
-* Number of recursive dependencies: 122
-
-Run `revdepcheck::cloud_details(, "arules")` for more info
-
-
-
-## Error before installation
-
-### Devel
-
-```
-
-
-
-
-
-
-```
-### CRAN
-
-```
-
-
-
-
-
-
-```
-# atom4R
-
-
-
-* Version: 0.3-3
-* GitHub: https://github.com/eblondel/atom4R
-* Source code: https://github.com/cran/atom4R
-* Date/Publication: 2022-11-18 14:40:15 UTC
-* Number of recursive dependencies: 66
-
-Run `revdepcheck::cloud_details(, "atom4R")` for more info
-
-
-
-## In both
-
-* checking whether package ‘atom4R’ can be installed ... ERROR
- ```
- Installation failed.
- See ‘/tmp/workdir/atom4R/new/atom4R.Rcheck/00install.out’ for details.
- ```
-
-## Installation
-
-### Devel
-
-```
-* installing *source* package ‘atom4R’ ...
-** package ‘atom4R’ successfully unpacked and MD5 sums checked
-** using staged installation
-** R
-** inst
-** byte-compile and prepare package for lazy loading
-Error in dyn.load(file, DLLpath = DLLpath, ...) :
- unable to load shared object '/usr/local/lib/R/site-library/redland/libs/redland.so':
- librdf.so.0: cannot open shared object file: No such file or directory
-Calls: ... asNamespace -> loadNamespace -> library.dynam -> dyn.load
-Execution halted
-ERROR: lazy loading failed for package ‘atom4R’
-* removing ‘/tmp/workdir/atom4R/new/atom4R.Rcheck/atom4R’
-
-
-```
-### CRAN
-
-```
-* installing *source* package ‘atom4R’ ...
-** package ‘atom4R’ successfully unpacked and MD5 sums checked
-** using staged installation
-** R
-** inst
-** byte-compile and prepare package for lazy loading
-Error in dyn.load(file, DLLpath = DLLpath, ...) :
- unable to load shared object '/usr/local/lib/R/site-library/redland/libs/redland.so':
- librdf.so.0: cannot open shared object file: No such file or directory
-Calls: ... asNamespace -> loadNamespace -> library.dynam -> dyn.load
-Execution halted
-ERROR: lazy loading failed for package ‘atom4R’
-* removing ‘/tmp/workdir/atom4R/old/atom4R.Rcheck/atom4R’
-
-
-```
-# bayesdfa
-
-
-
-* Version: 1.3.4
-* GitHub: https://github.com/fate-ewi/bayesdfa
-* Source code: https://github.com/cran/bayesdfa
-* Date/Publication: 2025-03-22 20:30:21 UTC
-* Number of recursive dependencies: 84
-
-Run `revdepcheck::cloud_details(, "bayesdfa")` for more info
-
-
-
-## In both
-
-* checking whether package ‘bayesdfa’ can be installed ... ERROR
- ```
- Installation failed.
- See ‘/tmp/workdir/bayesdfa/new/bayesdfa.Rcheck/00install.out’ for details.
- ```
-
-## Installation
-
-### Devel
-
-```
-* installing *source* package ‘bayesdfa’ ...
-** package ‘bayesdfa’ successfully unpacked and MD5 sums checked
-** using staged installation
-Error in loadNamespace(x) : there is no package called ‘rstantools’
-Calls: loadNamespace -> withRestarts -> withOneRestart -> doWithOneRestart
-Execution halted
-ERROR: configuration failed for package ‘bayesdfa’
-* removing ‘/tmp/workdir/bayesdfa/new/bayesdfa.Rcheck/bayesdfa’
-
-
-```
-### CRAN
-
-```
-* installing *source* package ‘bayesdfa’ ...
-** package ‘bayesdfa’ successfully unpacked and MD5 sums checked
-** using staged installation
-Error in loadNamespace(x) : there is no package called ‘rstantools’
-Calls: loadNamespace -> withRestarts -> withOneRestart -> doWithOneRestart
-Execution halted
-ERROR: configuration failed for package ‘bayesdfa’
-* removing ‘/tmp/workdir/bayesdfa/old/bayesdfa.Rcheck/bayesdfa’
-
-
-```
-# ctsem
-
-
-
-* Version: 3.10.4
-* GitHub: https://github.com/cdriveraus/ctsem
-* Source code: https://github.com/cran/ctsem
-* Date/Publication: 2025-06-30 16:40:11 UTC
-* Number of recursive dependencies: 164
-
-Run `revdepcheck::cloud_details(, "ctsem")` for more info
-
-
-
-## In both
-
-* checking whether package ‘ctsem’ can be installed ... ERROR
- ```
- Installation failed.
- See ‘/tmp/workdir/ctsem/new/ctsem.Rcheck/00install.out’ for details.
- ```
-
-* checking package dependencies ... NOTE
- ```
- Package suggested but not available for checking: ‘arules’
- ```
-
-## Installation
-
-### Devel
-
-```
-* installing *source* package ‘ctsem’ ...
-** package ‘ctsem’ successfully unpacked and MD5 sums checked
-** using staged installation
-** libs
-using C++ compiler: ‘g++ (Ubuntu 13.3.0-6ubuntu2~24.04) 13.3.0’
-using C++17
-
-
-g++ -std=gnu++17 -I"/opt/R/4.4.0/lib/R/include" -DNDEBUG -I"../inst/include" -I"/usr/local/lib/R/site-library/StanHeaders/include/src" -DBOOST_DISABLE_ASSERTS -DEIGEN_NO_DEBUG -DBOOST_MATH_OVERFLOW_ERROR_POLICY=errno_on_error -DUSE_STANC3 -D_HAS_AUTO_PTR_ETC=0 -I'/usr/local/lib/R/site-library/BH/include' -I'/usr/local/lib/R/site-library/Rcpp/include' -I'/usr/local/lib/R/site-library/RcppEigen/include' -I'/usr/local/lib/R/site-library/RcppParallel/include' -I'/usr/local/lib/R/site-library/rstan/include' -I'/usr/local/lib/R/site-library/StanHeaders/include' -I/usr/local/include -I'/usr/local/lib/R/site-library/RcppParallel/include' -D_REENTRANT -DSTAN_THREADS -fpic -g -O2 -c RcppExports.cpp -o RcppExports.o
-In file included from /usr/local/lib/R/site-library/RcppEigen/include/Eigen/Core:205,
-...
-/usr/local/lib/R/site-library/StanHeaders/include/src/stan/mcmc/hmc/hamiltonians/dense_e_metric.hpp:22:0: required from ‘double stan::mcmc::dense_e_metric::T(stan::mcmc::dense_e_point&) [with Model = model_ctsm_namespace::model_ctsm; BaseRNG = boost::random::additive_combine_engine, boost::random::linear_congruential_engine >]’
-/usr/local/lib/R/site-library/StanHeaders/include/src/stan/mcmc/hmc/hamiltonians/dense_e_metric.hpp:21:0: required from here
-/usr/local/lib/R/site-library/RcppEigen/include/Eigen/src/Core/DenseCoeffsBase.h:654:74: warning: ignoring attributes on template argument ‘Eigen::internal::packet_traits::type’ {aka ‘__m128d’} [-Wignored-attributes]
- 654 | return internal::first_aligned::alignment),Derived>(m);
- | ^~~~~~~~~
-g++: fatal error: Killed signal terminated program cc1plus
-compilation terminated.
-make: *** [/opt/R/4.4.0/lib/R/etc/Makeconf:202: stanExports_ctsm.o] Error 1
-ERROR: compilation failed for package ‘ctsem’
-* removing ‘/tmp/workdir/ctsem/new/ctsem.Rcheck/ctsem’
-
-
-```
-### CRAN
-
-```
-* installing *source* package ‘ctsem’ ...
-** package ‘ctsem’ successfully unpacked and MD5 sums checked
-** using staged installation
-** libs
-using C++ compiler: ‘g++ (Ubuntu 13.3.0-6ubuntu2~24.04) 13.3.0’
-using C++17
-
-
-g++ -std=gnu++17 -I"/opt/R/4.4.0/lib/R/include" -DNDEBUG -I"../inst/include" -I"/usr/local/lib/R/site-library/StanHeaders/include/src" -DBOOST_DISABLE_ASSERTS -DEIGEN_NO_DEBUG -DBOOST_MATH_OVERFLOW_ERROR_POLICY=errno_on_error -DUSE_STANC3 -D_HAS_AUTO_PTR_ETC=0 -I'/usr/local/lib/R/site-library/BH/include' -I'/usr/local/lib/R/site-library/Rcpp/include' -I'/usr/local/lib/R/site-library/RcppEigen/include' -I'/usr/local/lib/R/site-library/RcppParallel/include' -I'/usr/local/lib/R/site-library/rstan/include' -I'/usr/local/lib/R/site-library/StanHeaders/include' -I/usr/local/include -I'/usr/local/lib/R/site-library/RcppParallel/include' -D_REENTRANT -DSTAN_THREADS -fpic -g -O2 -c RcppExports.cpp -o RcppExports.o
-In file included from /usr/local/lib/R/site-library/RcppEigen/include/Eigen/Core:205,
-...
-/usr/local/lib/R/site-library/StanHeaders/include/src/stan/mcmc/hmc/hamiltonians/dense_e_metric.hpp:22:0: required from ‘double stan::mcmc::dense_e_metric::T(stan::mcmc::dense_e_point&) [with Model = model_ctsm_namespace::model_ctsm; BaseRNG = boost::random::additive_combine_engine, boost::random::linear_congruential_engine >]’
-/usr/local/lib/R/site-library/StanHeaders/include/src/stan/mcmc/hmc/hamiltonians/dense_e_metric.hpp:21:0: required from here
-/usr/local/lib/R/site-library/RcppEigen/include/Eigen/src/Core/DenseCoeffsBase.h:654:74: warning: ignoring attributes on template argument ‘Eigen::internal::packet_traits::type’ {aka ‘__m128d’} [-Wignored-attributes]
- 654 | return internal::first_aligned::alignment),Derived>(m);
- | ^~~~~~~~~
-g++: fatal error: Killed signal terminated program cc1plus
-compilation terminated.
-make: *** [/opt/R/4.4.0/lib/R/etc/Makeconf:202: stanExports_ctsm.o] Error 1
-ERROR: compilation failed for package ‘ctsem’
-* removing ‘/tmp/workdir/ctsem/old/ctsem.Rcheck/ctsem’
-
-
-```
-# dataone
-
-
-
-* Version: 2.2.2
-* GitHub: https://github.com/DataONEorg/rdataone
-* Source code: https://github.com/cran/dataone
-* Date/Publication: 2022-06-10 19:30:02 UTC
-* Number of recursive dependencies: 63
-
-Run `revdepcheck::cloud_details(, "dataone")` for more info
-
-
-
-## In both
-
-* checking whether package ‘dataone’ can be installed ... ERROR
- ```
- Installation failed.
- See ‘/tmp/workdir/dataone/new/dataone.Rcheck/00install.out’ for details.
- ```
-
-## Installation
-
-### Devel
-
-```
-* installing *source* package ‘dataone’ ...
-** package ‘dataone’ successfully unpacked and MD5 sums checked
-** using staged installation
-** R
-** inst
-** byte-compile and prepare package for lazy loading
-Error in dyn.load(file, DLLpath = DLLpath, ...) :
- unable to load shared object '/usr/local/lib/R/site-library/redland/libs/redland.so':
- librdf.so.0: cannot open shared object file: No such file or directory
-Calls: ... namespaceImport -> loadNamespace -> library.dynam -> dyn.load
-Execution halted
-ERROR: lazy loading failed for package ‘dataone’
-* removing ‘/tmp/workdir/dataone/new/dataone.Rcheck/dataone’
-
-
-```
-### CRAN
-
-```
-* installing *source* package ‘dataone’ ...
-** package ‘dataone’ successfully unpacked and MD5 sums checked
-** using staged installation
-** R
-** inst
-** byte-compile and prepare package for lazy loading
-Error in dyn.load(file, DLLpath = DLLpath, ...) :
- unable to load shared object '/usr/local/lib/R/site-library/redland/libs/redland.so':
- librdf.so.0: cannot open shared object file: No such file or directory
-Calls: ... namespaceImport -> loadNamespace -> library.dynam -> dyn.load
-Execution halted
-ERROR: lazy loading failed for package ‘dataone’
-* removing ‘/tmp/workdir/dataone/old/dataone.Rcheck/dataone’
-
-
-```
-# datapack
-
-
-
-* Version: 1.4.1
-* GitHub: https://github.com/ropensci/datapack
-* Source code: https://github.com/cran/datapack
-* Date/Publication: 2022-06-10 19:40:01 UTC
-* Number of recursive dependencies: 63
-
-Run `revdepcheck::cloud_details(, "datapack")` for more info
-
-
-
-## In both
-
-* checking whether package ‘datapack’ can be installed ... ERROR
- ```
- Installation failed.
- See ‘/tmp/workdir/datapack/new/datapack.Rcheck/00install.out’ for details.
- ```
-
-## Installation
-
-### Devel
-
-```
-* installing *source* package ‘datapack’ ...
-** package ‘datapack’ successfully unpacked and MD5 sums checked
-** using staged installation
-** R
-** inst
-** byte-compile and prepare package for lazy loading
-Error in dyn.load(file, DLLpath = DLLpath, ...) :
- unable to load shared object '/usr/local/lib/R/site-library/redland/libs/redland.so':
- librdf.so.0: cannot open shared object file: No such file or directory
-Calls: ... namespaceImport -> loadNamespace -> library.dynam -> dyn.load
-Execution halted
-ERROR: lazy loading failed for package ‘datapack’
-* removing ‘/tmp/workdir/datapack/new/datapack.Rcheck/datapack’
-
-
-```
-### CRAN
-
-```
-* installing *source* package ‘datapack’ ...
-** package ‘datapack’ successfully unpacked and MD5 sums checked
-** using staged installation
-** R
-** inst
-** byte-compile and prepare package for lazy loading
-Error in dyn.load(file, DLLpath = DLLpath, ...) :
- unable to load shared object '/usr/local/lib/R/site-library/redland/libs/redland.so':
- librdf.so.0: cannot open shared object file: No such file or directory
-Calls: ... namespaceImport -> loadNamespace -> library.dynam -> dyn.load
-Execution halted
-ERROR: lazy loading failed for package ‘datapack’
-* removing ‘/tmp/workdir/datapack/old/datapack.Rcheck/datapack’
-
-
-```
-# DSMolgenisArmadillo
-
-
-
-* Version: 2.0.9
-* GitHub: https://github.com/molgenis/molgenis-r-datashield
-* Source code: https://github.com/cran/DSMolgenisArmadillo
-* Date/Publication: 2024-07-09 07:50:08 UTC
-* Number of recursive dependencies: 76
-
-Run `revdepcheck::cloud_details(, "DSMolgenisArmadillo")` for more info
-
-
-
-## Error before installation
-
-### Devel
-
-```
-* using log directory ‘/tmp/workdir/DSMolgenisArmadillo/new/DSMolgenisArmadillo.Rcheck’
-* using R version 4.4.0 (2024-04-24)
-* using platform: x86_64-pc-linux-gnu
-* R was compiled by
- gcc (Ubuntu 13.3.0-6ubuntu2~24.04) 13.3.0
- GNU Fortran (Ubuntu 13.3.0-6ubuntu2~24.04) 13.3.0
-* running under: Ubuntu 24.04.2 LTS
-* using session charset: UTF-8
-* using option ‘--no-manual’
-* checking for file ‘DSMolgenisArmadillo/DESCRIPTION’ ... OK
-...
- 12. └─rlang::cnd_signal(...)
-
- [ FAIL 55 | WARN 0 | SKIP 1 | PASS 9 ]
- Error: Test failures
- Execution halted
-* checking for unstated dependencies in vignettes ... OK
-* checking package vignettes ... OK
-* checking re-building of vignette outputs ... OK
-* DONE
-Status: 1 ERROR, 1 NOTE
-
-
-
-
-
-```
-### CRAN
-
-```
-* using log directory ‘/tmp/workdir/DSMolgenisArmadillo/old/DSMolgenisArmadillo.Rcheck’
-* using R version 4.4.0 (2024-04-24)
-* using platform: x86_64-pc-linux-gnu
-* R was compiled by
- gcc (Ubuntu 13.3.0-6ubuntu2~24.04) 13.3.0
- GNU Fortran (Ubuntu 13.3.0-6ubuntu2~24.04) 13.3.0
-* running under: Ubuntu 24.04.2 LTS
-* using session charset: UTF-8
-* using option ‘--no-manual’
-* checking for file ‘DSMolgenisArmadillo/DESCRIPTION’ ... OK
-...
-* checking files in ‘vignettes’ ... OK
-* checking examples ... NONE
-* checking for unstated dependencies in ‘tests’ ... OK
-* checking tests ... OK
- Running ‘testthat.R’
-* checking for unstated dependencies in vignettes ... OK
-* checking package vignettes ... OK
-* checking re-building of vignette outputs ... OK
-* DONE
-Status: 1 NOTE
-
-
-
-
-
-```
-# dsTidyverse
-
-
-
-* Version: 1.0.4
-* GitHub: NA
-* Source code: https://github.com/cran/dsTidyverse
-* Date/Publication: 2025-02-27 09:40:06 UTC
-* Number of recursive dependencies: 134
-
-Run `revdepcheck::cloud_details(, "dsTidyverse")` for more info
-
-
-
-## Error before installation
-
-### Devel
-
-```
-* using log directory ‘/tmp/workdir/dsTidyverse/new/dsTidyverse.Rcheck’
-* using R version 4.4.0 (2024-04-24)
-* using platform: x86_64-pc-linux-gnu
-* R was compiled by
- gcc (Ubuntu 13.3.0-6ubuntu2~24.04) 13.3.0
- GNU Fortran (Ubuntu 13.3.0-6ubuntu2~24.04) 13.3.0
-* running under: Ubuntu 24.04.2 LTS
-* using session charset: UTF-8
-* using option ‘--no-manual’
-* checking for file ‘dsTidyverse/DESCRIPTION’ ... OK
-...
-* checking for code/documentation mismatches ... OK
-* checking Rd \usage sections ... OK
-* checking Rd contents ... OK
-* checking for unstated dependencies in examples ... OK
-* checking examples ... NONE
-* checking for unstated dependencies in ‘tests’ ... OK
-* checking tests ... OK
- Running ‘testthat.R’
-* DONE
-Status: 1 NOTE
-
-
-
-
-
-```
-### CRAN
-
-```
-* using log directory ‘/tmp/workdir/dsTidyverse/old/dsTidyverse.Rcheck’
-* using R version 4.4.0 (2024-04-24)
-* using platform: x86_64-pc-linux-gnu
-* R was compiled by
- gcc (Ubuntu 13.3.0-6ubuntu2~24.04) 13.3.0
- GNU Fortran (Ubuntu 13.3.0-6ubuntu2~24.04) 13.3.0
-* running under: Ubuntu 24.04.2 LTS
-* using session charset: UTF-8
-* using option ‘--no-manual’
-* checking for file ‘dsTidyverse/DESCRIPTION’ ... OK
-...
-* checking for code/documentation mismatches ... OK
-* checking Rd \usage sections ... OK
-* checking Rd contents ... OK
-* checking for unstated dependencies in examples ... OK
-* checking examples ... NONE
-* checking for unstated dependencies in ‘tests’ ... OK
-* checking tests ... OK
- Running ‘testthat.R’
-* DONE
-Status: 1 NOTE
-
-
-
-
-
-```
-# dsTidyverseClient
-
-
-
-* Version: 1.0.2
-* GitHub: NA
-* Source code: https://github.com/cran/dsTidyverseClient
-* Date/Publication: 2025-02-27 09:30:06 UTC
-* Number of recursive dependencies: 151
-
-Run `revdepcheck::cloud_details(, "dsTidyverseClient")` for more info
-
-
-
-## Error before installation
-
-### Devel
-
-```
-* using log directory ‘/tmp/workdir/dsTidyverseClient/new/dsTidyverseClient.Rcheck’
-* using R version 4.4.0 (2024-04-24)
-* using platform: x86_64-pc-linux-gnu
-* R was compiled by
- gcc (Ubuntu 13.3.0-6ubuntu2~24.04) 13.3.0
- GNU Fortran (Ubuntu 13.3.0-6ubuntu2~24.04) 13.3.0
-* running under: Ubuntu 24.04.2 LTS
-* using session charset: UTF-8
-* using option ‘--no-manual’
-* checking for file ‘dsTidyverseClient/DESCRIPTION’ ... OK
-...
-* checking files in ‘vignettes’ ... OK
-* checking examples ... OK
-* checking for unstated dependencies in ‘tests’ ... OK
-* checking tests ... OK
- Running ‘testthat.R’
-* checking for unstated dependencies in vignettes ... OK
-* checking package vignettes ... OK
-* checking re-building of vignette outputs ... OK
-* DONE
-Status: 1 NOTE
-
-
-
-
-
-```
-### CRAN
-
-```
-* using log directory ‘/tmp/workdir/dsTidyverseClient/old/dsTidyverseClient.Rcheck’
-* using R version 4.4.0 (2024-04-24)
-* using platform: x86_64-pc-linux-gnu
-* R was compiled by
- gcc (Ubuntu 13.3.0-6ubuntu2~24.04) 13.3.0
- GNU Fortran (Ubuntu 13.3.0-6ubuntu2~24.04) 13.3.0
-* running under: Ubuntu 24.04.2 LTS
-* using session charset: UTF-8
-* using option ‘--no-manual’
-* checking for file ‘dsTidyverseClient/DESCRIPTION’ ... OK
-...
-* checking files in ‘vignettes’ ... OK
-* checking examples ... OK
-* checking for unstated dependencies in ‘tests’ ... OK
-* checking tests ... OK
- Running ‘testthat.R’
-* checking for unstated dependencies in vignettes ... OK
-* checking package vignettes ... OK
-* checking re-building of vignette outputs ... OK
-* DONE
-Status: 1 NOTE
-
-
-
-
-
-```
-# EcoEnsemble
-
-
-
-* Version: 1.1.2
-* GitHub: https://github.com/CefasRepRes/EcoEnsemble
-* Source code: https://github.com/cran/EcoEnsemble
-* Date/Publication: 2025-03-18 18:20:02 UTC
-* Number of recursive dependencies: 87
-
-Run `revdepcheck::cloud_details(, "EcoEnsemble")` for more info
-
-
-
-## In both
-
-* checking whether package ‘EcoEnsemble’ can be installed ... ERROR
- ```
- Installation failed.
- See ‘/tmp/workdir/EcoEnsemble/new/EcoEnsemble.Rcheck/00install.out’ for details.
- ```
-
-## Installation
-
-### Devel
-
-```
-* installing *source* package ‘EcoEnsemble’ ...
-** package ‘EcoEnsemble’ successfully unpacked and MD5 sums checked
-** using staged installation
-** libs
-using C++ compiler: ‘g++ (Ubuntu 13.3.0-6ubuntu2~24.04) 13.3.0’
-using C++17
-
-
-g++ -std=gnu++17 -I"/opt/R/4.4.0/lib/R/include" -DNDEBUG -I"../inst/include" -I"/usr/local/lib/R/site-library/StanHeaders/include/src" -DBOOST_DISABLE_ASSERTS -DEIGEN_NO_DEBUG -DBOOST_MATH_OVERFLOW_ERROR_POLICY=errno_on_error -DUSE_STANC3 -D_HAS_AUTO_PTR_ETC=0 -I'/usr/local/lib/R/site-library/BH/include' -I'/usr/local/lib/R/site-library/Rcpp/include' -I'/usr/local/lib/R/site-library/RcppEigen/include' -I'/usr/local/lib/R/site-library/RcppParallel/include' -I'/usr/local/lib/R/site-library/rstan/include' -I'/usr/local/lib/R/site-library/StanHeaders/include' -I/usr/local/include -I'/usr/local/lib/R/site-library/RcppParallel/include' -D_REENTRANT -DSTAN_THREADS -fpic -g -O2 -c KF_back.cpp -o KF_back.o
-In file included from /usr/local/lib/R/site-library/RcppEigen/include/Eigen/Core:205,
-...
-/usr/local/lib/R/site-library/StanHeaders/include/src/stan/mcmc/hmc/hamiltonians/dense_e_metric.hpp:22:0: required from ‘double stan::mcmc::dense_e_metric::T(stan::mcmc::dense_e_point&) [with Model = model_ensemble_model_hierarchical_namespace::model_ensemble_model_hierarchical; BaseRNG = boost::random::additive_combine_engine, boost::random::linear_congruential_engine >]’
-/usr/local/lib/R/site-library/StanHeaders/include/src/stan/mcmc/hmc/hamiltonians/dense_e_metric.hpp:21:0: required from here
-/usr/local/lib/R/site-library/RcppEigen/include/Eigen/src/Core/DenseCoeffsBase.h:654:74: warning: ignoring attributes on template argument ‘Eigen::internal::packet_traits::type’ {aka ‘__m128d’} [-Wignored-attributes]
- 654 | return internal::first_aligned::alignment),Derived>(m);
- | ^~~~~~~~~
-g++: fatal error: Killed signal terminated program cc1plus
-compilation terminated.
-make: *** [/opt/R/4.4.0/lib/R/etc/Makeconf:202: stanExports_ensemble_model_hierarchical.o] Error 1
-ERROR: compilation failed for package ‘EcoEnsemble’
-* removing ‘/tmp/workdir/EcoEnsemble/new/EcoEnsemble.Rcheck/EcoEnsemble’
-
-
-```
-### CRAN
-
-```
-* installing *source* package ‘EcoEnsemble’ ...
-** package ‘EcoEnsemble’ successfully unpacked and MD5 sums checked
-** using staged installation
-** libs
-using C++ compiler: ‘g++ (Ubuntu 13.3.0-6ubuntu2~24.04) 13.3.0’
-using C++17
-
-
-g++ -std=gnu++17 -I"/opt/R/4.4.0/lib/R/include" -DNDEBUG -I"../inst/include" -I"/usr/local/lib/R/site-library/StanHeaders/include/src" -DBOOST_DISABLE_ASSERTS -DEIGEN_NO_DEBUG -DBOOST_MATH_OVERFLOW_ERROR_POLICY=errno_on_error -DUSE_STANC3 -D_HAS_AUTO_PTR_ETC=0 -I'/usr/local/lib/R/site-library/BH/include' -I'/usr/local/lib/R/site-library/Rcpp/include' -I'/usr/local/lib/R/site-library/RcppEigen/include' -I'/usr/local/lib/R/site-library/RcppParallel/include' -I'/usr/local/lib/R/site-library/rstan/include' -I'/usr/local/lib/R/site-library/StanHeaders/include' -I/usr/local/include -I'/usr/local/lib/R/site-library/RcppParallel/include' -D_REENTRANT -DSTAN_THREADS -fpic -g -O2 -c KF_back.cpp -o KF_back.o
-In file included from /usr/local/lib/R/site-library/RcppEigen/include/Eigen/Core:205,
-...
-/usr/local/lib/R/site-library/StanHeaders/include/src/stan/mcmc/hmc/hamiltonians/dense_e_metric.hpp:22:0: required from ‘double stan::mcmc::dense_e_metric::T(stan::mcmc::dense_e_point&) [with Model = model_ensemble_model_hierarchical_namespace::model_ensemble_model_hierarchical; BaseRNG = boost::random::additive_combine_engine, boost::random::linear_congruential_engine >]’
-/usr/local/lib/R/site-library/StanHeaders/include/src/stan/mcmc/hmc/hamiltonians/dense_e_metric.hpp:21:0: required from here
-/usr/local/lib/R/site-library/RcppEigen/include/Eigen/src/Core/DenseCoeffsBase.h:654:74: warning: ignoring attributes on template argument ‘Eigen::internal::packet_traits::type’ {aka ‘__m128d’} [-Wignored-attributes]
- 654 | return internal::first_aligned::alignment),Derived>(m);
- | ^~~~~~~~~
-g++: fatal error: Killed signal terminated program cc1plus
-compilation terminated.
-make: *** [/opt/R/4.4.0/lib/R/etc/Makeconf:202: stanExports_ensemble_model_hierarchical.o] Error 1
-ERROR: compilation failed for package ‘EcoEnsemble’
-* removing ‘/tmp/workdir/EcoEnsemble/old/EcoEnsemble.Rcheck/EcoEnsemble’
-
-
-```
-# FAfA
-
-
-
-* Version: 0.3
-* GitHub: NA
-* Source code: https://github.com/cran/FAfA
-* Date/Publication: 2025-05-23 19:42:09 UTC
-* Number of recursive dependencies: 253
-
-Run `revdepcheck::cloud_details(, "FAfA")` for more info
-
-
-
-## In both
-
-* checking whether package ‘FAfA’ can be installed ... ERROR
- ```
- Installation failed.
- See ‘/tmp/workdir/FAfA/new/FAfA.Rcheck/00install.out’ for details.
- ```
-
-## Installation
-
-### Devel
-
-```
-* installing *source* package ‘FAfA’ ...
-** package ‘FAfA’ successfully unpacked and MD5 sums checked
-** using staged installation
-** R
-** inst
-** byte-compile and prepare package for lazy loading
-Error in loadNamespace(i, c(lib.loc, .libPaths()), versionCheck = vI[[i]]) :
- there is no package called ‘OpenMx’
-Calls: ... loadNamespace -> withRestarts -> withOneRestart -> doWithOneRestart
-Execution halted
-ERROR: lazy loading failed for package ‘FAfA’
-* removing ‘/tmp/workdir/FAfA/new/FAfA.Rcheck/FAfA’
-
-
-```
-### CRAN
-
-```
-* installing *source* package ‘FAfA’ ...
-** package ‘FAfA’ successfully unpacked and MD5 sums checked
-** using staged installation
-** R
-** inst
-** byte-compile and prepare package for lazy loading
-Error in loadNamespace(i, c(lib.loc, .libPaths()), versionCheck = vI[[i]]) :
- there is no package called ‘OpenMx’
-Calls: ... loadNamespace -> withRestarts -> withOneRestart -> doWithOneRestart
-Execution halted
-ERROR: lazy loading failed for package ‘FAfA’
-* removing ‘/tmp/workdir/FAfA/old/FAfA.Rcheck/FAfA’
-
-
-```
-# FAIRmaterials
-
-
-
-* Version: 0.4.2.1
-* GitHub: NA
-* Source code: https://github.com/cran/FAIRmaterials
-* Date/Publication: 2024-06-27 15:40:02 UTC
-* Number of recursive dependencies: 90
-
-Run `revdepcheck::cloud_details(, "FAIRmaterials")` for more info
-
-
-
-## In both
-
-* checking whether package ‘FAIRmaterials’ can be installed ... ERROR
- ```
- Installation failed.
- See ‘/tmp/workdir/FAIRmaterials/new/FAIRmaterials.Rcheck/00install.out’ for details.
- ```
-
-## Installation
-
-### Devel
-
-```
-* installing *source* package ‘FAIRmaterials’ ...
-** package ‘FAIRmaterials’ successfully unpacked and MD5 sums checked
-** using staged installation
-** R
-** inst
-** byte-compile and prepare package for lazy loading
-Error in dyn.load(file, DLLpath = DLLpath, ...) :
- unable to load shared object '/usr/local/lib/R/site-library/redland/libs/redland.so':
- librdf.so.0: cannot open shared object file: No such file or directory
-Calls: ... asNamespace -> loadNamespace -> library.dynam -> dyn.load
-Execution halted
-ERROR: lazy loading failed for package ‘FAIRmaterials’
-* removing ‘/tmp/workdir/FAIRmaterials/new/FAIRmaterials.Rcheck/FAIRmaterials’
-
-
-```
-### CRAN
-
-```
-* installing *source* package ‘FAIRmaterials’ ...
-** package ‘FAIRmaterials’ successfully unpacked and MD5 sums checked
-** using staged installation
-** R
-** inst
-** byte-compile and prepare package for lazy loading
-Error in dyn.load(file, DLLpath = DLLpath, ...) :
- unable to load shared object '/usr/local/lib/R/site-library/redland/libs/redland.so':
- librdf.so.0: cannot open shared object file: No such file or directory
-Calls: ... asNamespace -> loadNamespace -> library.dynam -> dyn.load
-Execution halted
-ERROR: lazy loading failed for package ‘FAIRmaterials’
-* removing ‘/tmp/workdir/FAIRmaterials/old/FAIRmaterials.Rcheck/FAIRmaterials’
-
-
-```
-# fdaPDE
-
-
-
-* Version: 1.1-21
-* GitHub: NA
-* Source code: https://github.com/cran/fdaPDE
-* Date/Publication: 2025-01-08 18:00:02 UTC
-* Number of recursive dependencies: 50
-
-Run `revdepcheck::cloud_details(, "fdaPDE")` for more info
-
-
-
-## In both
-
-* checking whether package ‘fdaPDE’ can be installed ... ERROR
- ```
- Installation failed.
- See ‘/tmp/workdir/fdaPDE/new/fdaPDE.Rcheck/00install.out’ for details.
- ```
-
-## Installation
-
-### Devel
-
-```
-* installing *source* package ‘fdaPDE’ ...
-** package ‘fdaPDE’ successfully unpacked and MD5 sums checked
-** using staged installation
-** libs
-using C compiler: ‘gcc (Ubuntu 13.3.0-6ubuntu2~24.04) 13.3.0’
-using C++ compiler: ‘g++ (Ubuntu 13.3.0-6ubuntu2~24.04) 13.3.0’
-using C++17
-g++ -std=gnu++17 -I"/opt/R/4.4.0/lib/R/include" -DNDEBUG -I'/usr/local/lib/R/site-library/RcppEigen/include' -I'/usr/local/lib/R/site-library/Rcpp/include' -I/usr/local/include -fpic -g -O2 -c Density_Estimation/Source/Rfun_Density_Estimation.cpp -o Density_Estimation/Source/Rfun_Density_Estimation.o
-In file included from /usr/local/lib/R/site-library/RcppEigen/include/Eigen/Core:205,
- from /usr/local/lib/R/site-library/RcppEigen/include/Eigen/StdVector:14,
-...
-/usr/local/lib/R/site-library/RcppEigen/include/Eigen/src/Core/Matrix.h:225:24: required from ‘Eigen::Matrix<_Scalar, _Rows, _Cols, _Options, _MaxRows, _MaxCols>& Eigen::Matrix<_Scalar, _Rows, _Cols, _Options, _MaxRows, _MaxCols>::operator=(const Eigen::DenseBase&) [with OtherDerived = Eigen::CwiseBinaryOp, const Eigen::CwiseNullaryOp, const Eigen::Matrix >, const Eigen::CwiseBinaryOp, const Eigen::Solve >, Eigen::CwiseNullaryOp, Eigen::Matrix > >, const Eigen::Solve >, Eigen::Product >, Eigen::Matrix, 0>, Eigen::Transpose >, 0>, Eigen::Matrix, 0>, Eigen::Solve >, Eigen::CwiseNullaryOp, Eigen::Matrix > >, 0> > > >; _Scalar = double; int _Rows = -1; int _Cols = -1; int _Options = 0; int _MaxRows = -1; int _MaxCols = -1]’
-Regression/Source/../../Skeletons/Include/../../Inference/Include/Wald_imp.h:54:5: required from ‘void Wald_Base::compute_V() [with InputHandler = RegressionData; MatrixType = Eigen::Matrix]’
-Regression/Source/../../Skeletons/Include/../../Inference/Include/Wald_imp.h:123:5: required from ‘VectorXr Wald_Base::compute_beta_pvalue() [with InputHandler = RegressionData; MatrixType = Eigen::Matrix; VectorXr = Eigen::Matrix]’
-Regression/Source/../../Skeletons/Include/../../Inference/Include/Wald_imp.h:104:10: required from here
-/usr/local/lib/R/site-library/RcppEigen/include/Eigen/src/Core/DenseCoeffsBase.h:56:30: warning: ignoring attributes on template argument ‘Eigen::internal::packet_traits::type’ {aka ‘__m128d’} [-Wignored-attributes]
-g++: fatal error: Killed signal terminated program cc1plus
-compilation terminated.
-make: *** [/opt/R/4.4.0/lib/R/etc/Makeconf:204: Regression/Source/Rfun_Regression_Laplace.o] Error 1
-ERROR: compilation failed for package ‘fdaPDE’
-* removing ‘/tmp/workdir/fdaPDE/new/fdaPDE.Rcheck/fdaPDE’
-
-
-```
-### CRAN
-
-```
-* installing *source* package ‘fdaPDE’ ...
-** package ‘fdaPDE’ successfully unpacked and MD5 sums checked
-** using staged installation
-** libs
-using C compiler: ‘gcc (Ubuntu 13.3.0-6ubuntu2~24.04) 13.3.0’
-using C++ compiler: ‘g++ (Ubuntu 13.3.0-6ubuntu2~24.04) 13.3.0’
-using C++17
-g++ -std=gnu++17 -I"/opt/R/4.4.0/lib/R/include" -DNDEBUG -I'/usr/local/lib/R/site-library/RcppEigen/include' -I'/usr/local/lib/R/site-library/Rcpp/include' -I/usr/local/include -fpic -g -O2 -c Density_Estimation/Source/Rfun_Density_Estimation.cpp -o Density_Estimation/Source/Rfun_Density_Estimation.o
-In file included from /usr/local/lib/R/site-library/RcppEigen/include/Eigen/Core:205,
- from /usr/local/lib/R/site-library/RcppEigen/include/Eigen/StdVector:14,
-...
-/usr/local/lib/R/site-library/RcppEigen/include/Eigen/src/Core/Matrix.h:225:24: required from ‘Eigen::Matrix<_Scalar, _Rows, _Cols, _Options, _MaxRows, _MaxCols>& Eigen::Matrix<_Scalar, _Rows, _Cols, _Options, _MaxRows, _MaxCols>::operator=(const Eigen::DenseBase&) [with OtherDerived = Eigen::CwiseBinaryOp, const Eigen::CwiseNullaryOp, const Eigen::Matrix >, const Eigen::CwiseBinaryOp, const Eigen::Solve >, Eigen::CwiseNullaryOp, Eigen::Matrix > >, const Eigen::Solve >, Eigen::Product >, Eigen::Matrix, 0>, Eigen::Transpose >, 0>, Eigen::Matrix, 0>, Eigen::Solve >, Eigen::CwiseNullaryOp, Eigen::Matrix > >, 0> > > >; _Scalar = double; int _Rows = -1; int _Cols = -1; int _Options = 0; int _MaxRows = -1; int _MaxCols = -1]’
-Regression/Source/../../Skeletons/Include/../../Inference/Include/Wald_imp.h:54:5: required from ‘void Wald_Base::compute_V() [with InputHandler = RegressionData; MatrixType = Eigen::Matrix]’
-Regression/Source/../../Skeletons/Include/../../Inference/Include/Wald_imp.h:123:5: required from ‘VectorXr Wald_Base::compute_beta_pvalue() [with InputHandler = RegressionData; MatrixType = Eigen::Matrix; VectorXr = Eigen::Matrix]’
-Regression/Source/../../Skeletons/Include/../../Inference/Include/Wald_imp.h:104:10: required from here
-/usr/local/lib/R/site-library/RcppEigen/include/Eigen/src/Core/DenseCoeffsBase.h:56:30: warning: ignoring attributes on template argument ‘Eigen::internal::packet_traits::type’ {aka ‘__m128d’} [-Wignored-attributes]
-g++: fatal error: Killed signal terminated program cc1plus
-compilation terminated.
-make: *** [/opt/R/4.4.0/lib/R/etc/Makeconf:204: Regression/Source/Rfun_Regression_Laplace.o] Error 1
-ERROR: compilation failed for package ‘fdaPDE’
-* removing ‘/tmp/workdir/fdaPDE/old/fdaPDE.Rcheck/fdaPDE’
-
-
-```
-# fio
-
-
-
-* Version: 0.1.6
-* GitHub: https://github.com/albersonmiranda/fio
-* Source code: https://github.com/cran/fio
-* Date/Publication: 2025-04-06 07:50:02 UTC
-* Number of recursive dependencies: 87
-
-Run `revdepcheck::cloud_details(, "fio")` for more info
-
-
-
-## In both
-
-* checking whether package ‘fio’ can be installed ... ERROR
- ```
- Installation failed.
- See ‘/tmp/workdir/fio/new/fio.Rcheck/00install.out’ for details.
- ```
-
-## Installation
-
-### Devel
-
-```
-* installing *source* package ‘fio’ ...
-** package ‘fio’ successfully unpacked and MD5 sums checked
-** using staged installation
-Error in eval(ei, envir) :
------------------- [UNSUPPORTED RUST VERSION]------------------
-- Minimum supported Rust version is 1.77.
-- Installed Rust version is 1.75.0.
----------------------------------------------------------------
-Calls: source -> withVisible -> eval -> eval
-Execution halted
-ERROR: configuration failed for package ‘fio’
-* removing ‘/tmp/workdir/fio/new/fio.Rcheck/fio’
-
-
-```
-### CRAN
-
-```
-* installing *source* package ‘fio’ ...
-** package ‘fio’ successfully unpacked and MD5 sums checked
-** using staged installation
-Error in eval(ei, envir) :
------------------- [UNSUPPORTED RUST VERSION]------------------
-- Minimum supported Rust version is 1.77.
-- Installed Rust version is 1.75.0.
----------------------------------------------------------------
-Calls: source -> withVisible -> eval -> eval
-Execution halted
-ERROR: configuration failed for package ‘fio’
-* removing ‘/tmp/workdir/fio/old/fio.Rcheck/fio’
-
-
-```
-# geess
-
-
-
-* Version: NA
-* GitHub: NA
-* Source code: https://github.com/cran/geess
-* Number of recursive dependencies: 25
-
-Run `revdepcheck::cloud_details(, "geess")` for more info
-
-
-
-## Error before installation
-
-### Devel
-
-```
-
-
-
-
-
-
-```
-### CRAN
-
-```
-
-
-
-
-
-
-```
-# gllvm
-
-
-
-* Version: 2.0.5
-* GitHub: https://github.com/JenniNiku/gllvm
-* Source code: https://github.com/cran/gllvm
-* Date/Publication: 2025-07-13 08:20:02 UTC
-* Number of recursive dependencies: 61
-
-Run `revdepcheck::cloud_details(, "gllvm")` for more info
-
-
-
-## In both
-
-* checking whether package ‘gllvm’ can be installed ... ERROR
- ```
- Installation failed.
- See ‘/tmp/workdir/gllvm/new/gllvm.Rcheck/00install.out’ for details.
- ```
-
-## Installation
-
-### Devel
-
-```
-* installing *source* package ‘gllvm’ ...
-** package ‘gllvm’ successfully unpacked and MD5 sums checked
-** using staged installation
-** libs
-using C++ compiler: ‘g++ (Ubuntu 13.3.0-6ubuntu2~24.04) 13.3.0’
-g++ -std=gnu++17 -I"/opt/R/4.4.0/lib/R/include" -DNDEBUG -DTMBAD_FRAMEWORK -I'/usr/local/lib/R/site-library/TMB/include' -I'/usr/local/lib/R/site-library/RcppEigen/include' -I/usr/local/include -fopenmp -fpic -g -O2 -c gllvm.cpp -o gllvm.o
-In file included from /usr/local/lib/R/site-library/RcppEigen/include/Eigen/Core:205,
- from /usr/local/lib/R/site-library/RcppEigen/include/Eigen/Dense:1,
- from /usr/local/lib/R/site-library/TMB/include/TMB.hpp:92,
- from gllvm.cpp:3:
-...
-/usr/local/lib/R/site-library/TMB/include/tiny_ad/atomic.hpp:30:1: required from ‘void atomic::bessel_kOp::reverse(TMBad::ReverseArgs&) [with Type = double; int order = 3; int ninput = 2; int noutput = 8; long int mask = 9]’
-/usr/local/lib/R/site-library/TMB/include/TMBad/global.hpp:1721:28: required from ‘void TMBad::global::AddForwardMarkReverseMark::reverse(TMBad::ReverseArgs&) [with Type = double; OperatorBase = TMBad::global::AddIncrementDecrement > > >]’
-/usr/local/lib/R/site-library/TMB/include/TMBad/global.hpp:2134:57: required from ‘void TMBad::global::Complete::reverse(TMBad::ReverseArgs&) [with OperatorBase = atomic::bessel_kOp<3, 2, 8, 9>]’
-/usr/local/lib/R/site-library/TMB/include/TMBad/global.hpp:2134:10: required from here
-/usr/local/lib/R/site-library/RcppEigen/include/Eigen/src/Core/DenseCoeffsBase.h:56:30: warning: ignoring attributes on template argument ‘Eigen::internal::packet_traits::type’ {aka ‘__m128d’} [-Wignored-attributes]
-g++: fatal error: Killed signal terminated program cc1plus
-compilation terminated.
-make: *** [/opt/R/4.4.0/lib/R/etc/Makeconf:204: gllvm.o] Error 1
-ERROR: compilation failed for package ‘gllvm’
-* removing ‘/tmp/workdir/gllvm/new/gllvm.Rcheck/gllvm’
-
-
-```
-### CRAN
-
-```
-* installing *source* package ‘gllvm’ ...
-** package ‘gllvm’ successfully unpacked and MD5 sums checked
-** using staged installation
-** libs
-using C++ compiler: ‘g++ (Ubuntu 13.3.0-6ubuntu2~24.04) 13.3.0’
-g++ -std=gnu++17 -I"/opt/R/4.4.0/lib/R/include" -DNDEBUG -DTMBAD_FRAMEWORK -I'/usr/local/lib/R/site-library/TMB/include' -I'/usr/local/lib/R/site-library/RcppEigen/include' -I/usr/local/include -fopenmp -fpic -g -O2 -c gllvm.cpp -o gllvm.o
-In file included from /usr/local/lib/R/site-library/RcppEigen/include/Eigen/Core:205,
- from /usr/local/lib/R/site-library/RcppEigen/include/Eigen/Dense:1,
- from /usr/local/lib/R/site-library/TMB/include/TMB.hpp:92,
- from gllvm.cpp:3:
-...
-/usr/local/lib/R/site-library/TMB/include/tiny_ad/atomic.hpp:30:1: required from ‘void atomic::bessel_kOp::reverse(TMBad::ReverseArgs&) [with Type = double; int order = 3; int ninput = 2; int noutput = 8; long int mask = 9]’
-/usr/local/lib/R/site-library/TMB/include/TMBad/global.hpp:1721:28: required from ‘void TMBad::global::AddForwardMarkReverseMark::reverse(TMBad::ReverseArgs&) [with Type = double; OperatorBase = TMBad::global::AddIncrementDecrement > > >]’
-/usr/local/lib/R/site-library/TMB/include/TMBad/global.hpp:2134:57: required from ‘void TMBad::global::Complete::reverse(TMBad::ReverseArgs&) [with OperatorBase = atomic::bessel_kOp<3, 2, 8, 9>]’
-/usr/local/lib/R/site-library/TMB/include/TMBad/global.hpp:2134:10: required from here
-/usr/local/lib/R/site-library/RcppEigen/include/Eigen/src/Core/DenseCoeffsBase.h:56:30: warning: ignoring attributes on template argument ‘Eigen::internal::packet_traits::type’ {aka ‘__m128d’} [-Wignored-attributes]
-g++: fatal error: Killed signal terminated program cc1plus
-compilation terminated.
-make: *** [/opt/R/4.4.0/lib/R/etc/Makeconf:204: gllvm.o] Error 1
-ERROR: compilation failed for package ‘gllvm’
-* removing ‘/tmp/workdir/gllvm/old/gllvm.Rcheck/gllvm’
-
-
-```
-# gpboost
-
-
-
-* Version: 1.6.1
-* GitHub: https://github.com/fabsig/GPBoost
-* Source code: https://github.com/cran/gpboost
-* Date/Publication: 2025-07-23 08:30:02 UTC
-* Number of recursive dependencies: 28
-
-Run `revdepcheck::cloud_details(, "gpboost")` for more info
-
-
-
-## In both
-
-* checking whether package ‘gpboost’ can be installed ... ERROR
- ```
- Installation failed.
- See ‘/tmp/workdir/gpboost/new/gpboost.Rcheck/00install.out’ for details.
- ```
-
-## Installation
-
-### Devel
-
-```
-* installing *source* package ‘gpboost’ ...
-** package ‘gpboost’ successfully unpacked and MD5 sums checked
-** using staged installation
-checking location of R... /opt/R/4.4.0/lib/R
-checking whether MM_PREFETCH works... yes
-checking whether MM_MALLOC works... yes
-configure: creating ./config.status
-config.status: creating src/Makevars
-** libs
-using C compiler: ‘gcc (Ubuntu 13.3.0-6ubuntu2~24.04) 13.3.0’
-...
-./include/GPBoost/re_model_template.h:1456:6: required from ‘void GPBoost::REModelTemplate::OptimLinRegrCoefCovPar(const double*, const double*, int, double*, double*, int&, double*, double*, double*, double*, bool, const double*, bool, bool, bool, bool, bool) [with T_mat = Eigen::SparseMatrix; T_chol = Eigen::SimplicialLLT, 1, Eigen::AMDOrdering >]’
-re_model.cpp:312:40: required from here
-./include/Eigen/src/Core/CoreEvaluators.h:1064:54: warning: ignoring attributes on template argument ‘Eigen::internal::packet_traits::type’ {aka ‘__m128d’} [-Wignored-attributes]
- 1064 | PacketAlignment = unpacket_traits::alignment,
- | ^~~~~~~~~
-g++: fatal error: Killed signal terminated program cc1plus
-compilation terminated.
-make: *** [/opt/R/4.4.0/lib/R/etc/Makeconf:204: re_model.o] Error 1
-ERROR: compilation failed for package ‘gpboost’
-* removing ‘/tmp/workdir/gpboost/new/gpboost.Rcheck/gpboost’
-
-
-```
-### CRAN
-
-```
-* installing *source* package ‘gpboost’ ...
-** package ‘gpboost’ successfully unpacked and MD5 sums checked
-** using staged installation
-checking location of R... /opt/R/4.4.0/lib/R
-checking whether MM_PREFETCH works... yes
-checking whether MM_MALLOC works... yes
-configure: creating ./config.status
-config.status: creating src/Makevars
-** libs
-using C compiler: ‘gcc (Ubuntu 13.3.0-6ubuntu2~24.04) 13.3.0’
-...
-./include/GPBoost/re_model_template.h:1456:6: required from ‘void GPBoost::REModelTemplate::OptimLinRegrCoefCovPar(const double*, const double*, int, double*, double*, int&, double*, double*, double*, double*, bool, const double*, bool, bool, bool, bool, bool) [with T_mat = Eigen::SparseMatrix; T_chol = Eigen::SimplicialLLT, 1, Eigen::AMDOrdering >]’
-re_model.cpp:312:40: required from here
-./include/Eigen/src/Core/CoreEvaluators.h:1064:54: warning: ignoring attributes on template argument ‘Eigen::internal::packet_traits::type’ {aka ‘__m128d’} [-Wignored-attributes]
- 1064 | PacketAlignment = unpacket_traits::alignment,
- | ^~~~~~~~~
-g++: fatal error: Killed signal terminated program cc1plus
-compilation terminated.
-make: *** [/opt/R/4.4.0/lib/R/etc/Makeconf:204: re_model.o] Error 1
-ERROR: compilation failed for package ‘gpboost’
-* removing ‘/tmp/workdir/gpboost/old/gpboost.Rcheck/gpboost’
-
-
-```
-# gpuR
-
-
-
-* Version: 2.0.6
-* GitHub: https://github.com/cdeterman/gpuR
-* Source code: https://github.com/cran/gpuR
-* Date/Publication: 2024-05-23 16:00:02 UTC
-* Number of recursive dependencies: 32
-
-Run `revdepcheck::cloud_details(, "gpuR")` for more info
-
-
-
-## In both
-
-* checking whether package ‘gpuR’ can be installed ... ERROR
- ```
- Installation failed.
- See ‘/tmp/workdir/gpuR/new/gpuR.Rcheck/00install.out’ for details.
- ```
-
-## Installation
-
-### Devel
-
-```
-* installing *source* package ‘gpuR’ ...
-** package ‘gpuR’ successfully unpacked and MD5 sums checked
-** using staged installation
-OPENCL_FLAGS not set, using default -DCL_HPP_MINIMUM_OPENCL_VERSION=110 -DCL_USE_DEPRECATED_OPENCL_1_2_APIS -DCL_HPP_TARGET_OPENCL_VERSION=120
-Linux OS
-found OpenCL library
-Checking OpenCL C++ API
-OPENCL_INC not set, using default include directory /usr/include
-No OpenCL C++ API found, will use the headers contained in the package
-
-...
-/usr/local/lib/R/site-library/RcppEigen/include/Eigen/src/Core/Assign.h:66:28: required from ‘Derived& Eigen::MatrixBase::operator=(const Eigen::DenseBase&) [with OtherDerived = Eigen::Matrix; Derived = Eigen::Block, 0, Eigen::OuterStride<> >, -1, 1, true>]’
-../inst/include/gpuR/dynEigenMat.hpp:192:30: required from ‘void dynEigenMat::setCol(SEXP, int) [with T = double; SEXP = SEXPREC*]’
-../inst/include/gpuR/dynEigenMat.hpp:383:16: required from here
-/usr/local/lib/R/site-library/RcppEigen/include/Eigen/src/Core/CoreEvaluators.h:1071:54: warning: ignoring attributes on template argument ‘Eigen::internal::packet_traits::type’ {aka ‘__m128d’} [-Wignored-attributes]
-g++ -std=gnu++17 -shared -L/opt/R/4.4.0/lib/R/lib -L/usr/local/lib -o gpuR.so RcppExports.o chol.o context.o custom_math.o device.o gpuEigenPtr.o gpuMatrix_igemm.o norm.o platform.o set_row_order.o solve.o synchronize.o trunc_gpuMat.o utils-vcl.o utils.o vclPtr.o vienna_blas1.o vienna_blas2.o vienna_blas3.o vienna_eigen.o vienna_qr.o vienna_stats.o vienna_svd.o -lOpenCL -L/opt/R/4.4.0/lib/R/lib -lR
-/usr/bin/ld: cannot find -lOpenCL: No such file or directory
-collect2: error: ld returned 1 exit status
-make: *** [/opt/R/4.4.0/lib/R/share/make/shlib.mk:10: gpuR.so] Error 1
-ERROR: compilation failed for package ‘gpuR’
-* removing ‘/tmp/workdir/gpuR/new/gpuR.Rcheck/gpuR’
-
-
-```
-### CRAN
-
-```
-* installing *source* package ‘gpuR’ ...
-** package ‘gpuR’ successfully unpacked and MD5 sums checked
-** using staged installation
-OPENCL_FLAGS not set, using default -DCL_HPP_MINIMUM_OPENCL_VERSION=110 -DCL_USE_DEPRECATED_OPENCL_1_2_APIS -DCL_HPP_TARGET_OPENCL_VERSION=120
-Linux OS
-found OpenCL library
-Checking OpenCL C++ API
-OPENCL_INC not set, using default include directory /usr/include
-No OpenCL C++ API found, will use the headers contained in the package
-
-...
-/usr/local/lib/R/site-library/RcppEigen/include/Eigen/src/Core/Assign.h:66:28: required from ‘Derived& Eigen::MatrixBase::operator=(const Eigen::DenseBase&) [with OtherDerived = Eigen::Matrix; Derived = Eigen::Block, 0, Eigen::OuterStride<> >, -1, 1, true>]’
-../inst/include/gpuR/dynEigenMat.hpp:192:30: required from ‘void dynEigenMat::setCol(SEXP, int) [with T = double; SEXP = SEXPREC*]’
-../inst/include/gpuR/dynEigenMat.hpp:383:16: required from here
-/usr/local/lib/R/site-library/RcppEigen/include/Eigen/src/Core/CoreEvaluators.h:1071:54: warning: ignoring attributes on template argument ‘Eigen::internal::packet_traits::type’ {aka ‘__m128d’} [-Wignored-attributes]
-g++ -std=gnu++17 -shared -L/opt/R/4.4.0/lib/R/lib -L/usr/local/lib -o gpuR.so RcppExports.o chol.o context.o custom_math.o device.o gpuEigenPtr.o gpuMatrix_igemm.o norm.o platform.o set_row_order.o solve.o synchronize.o trunc_gpuMat.o utils-vcl.o utils.o vclPtr.o vienna_blas1.o vienna_blas2.o vienna_blas3.o vienna_eigen.o vienna_qr.o vienna_stats.o vienna_svd.o -lOpenCL -L/opt/R/4.4.0/lib/R/lib -lR
-/usr/bin/ld: cannot find -lOpenCL: No such file or directory
-collect2: error: ld returned 1 exit status
-make: *** [/opt/R/4.4.0/lib/R/share/make/shlib.mk:10: gpuR.so] Error 1
-ERROR: compilation failed for package ‘gpuR’
-* removing ‘/tmp/workdir/gpuR/old/gpuR.Rcheck/gpuR’
-
-
-```
-# loon.shiny
-
-
-
-* Version: 1.0.3
-* GitHub: NA
-* Source code: https://github.com/cran/loon.shiny
-* Date/Publication: 2022-10-08 15:30:02 UTC
-* Number of recursive dependencies: 133
-
-Run `revdepcheck::cloud_details(, "loon.shiny")` for more info
-
-
-
-## Error before installation
-
-### Devel
-
-```
-* using log directory ‘/tmp/workdir/loon.shiny/new/loon.shiny.Rcheck’
-* using R version 4.4.0 (2024-04-24)
-* using platform: x86_64-pc-linux-gnu
-* R was compiled by
- gcc (Ubuntu 13.3.0-6ubuntu2~24.04) 13.3.0
- GNU Fortran (Ubuntu 13.3.0-6ubuntu2~24.04) 13.3.0
-* running under: Ubuntu 24.04.2 LTS
-* using session charset: UTF-8
-* using option ‘--no-manual’
-* checking for file ‘loon.shiny/DESCRIPTION’ ... OK
-...
-* this is package ‘loon.shiny’ version ‘1.0.3’
-* package encoding: UTF-8
-* checking package namespace information ... OK
-* checking package dependencies ... ERROR
-Packages required but not available: 'loon', 'loon.ggplot'
-
-See section ‘The DESCRIPTION file’ in the ‘Writing R Extensions’
-manual.
-* DONE
-Status: 1 ERROR
-
-
-
-
-
-```
-### CRAN
-
-```
-* using log directory ‘/tmp/workdir/loon.shiny/old/loon.shiny.Rcheck’
-* using R version 4.4.0 (2024-04-24)
-* using platform: x86_64-pc-linux-gnu
-* R was compiled by
- gcc (Ubuntu 13.3.0-6ubuntu2~24.04) 13.3.0
- GNU Fortran (Ubuntu 13.3.0-6ubuntu2~24.04) 13.3.0
-* running under: Ubuntu 24.04.2 LTS
-* using session charset: UTF-8
-* using option ‘--no-manual’
-* checking for file ‘loon.shiny/DESCRIPTION’ ... OK
-...
-* this is package ‘loon.shiny’ version ‘1.0.3’
-* package encoding: UTF-8
-* checking package namespace information ... OK
-* checking package dependencies ... ERROR
-Packages required but not available: 'loon', 'loon.ggplot'
-
-See section ‘The DESCRIPTION file’ in the ‘Writing R Extensions’
-manual.
-* DONE
-Status: 1 ERROR
-
-
-
-
-
-```
-# loon.tourr
-
-
-
-* Version: 0.1.4
-* GitHub: https://github.com/z267xu/loon.tourr
-* Source code: https://github.com/cran/loon.tourr
-* Date/Publication: 2024-04-09 09:40:02 UTC
-* Number of recursive dependencies: 152
-
-Run `revdepcheck::cloud_details(, "loon.tourr")` for more info
-
-
-
-## Error before installation
-
-### Devel
-
-```
-* using log directory ‘/tmp/workdir/loon.tourr/new/loon.tourr.Rcheck’
-* using R version 4.4.0 (2024-04-24)
-* using platform: x86_64-pc-linux-gnu
-* R was compiled by
- gcc (Ubuntu 13.3.0-6ubuntu2~24.04) 13.3.0
- GNU Fortran (Ubuntu 13.3.0-6ubuntu2~24.04) 13.3.0
-* running under: Ubuntu 24.04.2 LTS
-* using session charset: UTF-8
-* using option ‘--no-manual’
-* checking for file ‘loon.tourr/DESCRIPTION’ ... OK
-...
-* this is package ‘loon.tourr’ version ‘0.1.4’
-* package encoding: UTF-8
-* checking package namespace information ... OK
-* checking package dependencies ... ERROR
-Packages required but not available: 'loon', 'loon.ggplot'
-
-See section ‘The DESCRIPTION file’ in the ‘Writing R Extensions’
-manual.
-* DONE
-Status: 1 ERROR
-
-
-
-
-
-```
-### CRAN
-
-```
-* using log directory ‘/tmp/workdir/loon.tourr/old/loon.tourr.Rcheck’
-* using R version 4.4.0 (2024-04-24)
-* using platform: x86_64-pc-linux-gnu
-* R was compiled by
- gcc (Ubuntu 13.3.0-6ubuntu2~24.04) 13.3.0
- GNU Fortran (Ubuntu 13.3.0-6ubuntu2~24.04) 13.3.0
-* running under: Ubuntu 24.04.2 LTS
-* using session charset: UTF-8
-* using option ‘--no-manual’
-* checking for file ‘loon.tourr/DESCRIPTION’ ... OK
-...
-* this is package ‘loon.tourr’ version ‘0.1.4’
-* package encoding: UTF-8
-* checking package namespace information ... OK
-* checking package dependencies ... ERROR
-Packages required but not available: 'loon', 'loon.ggplot'
-
-See section ‘The DESCRIPTION file’ in the ‘Writing R Extensions’
-manual.
-* DONE
-Status: 1 ERROR
-
-
-
-
-
-```
-# metajam
-
-
-
-* Version: 0.3.1
-* GitHub: https://github.com/NCEAS/metajam
-* Source code: https://github.com/cran/metajam
-* Date/Publication: 2024-08-16 17:50:02 UTC
-* Number of recursive dependencies: 89
-
-Run `revdepcheck::cloud_details(, "metajam")` for more info
-
-
-
-## In both
-
-* checking whether package ‘metajam’ can be installed ... ERROR
- ```
- Installation failed.
- See ‘/tmp/workdir/metajam/new/metajam.Rcheck/00install.out’ for details.
- ```
-
-## Installation
-
-### Devel
-
-```
-* installing *source* package ‘metajam’ ...
-** package ‘metajam’ successfully unpacked and MD5 sums checked
-** using staged installation
-** R
-** inst
-** byte-compile and prepare package for lazy loading
-Error in dyn.load(file, DLLpath = DLLpath, ...) :
- unable to load shared object '/usr/local/lib/R/site-library/redland/libs/redland.so':
- librdf.so.0: cannot open shared object file: No such file or directory
-Calls: ... namespaceImport -> loadNamespace -> library.dynam -> dyn.load
-Execution halted
-ERROR: lazy loading failed for package ‘metajam’
-* removing ‘/tmp/workdir/metajam/new/metajam.Rcheck/metajam’
-
-
-```
-### CRAN
-
-```
-* installing *source* package ‘metajam’ ...
-** package ‘metajam’ successfully unpacked and MD5 sums checked
-** using staged installation
-** R
-** inst
-** byte-compile and prepare package for lazy loading
-Error in dyn.load(file, DLLpath = DLLpath, ...) :
- unable to load shared object '/usr/local/lib/R/site-library/redland/libs/redland.so':
- librdf.so.0: cannot open shared object file: No such file or directory
-Calls: ... namespaceImport -> loadNamespace -> library.dynam -> dyn.load
-Execution halted
-ERROR: lazy loading failed for package ‘metajam’
-* removing ‘/tmp/workdir/metajam/old/metajam.Rcheck/metajam’
-
-
-```
-# multinma
-
-
-
-* Version: 0.8.1
-* GitHub: https://github.com/dmphillippo/multinma
-* Source code: https://github.com/cran/multinma
-* Date/Publication: 2025-05-31 00:00:02 UTC
-* Number of recursive dependencies: 149
-
-Run `revdepcheck::cloud_details(, "multinma")` for more info
-
-
-
-## In both
-
-* checking whether package ‘multinma’ can be installed ... ERROR
- ```
- Installation failed.
- See ‘/tmp/workdir/multinma/new/multinma.Rcheck/00install.out’ for details.
- ```
-
-## Installation
-
-### Devel
-
-```
-* installing *source* package ‘multinma’ ...
-** package ‘multinma’ successfully unpacked and MD5 sums checked
-** using staged installation
-** libs
-using C++ compiler: ‘g++ (Ubuntu 13.3.0-6ubuntu2~24.04) 13.3.0’
-using C++17
-
-
-g++ -std=gnu++17 -I"/opt/R/4.4.0/lib/R/include" -DNDEBUG -I"../inst/include" -I"/usr/local/lib/R/site-library/StanHeaders/include/src" -DBOOST_DISABLE_ASSERTS -DEIGEN_NO_DEBUG -DBOOST_MATH_OVERFLOW_ERROR_POLICY=errno_on_error -DUSE_STANC3 -D_HAS_AUTO_PTR_ETC=0 -I'/usr/local/lib/R/site-library/BH/include' -I'/usr/local/lib/R/site-library/Rcpp/include' -I'/usr/local/lib/R/site-library/RcppEigen/include' -I'/usr/local/lib/R/site-library/RcppParallel/include' -I'/usr/local/lib/R/site-library/rstan/include' -I'/usr/local/lib/R/site-library/StanHeaders/include' -I/usr/local/include -I'/usr/local/lib/R/site-library/RcppParallel/include' -D_REENTRANT -DSTAN_THREADS -fpic -g -O2 -c RcppExports.cpp -o RcppExports.o
-In file included from /usr/local/lib/R/site-library/RcppEigen/include/Eigen/Core:205,
-...
-/usr/local/lib/R/site-library/StanHeaders/include/src/stan/mcmc/hmc/hamiltonians/dense_e_metric.hpp:22:0: required from ‘double stan::mcmc::dense_e_metric::T(stan::mcmc::dense_e_point&) [with Model = model_survival_param_namespace::model_survival_param; BaseRNG = boost::random::additive_combine_engine, boost::random::linear_congruential_engine >]’
-/usr/local/lib/R/site-library/StanHeaders/include/src/stan/mcmc/hmc/hamiltonians/dense_e_metric.hpp:21:0: required from here
-/usr/local/lib/R/site-library/RcppEigen/include/Eigen/src/Core/DenseCoeffsBase.h:654:74: warning: ignoring attributes on template argument ‘Eigen::internal::packet_traits::type’ {aka ‘__m128d’} [-Wignored-attributes]
- 654 | return internal::first_aligned::alignment),Derived>(m);
- | ^~~~~~~~~
-g++: fatal error: Killed signal terminated program cc1plus
-compilation terminated.
-make: *** [/opt/R/4.4.0/lib/R/etc/Makeconf:202: stanExports_survival_param.o] Error 1
-ERROR: compilation failed for package ‘multinma’
-* removing ‘/tmp/workdir/multinma/new/multinma.Rcheck/multinma’
-
-
-```
-### CRAN
-
-```
-* installing *source* package ‘multinma’ ...
-** package ‘multinma’ successfully unpacked and MD5 sums checked
-** using staged installation
-** libs
-using C++ compiler: ‘g++ (Ubuntu 13.3.0-6ubuntu2~24.04) 13.3.0’
-using C++17
-
-
-g++ -std=gnu++17 -I"/opt/R/4.4.0/lib/R/include" -DNDEBUG -I"../inst/include" -I"/usr/local/lib/R/site-library/StanHeaders/include/src" -DBOOST_DISABLE_ASSERTS -DEIGEN_NO_DEBUG -DBOOST_MATH_OVERFLOW_ERROR_POLICY=errno_on_error -DUSE_STANC3 -D_HAS_AUTO_PTR_ETC=0 -I'/usr/local/lib/R/site-library/BH/include' -I'/usr/local/lib/R/site-library/Rcpp/include' -I'/usr/local/lib/R/site-library/RcppEigen/include' -I'/usr/local/lib/R/site-library/RcppParallel/include' -I'/usr/local/lib/R/site-library/rstan/include' -I'/usr/local/lib/R/site-library/StanHeaders/include' -I/usr/local/include -I'/usr/local/lib/R/site-library/RcppParallel/include' -D_REENTRANT -DSTAN_THREADS -fpic -g -O2 -c RcppExports.cpp -o RcppExports.o
-In file included from /usr/local/lib/R/site-library/RcppEigen/include/Eigen/Core:205,
-...
-/usr/local/lib/R/site-library/StanHeaders/include/src/stan/mcmc/hmc/hamiltonians/dense_e_metric.hpp:22:0: required from ‘double stan::mcmc::dense_e_metric::T(stan::mcmc::dense_e_point&) [with Model = model_survival_param_namespace::model_survival_param; BaseRNG = boost::random::additive_combine_engine, boost::random::linear_congruential_engine >]’
-/usr/local/lib/R/site-library/StanHeaders/include/src/stan/mcmc/hmc/hamiltonians/dense_e_metric.hpp:21:0: required from here
-/usr/local/lib/R/site-library/RcppEigen/include/Eigen/src/Core/DenseCoeffsBase.h:654:74: warning: ignoring attributes on template argument ‘Eigen::internal::packet_traits::type’ {aka ‘__m128d’} [-Wignored-attributes]
- 654 | return internal::first_aligned::alignment),Derived>(m);
- | ^~~~~~~~~
-g++: fatal error: Killed signal terminated program cc1plus
-compilation terminated.
-make: *** [/opt/R/4.4.0/lib/R/etc/Makeconf:202: stanExports_survival_param.o] Error 1
-ERROR: compilation failed for package ‘multinma’
-* removing ‘/tmp/workdir/multinma/old/multinma.Rcheck/multinma’
-
-
-```
-# OpenMx
-
-
-
-* Version: NA
-* GitHub: NA
-* Source code: https://github.com/cran/OpenMx
-* Number of recursive dependencies: 159
-
-Run `revdepcheck::cloud_details(, "OpenMx")` for more info
-
-
-
-## Error before installation
-
-### Devel
-
-```
-
-
-
-
-
-
-```
-### CRAN
-
-```
-
-
-
-
-
-
-```
-# rdflib
-
-
-
-* Version: 0.2.9
-* GitHub: https://github.com/ropensci/rdflib
-* Source code: https://github.com/cran/rdflib
-* Date/Publication: 2024-08-17 06:00:05 UTC
-* Number of recursive dependencies: 92
-
-Run `revdepcheck::cloud_details(, "rdflib")` for more info
-
-
-
-## In both
-
-* checking whether package ‘rdflib’ can be installed ... ERROR
- ```
- Installation failed.
- See ‘/tmp/workdir/rdflib/new/rdflib.Rcheck/00install.out’ for details.
- ```
-
-## Installation
-
-### Devel
-
-```
-* installing *source* package ‘rdflib’ ...
-** package ‘rdflib’ successfully unpacked and MD5 sums checked
-** using staged installation
-** R
-** inst
-** byte-compile and prepare package for lazy loading
-Error in dyn.load(file, DLLpath = DLLpath, ...) :
- unable to load shared object '/usr/local/lib/R/site-library/redland/libs/redland.so':
- librdf.so.0: cannot open shared object file: No such file or directory
-Calls: ... asNamespace -> loadNamespace -> library.dynam -> dyn.load
-Execution halted
-ERROR: lazy loading failed for package ‘rdflib’
-* removing ‘/tmp/workdir/rdflib/new/rdflib.Rcheck/rdflib’
-
-
-```
-### CRAN
-
-```
-* installing *source* package ‘rdflib’ ...
-** package ‘rdflib’ successfully unpacked and MD5 sums checked
-** using staged installation
-** R
-** inst
-** byte-compile and prepare package for lazy loading
-Error in dyn.load(file, DLLpath = DLLpath, ...) :
- unable to load shared object '/usr/local/lib/R/site-library/redland/libs/redland.so':
- librdf.so.0: cannot open shared object file: No such file or directory
-Calls: ... asNamespace -> loadNamespace -> library.dynam -> dyn.load
-Execution halted
-ERROR: lazy loading failed for package ‘rdflib’
-* removing ‘/tmp/workdir/rdflib/old/rdflib.Rcheck/rdflib’
-
-
-```
-# recommenderlab
-
-
-
-* Version: NA
-* GitHub: NA
-* Source code: https://github.com/cran/recommenderlab
-* Number of recursive dependencies: 36
-
-Run `revdepcheck::cloud_details(, "recommenderlab")` for more info
-
-
-
-## Error before installation
-
-### Devel
-
-```
-
-
-
-
-
-
-```
-### CRAN
-
-```
-
-
-
-
-
-
-```
-# redland
-
-
-
-* Version: 1.0.17-18
-* GitHub: https://github.com/ropensci/redland-bindings
-* Source code: https://github.com/cran/redland
-* Date/Publication: 2024-02-24 01:10:02 UTC
-* Number of recursive dependencies: 53
-
-Run `revdepcheck::cloud_details(, "redland")` for more info
-
-
-
-## In both
-
-* checking whether package ‘redland’ can be installed ... ERROR
- ```
- Installation failed.
- See ‘/tmp/workdir/redland/new/redland.Rcheck/00install.out’ for details.
- ```
-
-## Installation
-
-### Devel
-
-```
-* installing *source* package ‘redland’ ...
-** package ‘redland’ successfully unpacked and MD5 sums checked
-** using staged installation
-Using PKG_CFLAGS=
-Using PKG_LIBS=-lrdf
-------------------------- ANTICONF ERROR ---------------------------
-Configuration failed because redland was not found. Try installing:
- * deb: librdf0-dev (Debian, Ubuntu, etc)
- * rpm: redland-devel (Fedora, EPEL)
- * brew: redland (OSX)
-If redland is already installed, check that 'pkg-config' is in your
-PATH and PKG_CONFIG_PATH contains a redland.pc file. If pkg-config
-is unavailable you can set INCLUDE_DIR and LIB_DIR manually via:
-R CMD INSTALL --configure-vars='INCLUDE_DIR=... LIB_DIR=...'
---------------------------------------------------------------------
-ERROR: configuration failed for package ‘redland’
-* removing ‘/tmp/workdir/redland/new/redland.Rcheck/redland’
-
-
-```
-### CRAN
-
-```
-* installing *source* package ‘redland’ ...
-** package ‘redland’ successfully unpacked and MD5 sums checked
-** using staged installation
-Using PKG_CFLAGS=
-Using PKG_LIBS=-lrdf
-------------------------- ANTICONF ERROR ---------------------------
-Configuration failed because redland was not found. Try installing:
- * deb: librdf0-dev (Debian, Ubuntu, etc)
- * rpm: redland-devel (Fedora, EPEL)
- * brew: redland (OSX)
-If redland is already installed, check that 'pkg-config' is in your
-PATH and PKG_CONFIG_PATH contains a redland.pc file. If pkg-config
-is unavailable you can set INCLUDE_DIR and LIB_DIR manually via:
-R CMD INSTALL --configure-vars='INCLUDE_DIR=... LIB_DIR=...'
---------------------------------------------------------------------
-ERROR: configuration failed for package ‘redland’
-* removing ‘/tmp/workdir/redland/old/redland.Rcheck/redland’
-
-
-```
-# rstanarm
-
-
-
-* Version: 2.32.1
-* GitHub: https://github.com/stan-dev/rstanarm
-* Source code: https://github.com/cran/rstanarm
-* Date/Publication: 2024-01-18 23:00:03 UTC
-* Number of recursive dependencies: 139
-
-Run `revdepcheck::cloud_details(, "rstanarm")` for more info
-
-
-
-## In both
-
-* checking whether package ‘rstanarm’ can be installed ... ERROR
- ```
- Installation failed.
- See ‘/tmp/workdir/rstanarm/new/rstanarm.Rcheck/00install.out’ for details.
- ```
-
-## Installation
-
-### Devel
-
-```
-* installing *source* package ‘rstanarm’ ...
-** package ‘rstanarm’ successfully unpacked and MD5 sums checked
-** using staged installation
-** libs
-using C++ compiler: ‘g++ (Ubuntu 13.3.0-6ubuntu2~24.04) 13.3.0’
-using C++17
-"/opt/R/4.4.0/lib/R/bin/Rscript" -e "source(file.path('..', 'tools', 'make_cc.R')); make_cc(commandArgs(TRUE))" stan_files/bernoulli.stan
-Wrote C++ file "stan_files/bernoulli.cc"
-
-
-...
-/usr/local/lib/R/site-library/StanHeaders/include/stan/math/rev/fun/quad_form.hpp:88:0: required from here
-/usr/local/lib/R/site-library/RcppEigen/include/Eigen/src/Core/DenseCoeffsBase.h:654:74: warning: ignoring attributes on template argument ‘Eigen::internal::packet_traits::type’ {aka ‘__m128d’} [-Wignored-attributes]
- 654 | return internal::first_aligned::alignment),Derived>(m);
- | ^~~~~~~~~
-g++: fatal error: Killed signal terminated program cc1plus
-compilation terminated.
-make: *** [/opt/R/4.4.0/lib/R/etc/Makeconf:202: stan_files/continuous.o] Error 1
-rm stan_files/bernoulli.cc stan_files/binomial.cc stan_files/continuous.cc
-ERROR: compilation failed for package ‘rstanarm’
-* removing ‘/tmp/workdir/rstanarm/new/rstanarm.Rcheck/rstanarm’
-
-
-```
-### CRAN
-
-```
-* installing *source* package ‘rstanarm’ ...
-** package ‘rstanarm’ successfully unpacked and MD5 sums checked
-** using staged installation
-** libs
-using C++ compiler: ‘g++ (Ubuntu 13.3.0-6ubuntu2~24.04) 13.3.0’
-using C++17
-"/opt/R/4.4.0/lib/R/bin/Rscript" -e "source(file.path('..', 'tools', 'make_cc.R')); make_cc(commandArgs(TRUE))" stan_files/bernoulli.stan
-Wrote C++ file "stan_files/bernoulli.cc"
-
-
-...
-/usr/local/lib/R/site-library/StanHeaders/include/stan/math/rev/fun/quad_form.hpp:88:0: required from here
-/usr/local/lib/R/site-library/RcppEigen/include/Eigen/src/Core/DenseCoeffsBase.h:654:74: warning: ignoring attributes on template argument ‘Eigen::internal::packet_traits::type’ {aka ‘__m128d’} [-Wignored-attributes]
- 654 | return internal::first_aligned::alignment),Derived>(m);
- | ^~~~~~~~~
-g++: fatal error: Killed signal terminated program cc1plus
-compilation terminated.
-make: *** [/opt/R/4.4.0/lib/R/etc/Makeconf:202: stan_files/continuous.o] Error 1
-rm stan_files/bernoulli.cc stan_files/binomial.cc stan_files/continuous.cc
-ERROR: compilation failed for package ‘rstanarm’
-* removing ‘/tmp/workdir/rstanarm/old/rstanarm.Rcheck/rstanarm’
-
-
-```
-# SQLFormatteR
-
-
-
-* Version: 0.0.2
-* GitHub: https://github.com/dataupsurge/SQLFormatteR
-* Source code: https://github.com/cran/SQLFormatteR
-* Date/Publication: 2025-04-13 06:30:01 UTC
-* Number of recursive dependencies: 70
-
-Run `revdepcheck::cloud_details(, "SQLFormatteR")` for more info
-
-
-
-## In both
-
-* checking whether package ‘SQLFormatteR’ can be installed ... ERROR
- ```
- Installation failed.
- See ‘/tmp/workdir/SQLFormatteR/new/SQLFormatteR.Rcheck/00install.out’ for details.
- ```
-
-## Installation
-
-### Devel
-
-```
-* installing *source* package ‘SQLFormatteR’ ...
-** package ‘SQLFormatteR’ successfully unpacked and MD5 sums checked
-** using staged installation
-Error in eval(ei, envir) :
------------------- [UNSUPPORTED RUST VERSION]------------------
-- Minimum supported Rust version is 1.78.0.
-- Installed Rust version is 1.75.0.
----------------------------------------------------------------
-Calls: source -> withVisible -> eval -> eval
-Execution halted
-ERROR: configuration failed for package ‘SQLFormatteR’
-* removing ‘/tmp/workdir/SQLFormatteR/new/SQLFormatteR.Rcheck/SQLFormatteR’
-
-
-```
-### CRAN
-
-```
-* installing *source* package ‘SQLFormatteR’ ...
-** package ‘SQLFormatteR’ successfully unpacked and MD5 sums checked
-** using staged installation
-Error in eval(ei, envir) :
------------------- [UNSUPPORTED RUST VERSION]------------------
-- Minimum supported Rust version is 1.78.0.
-- Installed Rust version is 1.75.0.
----------------------------------------------------------------
-Calls: source -> withVisible -> eval -> eval
-Execution halted
-ERROR: configuration failed for package ‘SQLFormatteR’
-* removing ‘/tmp/workdir/SQLFormatteR/old/SQLFormatteR.Rcheck/SQLFormatteR’
-
-
-```
-# string2path
-
-
-
-* Version: 0.2.2
-* GitHub: https://github.com/yutannihilation/string2path
-* Source code: https://github.com/cran/string2path
-* Date/Publication: 2025-03-25 23:20:02 UTC
-* Number of recursive dependencies: 35
-
-Run `revdepcheck::cloud_details(, "string2path")` for more info
-
-
-
-## In both
-
-* checking whether package ‘string2path’ can be installed ... ERROR
- ```
- Installation failed.
- See ‘/tmp/workdir/string2path/new/string2path.Rcheck/00install.out’ for details.
- ```
-
-## Installation
-
-### Devel
-
-```
-* installing *source* package ‘string2path’ ...
-** package ‘string2path’ successfully unpacked and MD5 sums checked
-** using staged installation
-*** Checking if cargo is installed
-*** Checking if cargo is newer than the required version
-
--------------- ERROR: CONFIGURATION FAILED --------------------
-
-[cargo check result]
-The installed version of cargo (1.75.0) is older than the requirement (1.78.0)
-
-Please refer to to install Rust.
-
----------------------------------------------------------------
-
-ERROR: configuration failed for package ‘string2path’
-* removing ‘/tmp/workdir/string2path/new/string2path.Rcheck/string2path’
-
-
-```
-### CRAN
-
-```
-* installing *source* package ‘string2path’ ...
-** package ‘string2path’ successfully unpacked and MD5 sums checked
-** using staged installation
-*** Checking if cargo is installed
-*** Checking if cargo is newer than the required version
-
--------------- ERROR: CONFIGURATION FAILED --------------------
-
-[cargo check result]
-The installed version of cargo (1.75.0) is older than the requirement (1.78.0)
-
-Please refer to to install Rust.
-
----------------------------------------------------------------
-
-ERROR: configuration failed for package ‘string2path’
-* removing ‘/tmp/workdir/string2path/old/string2path.Rcheck/string2path’
-
-
-```
-# TestAnaAPP
-
-
-
-* Version: 1.1.2
-* GitHub: https://github.com/jiangyouxiang/TestAnaAPP
-* Source code: https://github.com/cran/TestAnaAPP
-* Date/Publication: 2024-11-09 04:00:02 UTC
-* Number of recursive dependencies: 263
-
-Run `revdepcheck::cloud_details(, "TestAnaAPP")` for more info
-
-
-
-## In both
-
-* checking whether package ‘TestAnaAPP’ can be installed ... ERROR
- ```
- Installation failed.
- See ‘/tmp/workdir/TestAnaAPP/new/TestAnaAPP.Rcheck/00install.out’ for details.
- ```
-
-## Installation
-
-### Devel
-
-```
-* installing *source* package ‘TestAnaAPP’ ...
-** package ‘TestAnaAPP’ successfully unpacked and MD5 sums checked
-** using staged installation
-** R
-** inst
-** byte-compile and prepare package for lazy loading
-Error in loadNamespace(i, c(lib.loc, .libPaths()), versionCheck = vI[[i]]) :
- there is no package called ‘OpenMx’
-Calls: ... loadNamespace -> withRestarts -> withOneRestart -> doWithOneRestart
-Execution halted
-ERROR: lazy loading failed for package ‘TestAnaAPP’
-* removing ‘/tmp/workdir/TestAnaAPP/new/TestAnaAPP.Rcheck/TestAnaAPP’
-
-
-```
-### CRAN
-
-```
-* installing *source* package ‘TestAnaAPP’ ...
-** package ‘TestAnaAPP’ successfully unpacked and MD5 sums checked
-** using staged installation
-** R
-** inst
-** byte-compile and prepare package for lazy loading
-Error in loadNamespace(i, c(lib.loc, .libPaths()), versionCheck = vI[[i]]) :
- there is no package called ‘OpenMx’
-Calls: ... loadNamespace -> withRestarts -> withOneRestart -> doWithOneRestart
-Execution halted
-ERROR: lazy loading failed for package ‘TestAnaAPP’
-* removing ‘/tmp/workdir/TestAnaAPP/old/TestAnaAPP.Rcheck/TestAnaAPP’
-
-
-```
-# TriDimRegression
-
-
-
-* Version: 1.0.2
-* GitHub: https://github.com/alexander-pastukhov/tridim-regression
-* Source code: https://github.com/cran/TriDimRegression
-* Date/Publication: 2023-09-13 14:10:03 UTC
-* Number of recursive dependencies: 95
-
-Run `revdepcheck::cloud_details(, "TriDimRegression")` for more info
-
-
-
-## In both
-
-* checking whether package ‘TriDimRegression’ can be installed ... ERROR
- ```
- Installation failed.
- See ‘/tmp/workdir/TriDimRegression/new/TriDimRegression.Rcheck/00install.out’ for details.
- ```
-
-## Installation
-
-### Devel
-
-```
-* installing *source* package ‘TriDimRegression’ ...
-** package ‘TriDimRegression’ successfully unpacked and MD5 sums checked
-** using staged installation
-Error in loadNamespace(x) : there is no package called ‘rstantools’
-Calls: loadNamespace -> withRestarts -> withOneRestart -> doWithOneRestart
-Execution halted
-ERROR: configuration failed for package ‘TriDimRegression’
-* removing ‘/tmp/workdir/TriDimRegression/new/TriDimRegression.Rcheck/TriDimRegression’
-
-
-```
-### CRAN
-
-```
-* installing *source* package ‘TriDimRegression’ ...
-** package ‘TriDimRegression’ successfully unpacked and MD5 sums checked
-** using staged installation
-Error in loadNamespace(x) : there is no package called ‘rstantools’
-Calls: loadNamespace -> withRestarts -> withOneRestart -> doWithOneRestart
-Execution halted
-ERROR: configuration failed for package ‘TriDimRegression’
-* removing ‘/tmp/workdir/TriDimRegression/old/TriDimRegression.Rcheck/TriDimRegression’
-
-
-```
-# xactonomial
-
-
-
-* Version: 1.0.3
-* GitHub: https://github.com/sachsmc/xactonomial
-* Source code: https://github.com/cran/xactonomial
-* Date/Publication: 2025-04-28 13:50:02 UTC
-* Number of recursive dependencies: 41
-
-Run `revdepcheck::cloud_details(, "xactonomial")` for more info
-
-
-
-## In both
-
-* checking whether package ‘xactonomial’ can be installed ... ERROR
- ```
- Installation failed.
- See ‘/tmp/workdir/xactonomial/new/xactonomial.Rcheck/00install.out’ for details.
- ```
-
-## Installation
-
-### Devel
-
-```
-* installing *source* package ‘xactonomial’ ...
-** package ‘xactonomial’ successfully unpacked and MD5 sums checked
-** using staged installation
-Using cargo 1.75.0
-Using rustc 1.75.0 (82e1608df 2023-12-21) (built from a source tarball)
-Building for CRAN.
-Writing `src/Makevars`.
-`tools/config.R` has finished.
-** libs
-using C compiler: ‘gcc (Ubuntu 13.3.0-6ubuntu2~24.04) 13.3.0’
-...
-106 | [::std::mem::offset_of!(R_CallMethodDef, numArgs) - 16usize];
- | ^^^^^^^^^^^^^^^^^^^^^
- |
- = note: see issue #106655 for more information
-
-For more information about this error, try `rustc --explain E0658`.
-error: could not compile `xactonomial` (lib) due to 7 previous errors
-make: *** [Makevars:28: rust/target/release/libxactonomial.a] Error 101
-ERROR: compilation failed for package ‘xactonomial’
-* removing ‘/tmp/workdir/xactonomial/new/xactonomial.Rcheck/xactonomial’
-
-
-```
-### CRAN
-
-```
-* installing *source* package ‘xactonomial’ ...
-** package ‘xactonomial’ successfully unpacked and MD5 sums checked
-** using staged installation
-Using cargo 1.75.0
-Using rustc 1.75.0 (82e1608df 2023-12-21) (built from a source tarball)
-Building for CRAN.
-Writing `src/Makevars`.
-`tools/config.R` has finished.
-** libs
-using C compiler: ‘gcc (Ubuntu 13.3.0-6ubuntu2~24.04) 13.3.0’
-...
-106 | [::std::mem::offset_of!(R_CallMethodDef, numArgs) - 16usize];
- | ^^^^^^^^^^^^^^^^^^^^^
- |
- = note: see issue #106655 for more information
-
-For more information about this error, try `rustc --explain E0658`.
-error: could not compile `xactonomial` (lib) due to 7 previous errors
-make: *** [Makevars:28: rust/target/release/libxactonomial.a] Error 101
-ERROR: compilation failed for package ‘xactonomial’
-* removing ‘/tmp/workdir/xactonomial/old/xactonomial.Rcheck/xactonomial’
-
-
-```
-# zen4R
-
-
-
-* Version: 0.10.2
-* GitHub: https://github.com/eblondel/zen4R
-* Source code: https://github.com/cran/zen4R
-* Date/Publication: 2025-06-18 00:50:02 UTC
-* Number of recursive dependencies: 71
-
-Run `revdepcheck::cloud_details(, "zen4R")` for more info
-
-
-
-## In both
-
-* checking whether package ‘zen4R’ can be installed ... ERROR
- ```
- Installation failed.
- See ‘/tmp/workdir/zen4R/new/zen4R.Rcheck/00install.out’ for details.
- ```
-
-## Installation
-
-### Devel
-
-```
-* installing *source* package ‘zen4R’ ...
-** package ‘zen4R’ successfully unpacked and MD5 sums checked
-** using staged installation
-** R
-** inst
-** byte-compile and prepare package for lazy loading
-Error in dyn.load(file, DLLpath = DLLpath, ...) :
- unable to load shared object '/usr/local/lib/R/site-library/redland/libs/redland.so':
- librdf.so.0: cannot open shared object file: No such file or directory
-Calls: ... asNamespace -> loadNamespace -> library.dynam -> dyn.load
-Execution halted
-ERROR: lazy loading failed for package ‘zen4R’
-* removing ‘/tmp/workdir/zen4R/new/zen4R.Rcheck/zen4R’
-
-
-```
-### CRAN
-
-```
-* installing *source* package ‘zen4R’ ...
-** package ‘zen4R’ successfully unpacked and MD5 sums checked
-** using staged installation
-** R
-** inst
-** byte-compile and prepare package for lazy loading
-Error in dyn.load(file, DLLpath = DLLpath, ...) :
- unable to load shared object '/usr/local/lib/R/site-library/redland/libs/redland.so':
- librdf.so.0: cannot open shared object file: No such file or directory
-Calls: ... asNamespace -> loadNamespace -> library.dynam -> dyn.load
-Execution halted
-ERROR: lazy loading failed for package ‘zen4R’
-* removing ‘/tmp/workdir/zen4R/old/zen4R.Rcheck/zen4R’
-
-
-```
+*Wow, no problems at all. :)*
\ No newline at end of file
diff --git a/revdep/problems.md b/revdep/problems.md
index 826564899..0240a8c05 100644
--- a/revdep/problems.md
+++ b/revdep/problems.md
@@ -1,2579 +1,5621 @@
-# aws.comprehend
+# adjclust (0.6.10)
-
+* GitHub:
+* Email:
+* GitHub mirror:
-* Version: 0.2.1
-* GitHub: https://github.com/cloudyr/aws.comprehend
-* Source code: https://github.com/cran/aws.comprehend
-* Date/Publication: 2020-03-18 14:30:06 UTC
-* Number of recursive dependencies: 32
+Run `revdepcheck::cloud_details(, "adjclust")` for more info
+
+## Newly broken
+
+* checking tests ... ERROR
+ ```
+ ...
+ > library("testthat")
+ > library("adjclust")
+ >
+ > test_check("adjclust")
+ object has no names - using numeric order for row/column names
+ [ FAIL 1 | WARN 0 | SKIP 3 | PASS 171 ]
+
+ ══ Skipped tests (3) ═══════════════════════════════════════════════════════════
+ • No NA value: nothing to test here! (3): 'test_snpClust_NA-in-LD.R:22:3',
+ 'test_snpClust_NA-in-LD.R:57:3', 'test_snpClust_NA-in-LD.R:78:3'
+
+ ══ Failed tests ════════════════════════════════════════════════════════════════
+ ── Error ('test_modify.R:19:3'): Results of the algorithm are shifted by lambda when similarity is unnormalized and heights are positive ──
+ Error in `expect_message(fit4 <- adjClust(sim2), fit3$correction)`: `regexp` must be a single string, `NA`, or `NULL`, not the number 1.8.
+ Backtrace:
+ ▆
+ 1. └─testthat::expect_message(regexp = fit3$correction) at test_modify.R:19:3
+ 2. └─testthat:::check_string(regexp, allow_null = TRUE, allow_na = TRUE)
+ 3. └─testthat:::stop_input_type(...)
+ 4. └─rlang::abort(message, ..., call = call, arg = arg)
+
+ [ FAIL 1 | WARN 0 | SKIP 3 | PASS 171 ]
+ Error:
+ ! Test failures.
+ Execution halted
+ ```
+
+## In both
+
+* checking installed package size ... NOTE
+ ```
+ installed size is 5.2Mb
+ sub-directories of 1Mb or more:
+ doc 2.1Mb
+ libs 2.6Mb
+ ```
+
+# APackOfTheClones (1.3.0)
+
+* GitHub:
+* Email:
+* GitHub mirror:
+
+Run `revdepcheck::cloud_details(, "APackOfTheClones")` for more info
+
+## Newly broken
+
+* checking tests ... ERROR
+ ```
+ ...
+
+ ── Failure ('test-get_clone_sizes.R:48:2'): countCloneSizes works ──────────────
+ Expected `test_obj[5:12]` to be equal to `expected_obj[5:12]`.
+ Differences:
+ dimnames(actual)[[1]] vs dimnames(expected)[[1]]
+ "TRAV10.TRAJ48.TRAC;TGTGTGGTGAGCGACTTTGGAAATGAGAAATTAACCTTT_TRBV27.None.TRBJ2-1.TRBC2;TGTGCCAGCAGTTTAGGGTCGGGGGGGACGGGGAATGAGCAGTTCTTC"
+ "TRAV12-2.TRAJ12.TRAC;TGTGCCCGGAAGGTTAGGGATAGCAGCTATAAATTGATCTTC_TRBV6-4.None.TRBJ2-1.TRBC2;TGTGCCAGCAGTGACTCCGGATACAATGAGCAGTTCTTC"
+ - "TRAV12-2.TRAJ6.TRAC;TGTGCCGAGAGGGGTTCGGGAGGAAGCTACATACCTACATTT_TRBV7-9.None.TRBJ2-3.TRBC2;TGTGCCAGCAGCGACCCGAGTGGACGACAGGGTCCGAGGTGGGATACGCAGTATTTT"
+ + "TRAV16.TRAJ30.TRAC;TGTGCTCTAAGTGGTAGCAGAGATGACAAGATCATCTTT_NA;NA"
+ - "TRAV16.TRAJ30.TRAC;TGTGCTCTAAGTGGTAGCAGAGATGACAAGATCATCTTT_NA;NA"
+ + "TRAV8-3.TRAJ42.TRAC;TGTGCTGTGGGTGAGAAGGGTTATGGAGGAAGCCAAGGAAATCTCATCTTT_TRBV12-4.None.TRBJ1-6.TRBC1;TRBV7-6.None.TRBJ1-4.TRBC1;TGTGCCAGCAGTTTCCGACCGCCGGGTTCACCCCTCCACTTT;TGTGCCAGCCACGGCGCCAGGGGTGATGGCTTTTGTGAAAAACTGTTTTTT"
+ - "TRAV24.TRAJ22.TRAC;TGTGCCTCCCTTTCTGGTTCTGCAAGGCAACTGACCTTT_TRBV27.None.TRBJ2-1.TRBC2;TGTGCCAGCAGCCCCACAGTAGCGGGGGAGCAGTTCTTC"
+ + "TRAV8-6.TRAJ34.TRAC;TGTGCTGTGACCTTCCATTATAACACCGACAAGCTCATCTTT_TRBV4-1.None.TRBJ2-7.TRBC2;TGCGCCAGCAGCCAAGACCGGACGGGACTAGACTACGAGCAGTACTTC"
+ - "TRAV27.TRAJ58.TRAC;TGTGCAGGAGCTGCGGAAACCAGTGGCTCTAGGTTGACCTTT_TRBV12-4.None.TRBJ2-7.TRBC2;TGTGCCAGCAGCCGGTTGAGGACAGGGGCCCTATACGAGCAGTACTTC"
+ + "TRAV24.TRAJ22.TRAC;TGTGCCTCCCTTTCTGGTTCTGCAAGGCAACTGACCTTT_TRBV27.None.TRBJ2-1.TRBC2;TGTGCCAGCAGCCCCACAGTAGCGGGGGAGCAGTTCTTC"
+ - "TRAV8-3.TRAJ42.TRAC;TGTGCTGTGGGTGAGAAGGGTTATGGAGGAAGCCAAGGAAATCTCATCTTT_TRBV12-4.None.TRBJ1-6.TRBC1;TRBV7-6.None.TRBJ1-4.TRBC1;TGTGCCAGCAGTTTCCGACCGCCGGGTTCACCCCTCCACTTT;TGTGCCAGCCACGGCGCCAGGGGTGATGGCTTTTGTGAAAAACTGTTTTTT"
+ + "TRAV27.TRAJ58.TRAC;TGTGCAGGAGCTGCGGAAACCAGTGGCTCTAGGTTGACCTTT_TRBV12-4.None.TRBJ2-7.TRBC2;TGTGCCAGCAGCCGGTTGAGGACAGGGGCCCTATACGAGCAGTACTTC"
+ - "TRAV8-6.TRAJ34.TRAC;TGTGCTGTGACCTTCCATTATAACACCGACAAGCTCATCTTT_TRBV4-1.None.TRBJ2-7.TRBC2;TGCGCCAGCAGCCAAGACCGGACGGGACTAGACTACGAGCAGTACTTC"
+ + "TRAV12-2.TRAJ6.TRAC;TGTGCCGAGAGGGGTTCGGGAGGAAGCTACATACCTACATTT_TRBV7-9.None.TRBJ2-3.TRBC2;TGTGCCAGCAGCGACCCGAGTGGACGACAGGGTCCGAGGTGGGATACGCAGTATTTT"
+
+
+ [ FAIL 3 | WARN 0 | SKIP 15 | PASS 242 ]
+ Error:
+ ! Test failures.
+ Execution halted
+ ```
+
+## In both
+
+* checking installed package size ... NOTE
+ ```
+ installed size is 7.5Mb
+ sub-directories of 1Mb or more:
+ help 1.1Mb
+ libs 5.2Mb
+ ```
+
+# autodb (3.0.0)
+
+* GitHub:
+* Email:
+* GitHub mirror:
+
+Run `revdepcheck::cloud_details(, "autodb")` for more info
+
+## Newly broken
+
+* checking tests ... ERROR
+ ```
+ ...
+ 9. └─hedgehog:::as.expectation.error(e)
+ 10. └─testthat::expectation("error", msg, srcref)
+ 11. └─testthat::new_expectation(...)
+ 12. └─base::structure(...)
+ ── Error ('test-synthesise.r:101:5'): synthesise / is invariant to dependency reordering ──
+ Error in `attributes(.Data) <- c(attributes(.Data), attrib)`: all attributes must have names [3 does not]
+ Backtrace:
+ ▆
+ 1. └─hedgehog::forall(gen_permutation, normalisation_permutation_invariant) at test-synthesise.r:101:5
+ 2. └─hedgehog:::run.prop(property, tree$root, curry)
+ 3. └─base::tryCatch(...)
+ 4. └─base (local) tryCatchList(expr, classes, parentenv, handlers)
+ 5. └─base (local) tryCatchOne(expr, names, parentenv, handlers[[1L]])
+ 6. └─value[[3L]](cond)
+ 7. └─hedgehog (local) register_expectation(e)
+ 8. ├─hedgehog:::as.expectation(e)
+ 9. └─hedgehog:::as.expectation.error(e)
+ 10. └─testthat::expectation("error", msg, srcref)
+ 11. └─testthat::new_expectation(...)
+ 12. └─base::structure(...)
+
+ [ FAIL 19 | WARN 0 | SKIP 1 | PASS 694 ]
+ Error:
+ ! Test failures.
+ Execution halted
+ ```
+
+# aws.comprehend (0.2.1)
+
+* GitHub:
+* Email:
+* GitHub mirror:
Run `revdepcheck::cloud_details(, "aws.comprehend")` for more info
-
+## Newly broken
+
+* checking tests ... ERROR
+ ```
+ ...
+ ── Error ('test-detect_syntax.R:6:3'): detect_syntax works on single string ────
+
+ Error: `with_mock()` was deprecated in testthat 3.2.0 and is now defunct.
+ ℹ Please use `with_mocked_bindings()` instead.
+ Backtrace:
+ ▆
+ 1. └─testthat::with_mock(...) at test-detect_syntax.R:6:3
+ 2. └─lifecycle::deprecate_stop("3.2.0", "with_mock()", "with_mocked_bindings()")
+ 3. └─lifecycle:::deprecate_stop0(msg)
+ 4. └─rlang::cnd_signal(...)
+ ── Error ('test-detect_syntax.R:27:3'): detect_syntax works on character vector ──
+
+ Error: `with_mock()` was deprecated in testthat 3.2.0 and is now defunct.
+ ℹ Please use `with_mocked_bindings()` instead.
+ Backtrace:
+ ▆
+ 1. └─testthat::with_mock(...) at test-detect_syntax.R:27:3
+ 2. └─lifecycle::deprecate_stop("3.2.0", "with_mock()", "with_mocked_bindings()")
+ 3. └─lifecycle:::deprecate_stop0(msg)
+ 4. └─rlang::cnd_signal(...)
+
+ [ FAIL 13 | WARN 0 | SKIP 0 | PASS 10 ]
+ Error:
+ ! Test failures.
+ Execution halted
+ ```
+
+# bgmfiles (0.0.6)
+
+* GitHub:
+* Email:
+* GitHub mirror:
+
+Run `revdepcheck::cloud_details(, "bgmfiles")` for more info
## Newly broken
* checking tests ... ERROR
- ```
- Running ‘testthat.R’
- Running the tests in ‘tests/testthat.R’ failed.
- Complete output:
- > library(testthat)
- > library(aws.comprehend)
- >
- > test_check("aws.comprehend")
- [ FAIL 13 | WARN 0 | SKIP 0 | PASS 10 ]
-
- ══ Failed tests ════════════════════════════════════════════════════════════════
- ...
- Backtrace:
- ▆
- 1. └─testthat::with_mock(...) at test-detect_syntax.R:27:3
- 2. └─lifecycle::deprecate_stop("3.2.0", "with_mock()", "with_mocked_bindings()")
- 3. └─lifecycle:::deprecate_stop0(msg)
- 4. └─rlang::cnd_signal(...)
-
- [ FAIL 13 | WARN 0 | SKIP 0 | PASS 10 ]
- Error: Test failures
- Execution halted
- ```
-
-# bcRP
-
-
-
-* Version: 1.0.1
-* GitHub: https://github.com/JulioCollazos64/bcRP
-* Source code: https://github.com/cran/bcRP
-* Date/Publication: 2025-07-22 12:10:12 UTC
-* Number of recursive dependencies: 47
-
-Run `revdepcheck::cloud_details(, "bcRP")` for more info
-
-
-
-## Newly broken
-
-* checking examples ... ERROR
- ```
- Running examples in ‘bcRP-Ex.R’ failed
- The error most likely occurred in:
-
- > ### Name: get_bcrp_data
- > ### Title: Perform an API request to BCRPData
- > ### Aliases: get_bcrp_data
- >
- > ### ** Examples
- >
- > codes <- c("PN00009MM", "PN00002MM", "PN01270PM", "PD39557DA")
- ...
- 10 Mar.2024 -6059.647797 Cuentas monetarias de las sociedades creado… PN00…
- # ℹ 82 more rows
- >
- > # You can also provide the range of dates
- > # through the `from` and `to` arguments.
- > get_bcrp_data(codes = codes, from = "2015-01", to = "2020-01")
- Error in perform_req_strategy(requests = list_of_requests, strategy = request_strategy) :
- Error(s) at: PN00002MM
- Calls: get_bcrp_data -> perform_req_strategy
- Execution halted
- ```
-
-# bindr
-
-
-
-* Version: 0.1.2
-* GitHub: https://github.com/krlmlr/bindr
-* Source code: https://github.com/cran/bindr
-* Date/Publication: 2024-11-21 21:30:14 UTC
-* Number of recursive dependencies: 24
+ ```
+ Running ‘testthat.R’
+ Running the tests in ‘tests/testthat.R’ failed.
+ Complete output:
+ > library(testthat)
+ > library(bgmfiles)
+ >
+ > test_check("bgmfiles")
+ [ FAIL 1 | WARN 0 | SKIP 0 | PASS 2 ]
+
+ ══ Failed tests ════════════════════════════════════════════════════════════════
+ ── Error ('test-files.R:7:3'): files are present ───────────────────────────────
+ Error: 'is_true' is not an exported object from 'namespace:testthat'
+ Backtrace:
+ ▆
+ 1. └─testthat::expect_that(all(file.exists(bgmfiles())), testthat::is_true()) at test-files.R:7:3
+
+ [ FAIL 1 | WARN 0 | SKIP 0 | PASS 2 ]
+ Error:
+ ! Test failures.
+ Execution halted
+ ```
+
+# bindr (0.1.2)
+
+* GitHub:
+* Email:
+* GitHub mirror:
Run `revdepcheck::cloud_details(, "bindr")` for more info
-
+## Newly broken
+
+* checking tests ... ERROR
+ ```
+ Running ‘testthat.R’
+ Running the tests in ‘tests/testthat.R’ failed.
+ Complete output:
+ > library(testthat)
+ > library(bindr)
+ >
+ > test_check("bindr")
+ [ FAIL 1 | WARN 0 | SKIP 0 | PASS 41 ]
+
+ ══ Failed tests ════════════════════════════════════════════════════════════════
+ ── Error ('test-error.R:9:3'): non-native encoding causes warning ──────────────
+
+ Error: `with_mock()` was deprecated in testthat 3.2.0 and is now defunct.
+ ℹ Please use `with_mocked_bindings()` instead.
+ Backtrace:
+ ▆
+ 1. └─testthat::with_mock(...) at test-error.R:9:3
+ 2. └─lifecycle::deprecate_stop("3.2.0", "with_mock()", "with_mocked_bindings()")
+ 3. └─lifecycle:::deprecate_stop0(msg)
+ 4. └─rlang::cnd_signal(...)
+
+ [ FAIL 1 | WARN 0 | SKIP 0 | PASS 41 ]
+ Error:
+ ! Test failures.
+ Execution halted
+ ```
+
+# caretEnsemble (4.0.1)
+
+* GitHub:
+* Email:
+* GitHub mirror:
+
+Run `revdepcheck::cloud_details(, "caretEnsemble")` for more info
## Newly broken
* checking tests ... ERROR
- ```
- Running ‘testthat.R’
- Running the tests in ‘tests/testthat.R’ failed.
- Complete output:
- > library(testthat)
- > library(bindr)
- >
- > test_check("bindr")
- [ FAIL 1 | WARN 0 | SKIP 0 | PASS 41 ]
-
- ══ Failed tests ════════════════════════════════════════════════════════════════
- ...
- Backtrace:
- ▆
- 1. └─testthat::with_mock(...) at test-error.R:9:3
- 2. └─lifecycle::deprecate_stop("3.2.0", "with_mock()", "with_mocked_bindings()")
- 3. └─lifecycle:::deprecate_stop0(msg)
- 4. └─rlang::cnd_signal(...)
-
- [ FAIL 1 | WARN 0 | SKIP 0 | PASS 41 ]
- Error: Test failures
- Execution halted
- ```
-
-# conflr
-
-
-
-* Version: 0.1.1
-* GitHub: https://github.com/line/conflr
-* Source code: https://github.com/cran/conflr
-* Date/Publication: 2020-04-08 12:50:02 UTC
-* Number of recursive dependencies: 61
+ ```
+ Running ‘testthat.R’
+ Running the tests in ‘tests/testthat.R’ failed.
+ Complete output:
+ > testthat::test_check("caretEnsemble")
+ Loading required package: caretEnsemble
+ [ FAIL 1 | WARN 0 | SKIP 0 | PASS 614 ]
+
+ ══ Failed tests ════════════════════════════════════════════════════════════════
+ ── Error ('test-caretList.R:315:3'): caretList supports models that return an array or matrix ──
+ Error in `UseMethod("predict")`: no applicable method for 'predict' applied to an object of class "character"
+ Backtrace:
+ ▆
+ 1. └─stats::predict(models, head(X, 10L)) at test-caretList.R:315:3
+
+ [ FAIL 1 | WARN 0 | SKIP 0 | PASS 614 ]
+ Error:
+ ! Test failures.
+ Execution halted
+ ```
+
+# clinDataReview (1.6.2)
+
+* GitHub:
+* Email:
+* GitHub mirror:
+
+Run `revdepcheck::cloud_details(, "clinDataReview")` for more info
-Run `revdepcheck::cloud_details(, "conflr")` for more info
+## Newly broken
+
+* checking tests ... ERROR
+ ```
+ ...
+ `names(expected)`: "TRT" "TERM" "CAT" "ASTDY" "AENDY" "ASTFLG" "AENFLG"
+
+ actual | expected
+ [1] "CAT" - "treatment" [1]
+ [2] "term of interest" | "term of interest" [2]
+ [3] "ASTDY" - "CAT" [3]
+ [4] "AENDY" - "ASTDY" [4]
+ [5] "treatment" - "AENDY" [5]
+ [6] "ASTFLG" | "ASTFLG" [6]
+ [7] "AENFLG" | "AENFLG" [7]
+
+ ── Failure ('test_utility-dimensions.R:9:2'): Plot width and height, if specified, are respected ──
+ Expected `res` to be equal to `c(height = 100, width = 300)`.
+ Differences:
+ `names(actual)`: "width" "height"
+ `names(expected)`: "height" "width"
+
+ `actual`: 300.0 100.0
+ `expected`: 100.0 300.0
+
+
+ [ FAIL 16 | WARN 0 | SKIP 31 | PASS 501 ]
+ Error:
+ ! Test failures.
+ Execution halted
+ ```
-
+## In both
+
+* checking installed package size ... NOTE
+ ```
+ installed size is 5.7Mb
+ sub-directories of 1Mb or more:
+ doc 4.3Mb
+ ```
+
+# cnd (0.1.0)
+
+* GitHub:
+* Email:
+* GitHub mirror:
+
+Run `revdepcheck::cloud_details(, "cnd")` for more info
## Newly broken
* checking tests ... ERROR
- ```
- Running ‘testthat.R’
- Running the tests in ‘tests/testthat.R’ failed.
- Complete output:
- > # Copyright (C) 2019 LINE Corporation
- > #
- > # conflr is free software; you can redistribute it and/or modify it under the
- > # terms of the GNU General Public License as published by the Free Software
- > # Foundation, version 3.
- > #
- > # conflr is distributed in the hope that it will be useful, but WITHOUT ANY
- ...
- Backtrace:
- ▆
- 1. └─testthat::with_mock(...) at test-utils.R:93:3
- 2. └─lifecycle::deprecate_stop("3.2.0", "with_mock()", "with_mocked_bindings()")
- 3. └─lifecycle:::deprecate_stop0(msg)
- 4. └─rlang::cnd_signal(...)
-
- [ FAIL 14 | WARN 0 | SKIP 4 | PASS 92 ]
- Error: Test failures
- Execution halted
- ```
+ ```
+ ...
+ > # Learn more about the roles of various files in:
+ > # * https://r-pkgs.org/testing-design.html#sec-tests-files-overview
+ > # * https://testthat.r-lib.org/articles/special-files.html
+ >
+ > library(testthat)
+ > library(cnd)
+ >
+ > test_check("cnd")
+ [ FAIL 1 | WARN 0 | SKIP 11 | PASS 81 ]
+
+ ══ Skipped tests (11) ══════════════════════════════════════════════════════════
+ • On CRAN (11): 'test-condition.R:109:1', 'test-condition.R:179:1',
+ 'test-document.R:33:3', 'test-document.R:37:1', 'test-handlers.R:1:1',
+ 'test-handlers.R:11:1', 'test-print.R:1:1', 'test-print.R:24:1',
+ 'test-register.R:40:1', 'test-register.R:44:1', 'test-utils.R:28:1'
+
+ ══ Failed tests ════════════════════════════════════════════════════════════════
+ ── Failure ('test-condition.R:226:3'): cnd(condition) handling ─────────────────
+ Expected zero successes.
+ Actually succeeded 1 times
+
+ [ FAIL 1 | WARN 0 | SKIP 11 | PASS 81 ]
+ Error:
+ ! Test failures.
+ Execution halted
+ ```
+
+# coenocliner (0.2-3)
+
+* GitHub:
+* Email:
+* GitHub mirror:
+
+Run `revdepcheck::cloud_details(, "coenocliner")` for more info
+
+## Newly broken
+
+* checking tests ... ERROR
+ ```
+ ...
+ > ## Setup
+ > library("testthat")
+ >
+ > ## Runs the tests in inst/tests
+ > test_check("coenocliner")
+ Loading required package: coenocliner
+ This is coenocliner 0.2-3
+ [ FAIL 2 | WARN 0 | SKIP 0 | PASS 85 ]
+
+ ══ Failed tests ════════════════════════════════════════════════════════════════
+ ── Error ('test-coenocline.R:25:5'): coenocline() returns an integer matrix ────
+ Error in `is_true()`: could not find function "is_true"
+ Backtrace:
+ ▆
+ 1. └─testthat::expect_that(typeof(sim) == "integer", is_true()) at test-coenocline.R:25:5
+ ── Error ('test-coenocline.R:55:5'): coenocline() returns an integer matrix with x and y gradients ──
+ Error in `is_true()`: could not find function "is_true"
+ Backtrace:
+ ▆
+ 1. └─testthat::expect_that(typeof(sim) == "integer", is_true()) at test-coenocline.R:55:5
+
+ [ FAIL 2 | WARN 0 | SKIP 0 | PASS 85 ]
+ Error:
+ ! Test failures.
+ Execution halted
+ ```
+
+# conflr (0.1.1)
+
+* GitHub:
+* Email:
+* GitHub mirror:
+
+Run `revdepcheck::cloud_details(, "conflr")` for more info
+
+## Newly broken
+
+* checking tests ... ERROR
+ ```
+ ...
+ ── Error ('test-utils.R:77:3'): try_get_existing_page_id() works ───────────────
+
+ Error: `with_mock()` was deprecated in testthat 3.2.0 and is now defunct.
+ ℹ Please use `with_mocked_bindings()` instead.
+ Backtrace:
+ ▆
+ 1. └─testthat::with_mock(...) at test-utils.R:77:3
+ 2. └─lifecycle::deprecate_stop("3.2.0", "with_mock()", "with_mocked_bindings()")
+ 3. └─lifecycle:::deprecate_stop0(msg)
+ 4. └─rlang::cnd_signal(...)
+ ── Error ('test-utils.R:93:3'): try_get_personal_space_key() handles personal spaces ──
+
+ Error: `with_mock()` was deprecated in testthat 3.2.0 and is now defunct.
+ ℹ Please use `with_mocked_bindings()` instead.
+ Backtrace:
+ ▆
+ 1. └─testthat::with_mock(...) at test-utils.R:93:3
+ 2. └─lifecycle::deprecate_stop("3.2.0", "with_mock()", "with_mocked_bindings()")
+ 3. └─lifecycle:::deprecate_stop0(msg)
+ 4. └─rlang::cnd_signal(...)
+
+ [ FAIL 14 | WARN 0 | SKIP 4 | PASS 92 ]
+ Error:
+ ! Test failures.
+ Execution halted
+ ```
## In both
* checking dependencies in R code ... NOTE
- ```
- Namespace in Imports field not imported from: ‘R6’
- All declared Imports should be used.
- ```
+ ```
+ Namespace in Imports field not imported from: ‘R6’
+ All declared Imports should be used.
+ ```
* checking LazyData ... NOTE
- ```
- 'LazyData' is specified without a 'data' directory
- ```
+ ```
+ 'LazyData' is specified without a 'data' directory
+ ```
-# countdown
+# countdown (0.4.0)
-
-
-* Version: 0.4.0
-* GitHub: https://github.com/gadenbuie/countdown
-* Source code: https://github.com/cran/countdown
-* Date/Publication: 2022-08-16 09:00:08 UTC
-* Number of recursive dependencies: 52
+* GitHub:
+* Email:
+* GitHub mirror:
Run `revdepcheck::cloud_details(, "countdown")` for more info
-
-
## Newly broken
* checking tests ... ERROR
- ```
- Running ‘testthat.R’
- Running the tests in ‘tests/testthat.R’ failed.
- Complete output:
- > library(testthat)
- > library(countdown)
- >
- > test_check("countdown")
- [ FAIL 1 | WARN 0 | SKIP 1 | PASS 43 ]
-
- ══ Skipped tests (1) ═══════════════════════════════════════════════════════════
- ...
- Backtrace:
- ▆
- 1. └─testthat::with_mock(requireNamespace = function(...) FALSE, expect_error(countdown_app())) at test-shiny.R:7:5
- 2. └─lifecycle::deprecate_stop("3.2.0", "with_mock()", "with_mocked_bindings()")
- 3. └─lifecycle:::deprecate_stop0(msg)
- 4. └─rlang::cnd_signal(...)
-
- [ FAIL 1 | WARN 0 | SKIP 1 | PASS 43 ]
- Error: Test failures
- Execution halted
- ```
+ ```
+ ...
+ > library(testthat)
+ > library(countdown)
+ >
+ > test_check("countdown")
+ [ FAIL 1 | WARN 0 | SKIP 1 | PASS 43 ]
+
+ ══ Skipped tests (1) ═══════════════════════════════════════════════════════════
+ • On CRAN (1): 'test-countdown.R:15:1'
+
+ ══ Failed tests ════════════════════════════════════════════════════════════════
+ ── Error ('test-shiny.R:7:5'): countdown_app() / errors if shiny not available ──
+
+ Error: `with_mock()` was deprecated in testthat 3.2.0 and is now defunct.
+ i Please use `with_mocked_bindings()` instead.
+ Backtrace:
+ ▆
+ 1. └─testthat::with_mock(requireNamespace = function(...) FALSE, expect_error(countdown_app())) at test-shiny.R:7:5
+ 2. └─lifecycle::deprecate_stop("3.2.0", "with_mock()", "with_mocked_bindings()")
+ 3. └─lifecycle:::deprecate_stop0(msg)
+ 4. └─rlang::cnd_signal(...)
+
+ [ FAIL 1 | WARN 0 | SKIP 1 | PASS 43 ]
+ Error:
+ ! Test failures.
+ Execution halted
+ ```
## In both
* checking Rd cross-references ... NOTE
- ```
- Packages unavailable to check Rd xrefs: ‘xaringan’, ‘beepr’
- ```
+ ```
+ Packages unavailable to check Rd xrefs: ‘xaringan’, ‘beepr’
+ ```
-# covr
+# covdepGE (1.0.1)
-
+* GitHub:
+* Email:
+* GitHub mirror:
-* Version: 3.6.4
-* GitHub: https://github.com/r-lib/covr
-* Source code: https://github.com/cran/covr
-* Date/Publication: 2023-11-09 08:10:06 UTC
-* Number of recursive dependencies: 58
+Run `revdepcheck::cloud_details(, "covdepGE")` for more info
-Run `revdepcheck::cloud_details(, "covr")` for more info
+## Newly broken
+
+* checking tests ... ERROR
+ ```
+ ...
+ Expected one failure.
+ Actually failed 0 times
+ ── Failure ('test-covdepGE.R:461:3'): Font size ────────────────────────────────
+ Expected one failure.
+ Actually failed 0 times
+ ── Failure ('test-covdepGE.R:467:3'): Font color 1 ─────────────────────────────
+ Expected one failure.
+ Actually failed 0 times
+ ── Failure ('test-covdepGE.R:473:3'): Font color 2 ─────────────────────────────
+ Expected one failure.
+ Actually failed 0 times
+ ── Failure ('test-covdepGE.R:479:3'): Font threshold ───────────────────────────
+ Expected one failure.
+ Actually failed 0 times
+ ── Failure ('test-covdepGE.R:506:3'): Different graph_colors ───────────────────
+ Expected one failure.
+ Actually failed 0 times
+ ── Failure ('test-covdepGE.R:511:3'): No title summary ─────────────────────────
+ Expected one failure.
+ Actually failed 0 times
+
+ [ FAIL 25 | WARN 16 | SKIP 31 | PASS 57 ]
+ Error:
+ ! Test failures.
+ Execution halted
+ ```
+
+## In both
-
+* checking C++ specification ... NOTE
+ ```
+ Specified C++11: please drop specification unless essential
+ ```
+
+# covr (3.6.4)
+
+* GitHub:
+* Email:
+* GitHub mirror:
+
+Run `revdepcheck::cloud_details(, "covr")` for more info
## Newly broken
* checking tests ... ERROR
- ```
- Running ‘testthat.R’
- Running the tests in ‘tests/testthat.R’ failed.
- Complete output:
- > ops <- options("crayon.enabled" = FALSE, warn = 1)
- > library(testthat)
- > library("covr")
- >
- > # Skip tests on Solaris as gcc is not in the PATH and I do not have an easy way
- > # to mimic the CRAN build environment
- > if (!tolower(Sys.info()[["sysname"]]) == "sunos") {
- ...
- Backtrace:
- ▆
- 1. └─testthat::with_mock(...) at test-utils.R:27:3
- 2. └─lifecycle::deprecate_stop("3.2.0", "with_mock()", "with_mocked_bindings()")
- 3. └─lifecycle:::deprecate_stop0(msg)
- 4. └─rlang::cnd_signal(...)
-
- [ FAIL 22 | WARN 0 | SKIP 10 | PASS 185 ]
- Error: Test failures
- Execution halted
- ```
-
-# datarobot
-
-
-
-* Version: 2.18.6
-* GitHub: NA
-* Source code: https://github.com/cran/datarobot
-* Date/Publication: 2024-03-13 20:40:02 UTC
-* Number of recursive dependencies: 94
+ ```
+ ...
+ ── Error ('test-utils.R:20:3'): it works as expected ───────────────────────────
+
+ Error: `with_mock()` was deprecated in testthat 3.2.0 and is now defunct.
+ ℹ Please use `with_mocked_bindings()` instead.
+ Backtrace:
+ ▆
+ 1. └─testthat::with_mock(...) at test-utils.R:20:3
+ 2. └─lifecycle::deprecate_stop("3.2.0", "with_mock()", "with_mocked_bindings()")
+ 3. └─lifecycle:::deprecate_stop0(msg)
+ 4. └─rlang::cnd_signal(...)
+ ── Error ('test-utils.R:27:3'): it works as expected ───────────────────────────
+
+ Error: `with_mock()` was deprecated in testthat 3.2.0 and is now defunct.
+ ℹ Please use `with_mocked_bindings()` instead.
+ Backtrace:
+ ▆
+ 1. └─testthat::with_mock(...) at test-utils.R:27:3
+ 2. └─lifecycle::deprecate_stop("3.2.0", "with_mock()", "with_mocked_bindings()")
+ 3. └─lifecycle:::deprecate_stop0(msg)
+ 4. └─rlang::cnd_signal(...)
+
+ [ FAIL 22 | WARN 0 | SKIP 11 | PASS 185 ]
+ Error:
+ ! Test failures.
+ Execution halted
+ ```
+
+# datarobot (2.18.6)
+
+* Email:
+* GitHub mirror:
Run `revdepcheck::cloud_details(, "datarobot")` for more info
-
+## Newly broken
+
+* checking tests ... ERROR
+ ```
+ ...
+ ── Error ('test-CreateUserPartition.R:87:3'): validationType = 'TVH' option can be used to SetTarget ──
+
+ Error: `with_mock()` was deprecated in testthat 3.2.0 and is now defunct.
+ ℹ Please use `with_mocked_bindings()` instead.
+ Backtrace:
+ ▆
+ 1. └─testthat::with_mock(...) at test-CreateUserPartition.R:87:3
+ 2. └─lifecycle::deprecate_stop("3.2.0", "with_mock()", "with_mocked_bindings()")
+ 3. └─lifecycle:::deprecate_stop0(msg)
+ 4. └─rlang::cnd_signal(...)
+ ── Error ('test-StartAutopilot.R:461:3'): Datetime partition with invalid partition ──
+
+ Error: `with_mock()` was deprecated in testthat 3.2.0 and is now defunct.
+ ℹ Please use `with_mocked_bindings()` instead.
+ Backtrace:
+ ▆
+ 1. └─testthat::with_mock(...) at test-StartAutopilot.R:461:3
+ 2. └─lifecycle::deprecate_stop("3.2.0", "with_mock()", "with_mocked_bindings()")
+ 3. └─lifecycle:::deprecate_stop0(msg)
+ 4. └─rlang::cnd_signal(...)
+
+ [ FAIL 9 | WARN 0 | SKIP 32 | PASS 98 ]
+ Error:
+ ! Test failures.
+ Execution halted
+ ```
+
+# DiceKriging (1.6.0)
+
+* Email:
+* GitHub mirror:
+
+Run `revdepcheck::cloud_details(, "DiceKriging")` for more info
## Newly broken
* checking tests ... ERROR
- ```
- Running ‘testthat.R’
- Running the tests in ‘tests/testthat.R’ failed.
- Complete output:
- > library(testthat)
- > library(datarobot)
- Did not connect to DataRobot on package startup. Use `ConnectToDataRobot`.
- To connect by default on startup, you can put a config file at: /root/.config/datarobot/drconfig.yaml
- >
- > test_check("datarobot")
- [ FAIL 9 | WARN 0 | SKIP 32 | PASS 98 ]
- ...
- Backtrace:
- ▆
- 1. └─testthat::with_mock(...) at test-StartAutopilot.R:461:3
- 2. └─lifecycle::deprecate_stop("3.2.0", "with_mock()", "with_mocked_bindings()")
- 3. └─lifecycle:::deprecate_stop0(msg)
- 4. └─rlang::cnd_signal(...)
-
- [ FAIL 9 | WARN 0 | SKIP 32 | PASS 98 ]
- Error: Test failures
- Execution halted
- ```
-
-# digitize
-
-
-
-* Version: 0.0.4
-* GitHub: https://github.com/tpoisot/digitize
-* Source code: https://github.com/cran/digitize
-* Date/Publication: 2016-08-27 07:52:45
-* Number of recursive dependencies: 29
+ ```
+ ...
+ ── Error ('test-scaling.R:3:1'): Test leaveOneOut ──────────────────────────────
+ Error in `is_true()`: could not find function "is_true"
+ Backtrace:
+ ▆
+ 1. └─testthat::expect_that(...)
+ ── Error ('test-scaling.R:3:1'): Test leaveOneOut ──────────────────────────────
+ Error in `is_true()`: could not find function "is_true"
+ Backtrace:
+ ▆
+ 1. └─testthat::expect_that(...)
+ ── Error ('test-scaling.R:3:1'): Test predict ──────────────────────────────────
+ Error in `is_true()`: could not find function "is_true"
+ Backtrace:
+ ▆
+ 1. └─testthat::expect_that(...)
+ ── Error ('test-scaling.R:3:1'): Test predict ──────────────────────────────────
+ Error in `is_true()`: could not find function "is_true"
+ Backtrace:
+ ▆
+ 1. └─testthat::expect_that(max(abs(p$sd - p.test$sd)) < 1e-06, is_true())
+
+ [ FAIL 12 | WARN 6 | SKIP 12 | PASS 85 ]
+ Error:
+ ! Test failures.
+ Execution halted
+ ```
+
+# dictionar6 (0.1.3)
+
+* GitHub:
+* Email:
+* GitHub mirror:
+
+Run `revdepcheck::cloud_details(, "dictionar6")` for more info
+
+## Newly broken
+
+* checking tests ... ERROR
+ ```
+ ...
+ Complete output:
+ > library(testthat)
+ > test_check("dictionar6")
+ Loading required package: dictionar6
+ [ FAIL 1 | WARN 0 | SKIP 0 | PASS 165 ]
+
+ ══ Failed tests ════════════════════════════════════════════════════════════════
+ ── Failure ('test-Dictionary.R:56:3'): add untyped ─────────────────────────────
+ Expected `x$items` to be equal to `y$items`.
+ Differences:
+ `actual$c` is an integer vector (3)
+ `expected$c` is a double vector (3)
+
+ `actual$d` is an integer vector (4)
+ `expected$d` is a double vector (4)
+
+ Backtrace:
+ ▆
+ 1. └─dictionar6:::expect_equal_dictionary(...) at test-Dictionary.R:56:3
+ 2. └─testthat::expect_mapequal(x$items, y$items) at ./helpers.R:10:3
+
+ [ FAIL 1 | WARN 0 | SKIP 0 | PASS 165 ]
+ Error:
+ ! Test failures.
+ Execution halted
+ ```
+
+# difNLR (1.5.1-4)
+
+* GitHub:
+* Email:
+* GitHub mirror:
+
+Run `revdepcheck::cloud_details(, "difNLR")` for more info
+
+## Newly broken
+
+* checking tests ... ERROR
+ ```
+ ...
+ - attr(environment(actual$m$resid)$rhs, 'gradient')[6, ] -0.17426729 -0.16579794 0.78936340 0.00000000 0.00000000
+ + attr(environment(expected$m$resid)$rhs, 'gradient')[6, ] -0.17426730 -0.16579795 0.78936344 0.00000000 0.00000000
+ - attr(environment(actual$m$resid)$rhs, 'gradient')[7, ] -0.04316780 -0.23243707 0.55164766 -0.04316774 -0.23243707
+ + attr(environment(expected$m$resid)$rhs, 'gradient')[7, ] -0.04316780 -0.23243709 0.55164768 -0.04316789 -0.23243709
+ - attr(environment(actual$m$resid)$rhs, 'gradient')[8, ] -0.10877869 -0.22819247 0.64546291 0.00000000 0.00000000
+ + attr(environment(expected$m$resid)$rhs, 'gradient')[8, ] -0.10877869 -0.22819249 0.64546285 0.00000000 0.00000000
+ - attr(environment(actual$m$resid)$rhs, 'gradient')[9, ] 0.16964468 -0.17684839 0.23046458 0.00000000 0.00000000
+ + attr(environment(expected$m$resid)$rhs, 'gradient')[9, ] 0.16964469 -0.17684838 0.23046462 0.00000000 0.00000000
+ - attr(environment(actual$m$resid)$rhs, 'gradient')[10, ] 0.17703718 -0.17134705 0.23986089 0.17703731 -0.17134705
+ + attr(environment(expected$m$resid)$rhs, 'gradient')[10, ] 0.17703716 -0.17134706 0.23986080 0.17703712 -0.17134706
+ and 1990 more ...
+
+ ── Failure ('test-estimNLR.R:81:3'): estimNLR - examples at help page ──────────
+ Expected `fit_plf` to be equal to `fit_plf_expected`.
+ Differences:
+ `actual$se`: 0.23443593 0.13252404 0.16037916 0.14521814 0.12357220
+ `expected$se`: 0.23443320 0.13252301 0.16037792 0.14521746 0.12357061
+
+
+ [ FAIL 25 | WARN 0 | SKIP 16 | PASS 317 ]
+ Deleting unused snapshots: 'difNLR/plot-fit1-gen.svg',
+ 'difNLR/plot-fit2-gen.svg', and 'difNLR/plot-stat-gen.svg'
+ Error:
+ ! Test failures.
+ Execution halted
+ ```
+
+# digitize (0.0.4)
+
+* GitHub:
+* Email:
+* GitHub mirror:
Run `revdepcheck::cloud_details(, "digitize")` for more info
-
+## Newly broken
+
+* checking tests ... ERROR
+ ```
+ ...
+ ── Error ('test-reverse_compatible.r:32:13'): `digitize` gives same ────────────
+
+ Error: `with_mock()` was deprecated in testthat 3.2.0 and is now defunct.
+ ℹ Please use `with_mocked_bindings()` instead.
+ Backtrace:
+ ▆
+ 1. └─testthat::with_mock(...) at test-reverse_compatible.r:32:13
+ 2. └─lifecycle::deprecate_stop("3.2.0", "with_mock()", "with_mocked_bindings()")
+ 3. └─lifecycle:::deprecate_stop0(msg)
+ 4. └─rlang::cnd_signal(...)
+ ── Error ('test-unit.r:9:13'): Digitize skips point input ──────────────────────
+
+ Error: `with_mock()` was deprecated in testthat 3.2.0 and is now defunct.
+ ℹ Please use `with_mocked_bindings()` instead.
+ Backtrace:
+ ▆
+ 1. └─testthat::with_mock(...) at test-unit.r:9:13
+ 2. └─lifecycle::deprecate_stop("3.2.0", "with_mock()", "with_mocked_bindings()")
+ 3. └─lifecycle:::deprecate_stop0(msg)
+ 4. └─rlang::cnd_signal(...)
+
+ [ FAIL 2 | WARN 0 | SKIP 0 | PASS 1 ]
+ Error:
+ ! Test failures.
+ Execution halted
+ ```
+
+# disprofas (0.2.1)
+
+* GitHub:
+* Email:
+* GitHub mirror:
+
+Run `revdepcheck::cloud_details(, "disprofas")` for more info
## Newly broken
* checking tests ... ERROR
- ```
- Running ‘testthat.R’
- Running the tests in ‘tests/testthat.R’ failed.
- Complete output:
- > library(testthat)
- > library(digitize)
- >
- > test_check("digitize")
- [ FAIL 2 | WARN 0 | SKIP 0 | PASS 1 ]
-
- ══ Failed tests ════════════════════════════════════════════════════════════════
- ...
- Backtrace:
- ▆
- 1. └─testthat::with_mock(...) at test-unit.r:9:13
- 2. └─lifecycle::deprecate_stop("3.2.0", "with_mock()", "with_mocked_bindings()")
- 3. └─lifecycle:::deprecate_stop0(msg)
- 4. └─rlang::cnd_signal(...)
-
- [ FAIL 2 | WARN 0 | SKIP 0 | PASS 1 ]
- Error: Test failures
- Execution halted
- ```
-
-# distro
-
-
-
-* Version: 0.1.0
-* GitHub: NA
-* Source code: https://github.com/cran/distro
-* Date/Publication: 2020-11-09 09:50:02 UTC
-* Number of recursive dependencies: 24
+ ```
+ ...
+
+ ══ Failed tests ════════════════════════════════════════════════════════════════
+ ── Failure ('test-generic_bootstrap_f2.R:10:3'): plot.bootstrap_f2_succeeds ────
+ Expected `expect_output(plot(re), "Shah")` to be an S3 object.
+ Actual OO type: none.
+ ── Failure ('test-generic_bootstrap_f2.R:21:3'): print_and_thus_summary.bootstrap_f2_succeeds ──
+ Expected `expect_output(print(re), "Shah")` to be an S3 object.
+ Actual OO type: none.
+ ── Failure ('test-generic_mimcr.R:22:3'): print_and_thus_summary.mimcr_succeeds ──
+ Expected `expect_output(print(re1), "MIMCR")` to be an S3 object.
+ Actual OO type: none.
+ ── Failure ('test-generic_mimcr.R:43:3'): print_and_thus_summary.mimcr_succeeds ──
+ Expected `expect_output(print(re2), "MIMCR")` to be an S3 object.
+ Actual OO type: none.
+ ── Failure ('test-generic_mimcr.R:53:3'): print_and_thus_summary.mimcr_succeeds ──
+ Expected `expect_output(print(re3), "MIMCR")` to be an S3 object.
+ Actual OO type: none.
+ ── Failure ('test-generic_mztia.R:43:3'): print_and_thus_summary.mztia_succeeds ──
+ Expected `expect_output(print(re), "Martinez & Zhao")` to be an S3 object.
+ Actual OO type: none.
+
+ [ FAIL 6 | WARN 0 | SKIP 0 | PASS 694 ]
+ Error:
+ ! Test failures.
+ Execution halted
+ ```
+
+# distances (0.1.12)
+
+* GitHub:
+* Email:
+* GitHub mirror:
+
+Run `revdepcheck::cloud_details(, "distances")` for more info
+
+## Newly broken
+
+* checking tests ... ERROR
+ ```
+ ...
+ 1. └─testthat::expect_error(class = c("error", "condition")) at test_input_check.R:249:3
+ 2. └─testthat:::check_string(class, allow_null = TRUE)
+ 3. └─testthat:::stop_input_type(...)
+ 4. └─rlang::abort(message, ..., call = call, arg = arg)
+ ── Error ('test_input_check.R:273:3'): `coerce_integer` checks input. ──────────
+ Error in `expect_error(t_coerce_integer(t_x = letters[1:10]), class = c("error", "condition"), regexp = "`t_x` must be integer or NULL.")`: `class` must be a single string or `NULL`, not a character vector.
+ Backtrace:
+ ▆
+ 1. └─testthat::expect_error(class = c("error", "condition")) at test_input_check.R:273:3
+ 2. └─testthat:::check_string(class, allow_null = TRUE)
+ 3. └─testthat:::stop_input_type(...)
+ 4. └─rlang::abort(message, ..., call = call, arg = arg)
+ ── Error ('test_input_check.R:300:3'): `coerce_norm_matrix` checks input. ──────
+ Error in `expect_error(t_coerce_norm_matrix(t_mat = dist(1:4)), class = c("error", "condition"), regexp = "`t_mat` must be matrix, data.frame or vector.")`: `class` must be a single string or `NULL`, not a character vector.
+ Backtrace:
+ ▆
+ 1. └─testthat::expect_error(class = c("error", "condition")) at test_input_check.R:300:3
+ 2. └─testthat:::check_string(class, allow_null = TRUE)
+ 3. └─testthat:::stop_input_type(...)
+ 4. └─rlang::abort(message, ..., call = call, arg = arg)
+
+ [ FAIL 8 | WARN 0 | SKIP 0 | PASS 419 ]
+ Error:
+ ! Test failures.
+ Execution halted
+ ```
+
+# distro (0.1.0)
+
+* Email:
+* GitHub mirror:
Run `revdepcheck::cloud_details(, "distro")` for more info
-
-
-## Newly broken
-
-* checking tests ... ERROR
- ```
- Running ‘testthat.R’
- Running the tests in ‘tests/testthat.R’ failed.
- Complete output:
- > library(testthat)
- > library(distro)
- >
- > test_check("distro")
- [ FAIL 3 | WARN 0 | SKIP 0 | PASS 1 ]
-
- ══ Failed tests ════════════════════════════════════════════════════════════════
- ...
- 3. │ └─rlang::eval_bare(expr, quo_get_env(quo))
- 4. └─distro (local) with_mock_system_release(...)
- 5. └─testthat::with_mock(...) at test-system-release.R:2:3
- 6. └─lifecycle::deprecate_stop("3.2.0", "with_mock()", "with_mocked_bindings()")
- 7. └─lifecycle:::deprecate_stop0(msg)
- 8. └─rlang::cnd_signal(...)
-
- [ FAIL 3 | WARN 0 | SKIP 0 | PASS 1 ]
- Error: Test failures
- Execution halted
- ```
+## Newly broken
+
+* checking tests ... ERROR
+ ```
+ ...
+ 3. │ └─rlang::eval_bare(expr, quo_get_env(quo))
+ 4. └─distro (local) with_mock_os_release("debian-bullseye", distro())
+ 5. └─testthat::with_mock(...) at test-os-release.R:2:3
+ 6. └─lifecycle::deprecate_stop("3.2.0", "with_mock()", "with_mocked_bindings()")
+ 7. └─lifecycle:::deprecate_stop0(msg)
+ 8. └─rlang::cnd_signal(...)
+ ── Error ('test-system-release.R:11:3'): system_release ────────────────────────
+
+ Error: `with_mock()` was deprecated in testthat 3.2.0 and is now defunct.
+ ℹ Please use `with_mocked_bindings()` instead.
+ Backtrace:
+ ▆
+ 1. ├─testthat::expect_equal(...) at test-system-release.R:11:3
+ 2. │ └─testthat::quasi_label(enquo(object), label)
+ 3. │ └─rlang::eval_bare(expr, quo_get_env(quo))
+ 4. └─distro (local) with_mock_system_release(...)
+ 5. └─testthat::with_mock(...) at test-system-release.R:2:3
+ 6. └─lifecycle::deprecate_stop("3.2.0", "with_mock()", "with_mocked_bindings()")
+ 7. └─lifecycle:::deprecate_stop0(msg)
+ 8. └─rlang::cnd_signal(...)
+
+ [ FAIL 3 | WARN 0 | SKIP 0 | PASS 1 ]
+ Error:
+ ! Test failures.
+ Execution halted
+ ```
## In both
* checking LazyData ... NOTE
- ```
- 'LazyData' is specified without a 'data' directory
- ```
+ ```
+ 'LazyData' is specified without a 'data' directory
+ ```
-# esci
+# EDISON (1.1.1)
-
+* Email:
+* GitHub mirror:
-* Version: 1.0.7
-* GitHub: https://github.com/rcalinjageman/esci
-* Source code: https://github.com/cran/esci
-* Date/Publication: 2025-02-22 03:20:02 UTC
-* Number of recursive dependencies: 90
+Run `revdepcheck::cloud_details(, "EDISON")` for more info
-Run `revdepcheck::cloud_details(, "esci")` for more info
+## Newly broken
-
+* checking tests ... ERROR
+ ```
+ ...
+ 5 % 10 % 15 % 20 % 25 % 30 % 35 % 40 % 45 % 50 % 55 % 60 % 65 % 70 % 75 % 80 % 85 % 90 % 95 % 100 % [1] ""
+ [1] "End of iterations"
+ [ FAIL 3 | WARN 0 | SKIP 0 | PASS 17 ]
+
+ ══ Failed tests ════════════════════════════════════════════════════════════════
+ ── Error ('test-structure-moves.r:328:1'): network info the same before and after ──
+ Error in `is_true()`: could not find function "is_true"
+ Backtrace:
+ ▆
+ 1. └─testthat::expect_that(updateCorrectly(), is_true())
+ ── Error ('test-structure-moves.r:332:1'): rejected moves make no change ───────
+ Error in `is_true()`: could not find function "is_true"
+ Backtrace:
+ ▆
+ 1. └─testthat::expect_that(noChangeOnReject(), is_true())
+ ── Error ('test-structure-moves.r:336:1'): output not null ─────────────────────
+ Error in `is_false()`: could not find function "is_false"
+ Backtrace:
+ ▆
+ 1. └─testthat::expect_that(...)
+
+ [ FAIL 3 | WARN 0 | SKIP 0 | PASS 17 ]
+ Error:
+ ! Test failures.
+ Execution halted
+ ```
+
+# ergm (4.10.1)
+
+* GitHub:
+* Email:
+* GitHub mirror:
+
+Run `revdepcheck::cloud_details(, "ergm")` for more info
## Newly broken
+* checking tests ... ERROR
+ ```
+ ...
+ > test-valued-terms.R:
+ > test-valued-terms.R: 'ergm.count' 4.1.2 (2024-06-15), part of the Statnet Project
+ > test-valued-terms.R: * 'news(package="ergm.count")' for changes since last version
+ > test-valued-terms.R: * 'citation("ergm.count")' for citation information
+ > test-valued-terms.R: * 'https://statnet.org' for help, support, and other information
+ > test-valued-terms.R:
+ [ FAIL 2 | WARN 0 | SKIP 1 | PASS 4275 ]
+
+ ══ Skipped tests (1) ═══════════════════════════════════════════════════════════
+ • empty test (1):
+
+ ══ Failed tests ════════════════════════════════════════════════════════════════
+ ── Failure ('test-term-Offset.R:19:3'): Estimation with Offset() operator works ──
+ Expected failure message to match regexp ".* did not throw the expected message.*".
+ Actual message:
+ x | Expected `off <- ergm(nw ~ edges + offset(triangle), offset.coef = 0.1)` to throw a message.
+ ── Failure ('test-term-Offset.R:23:3'): Estimation with Offset() operator works ──
+ Expected failure message to match regexp ".* did not throw the expected message.*".
+ Actual message:
+ x | Expected `Off <- ergm(nw ~ edges + Offset(~triangle, which = 1, coef = 0.1))` to throw a message.
+
+ [ FAIL 2 | WARN 0 | SKIP 1 | PASS 4275 ]
+ Error:
+ ! Test failures.
+ Execution halted
+ ```
+
+## In both
+
* checking installed package size ... NOTE
- ```
- installed size is 6.7Mb
- sub-directories of 1Mb or more:
- R 6.0Mb
- ```
+ ```
+ installed size is 8.2Mb
+ sub-directories of 1Mb or more:
+ R 1.5Mb
+ doc 1.3Mb
+ help 1.6Mb
+ libs 2.9Mb
+ ```
-# gen3sis
+# expstudy (2.0.0)
-
+* GitHub:
+* Email:
+* GitHub mirror:
-* Version: 1.5.11
-* GitHub: https://github.com/project-Gen3sis/R-package
-* Source code: https://github.com/cran/gen3sis
-* Date/Publication: 2023-11-22 15:20:06 UTC
-* Number of recursive dependencies: 59
+Run `revdepcheck::cloud_details(, "expstudy")` for more info
-Run `revdepcheck::cloud_details(, "gen3sis")` for more info
+## Newly broken
-
+* checking tests ... ERROR
+ ```
+ ...
+ > library(testthat)
+ > library(expstudy)
+
+ Attaching package: 'expstudy'
+
+ The following object is masked from 'package:stats':
+
+ aggregate
+
+ >
+ > test_check("expstudy")
+ [ FAIL 1 | WARN 0 | SKIP 0 | PASS 19 ]
+
+ ══ Failed tests ════════════════════════════════════════════════════════════════
+ ── Failure ('test-summarise_measures.R:2:3'): measures summed up correctly ─────
+ Expected `as.list(summarise_measures(mortexp))` to be equal to `lapply(...)`.
+ Differences:
+ `attr(actual, 'measure_sets')` is a list
+ `attr(expected, 'measure_sets')` is absent
+
+
+ [ FAIL 1 | WARN 0 | SKIP 0 | PASS 19 ]
+ Error:
+ ! Test failures.
+ Execution halted
+ ```
+
+# fabletools (0.5.1)
+
+* GitHub:
+* Email:
+* GitHub mirror:
+
+Run `revdepcheck::cloud_details(, "fabletools")` for more info
## Newly broken
* checking tests ... ERROR
- ```
- Running ‘testthat.R’
- Running the tests in ‘tests/testthat.R’ failed.
- Complete output:
- > # Copyright (c) 2020, ETH Zurich
- >
- > library(testthat)
- > library(gen3sis)
- >
- > test_check("gen3sis")
- [ FAIL 1 | WARN 0 | SKIP 11 | PASS 23 ]
- ...
- Backtrace:
- ▆
- 1. └─testthat::local_mock(...) at test-input_creation.R:16:3
- 2. └─lifecycle::deprecate_stop("3.2.0", "local_mock()", "local_mocked_bindings()")
- 3. └─lifecycle:::deprecate_stop0(msg)
- 4. └─rlang::cnd_signal(...)
-
- [ FAIL 1 | WARN 0 | SKIP 11 | PASS 23 ]
- Error: Test failures
- Execution halted
- ```
+ ```
+ ...
+ ▆
+ 1. ├─... %>% expect_identical(c("key", "ets")) at test-mable.R:64:3
+ 2. └─testthat::expect_identical(., c("key", "ets"))
+ ── Failure ('test-mable.R:68:3'): mable dplyr verbs ────────────────────────────
+ Expected `.` to be identical to `c("key", "ets")`.
+ Differences:
+ target is NULL, current is character
+ Backtrace:
+ ▆
+ 1. ├─... %>% expect_identical(c("key", "ets")) at test-mable.R:68:3
+ 2. └─testthat::expect_identical(., c("key", "ets"))
+ ── Error ('test-mable.R:81:3'): mable dplyr verbs ──────────────────────────────
+
+ Error in `.[["key"]]`: subscript out of bounds
+ Backtrace:
+ ▆
+ 1. ├─... %>% expect_identical("mdeaths") at test-mable.R:81:3
+ 2. └─testthat::expect_identical(., "mdeaths")
+ 3. └─testthat::quasi_label(enquo(object), label)
+ 4. └─rlang::eval_bare(expr, quo_get_env(quo))
+
+ [ FAIL 3 | WARN 0 | SKIP 0 | PASS 291 ]
+ Error:
+ ! Test failures.
+ Execution halted
+ ```
+
+# futile.logger (1.4.3)
+
+* Email:
+* GitHub mirror:
+
+Run `revdepcheck::cloud_details(, "futile.logger")` for more info
+
+## Newly broken
+
+* checking tests ... ERROR
+ ```
+ ...
+ ── Error ('test_logger.R:34:3'): Create new logger ─────────────────────────────
+ Error in `is_true()`: could not find function "is_true"
+ Backtrace:
+ ▆
+ 1. └─testthat::expect_that(length(raw.root) == 0, is_true()) at test_logger.R:34:3
+ ── Error ('test_logger.R:47:3'): Hierarchy is honored ──────────────────────────
+ Error in `is_true()`: could not find function "is_true"
+ Backtrace:
+ ▆
+ 1. └─testthat::expect_that(length(raw.root) == 0, is_true()) at test_logger.R:47:3
+ ── Error ('test_logger.R:61:3'): Hierarchy inheritance ─────────────────────────
+ Error in `is_true()`: could not find function "is_true"
+ Backtrace:
+ ▆
+ 1. └─testthat::expect_that(length(raw.root) == 0, is_true()) at test_logger.R:61:3
+ ── Error ('test_logger.R:80:3'): carp returns output ───────────────────────────
+ Error in `is_false()`: could not find function "is_false"
+ Backtrace:
+ ▆
+ 1. └─testthat::expect_that(flog.carp(), is_false()) at test_logger.R:80:3
+
+ [ FAIL 12 | WARN 1 | SKIP 0 | PASS 40 ]
+ Error:
+ ! Test failures.
+ Execution halted
+ ```
+
+# ggeffects (2.3.1)
+
+* GitHub:
+* Email:
+* GitHub mirror:
+
+Run `revdepcheck::cloud_details(, "ggeffects")` for more info
+
+## Newly broken
+
+* checking tests ... ERROR
+ ```
+ ...
+ 'test-test_predictions_emmeans.R:73:1',
+ 'test-test_predictions_ggeffects.R:115:1',
+ 'test-test_predictions_ggeffects.R:164:1',
+ 'test-test_predictions_ggeffects.R:183:3',
+ 'test-test_predictions_ggeffects.R:226:5', 'test-vcov.R:1:1',
+ 'test-vglm.R:1:1', 'test-zeroinfl.R:27:3', 'test-zi_prob.R:1:1'
+ • On Linux (10): 'test-brglm.R:1:1', 'test-ci_backticks-names.R:1:1',
+ 'test-emmeans-weights.R:1:1', 'test-gee.R:1:1', 'test-ggaverage.R:1:1',
+ 'test-glm.R:1:1', 'test-ordinal.R:1:1', 'test-print_subsets.R:1:1',
+ 'test-print_test_predictions-ordinal.R:1:1',
+ 'test-print_test_predictions.R:1:1'
+ • empty test (2): 'test-polr.R:136:5', 'test-polr.R:142:5'
+
+ ══ Failed tests ════════════════════════════════════════════════════════════════
+ ── Failure ('test-polr.R:65:7'): ggaverage, polr, weights ──────────────────────
+ Expected `pr$predicted` to be equal to `c(...)`.
+ Differences:
+ `actual`: 0.4594 0.2668 0.2737 0.3307 0.2754 0.3939 0.1975 0.2378 0.5647
+ `expected`: 0.4489 0.2713 0.2798 0.3200 0.2776 0.4024 0.1888 0.2358 0.5754
+
+
+ [ FAIL 1 | WARN 0 | SKIP 70 | PASS 504 ]
+ Error:
+ ! Test failures.
+ Execution halted
+ ```
+
+# ggseg (1.6.5)
+
+* GitHub:
+* Email:
+* GitHub mirror:
+
+Run `revdepcheck::cloud_details(, "ggseg")` for more info
+
+## Newly broken
+
+* checking tests ... ERROR
+ ```
+ ...
+ Loading required package: ggseg
+ merging atlas and data by 'region'
+ merging atlas and data by 'region'
+ [ FAIL 1 | WARN 0 | SKIP 8 | PASS 106 ]
+
+ ══ Skipped tests (8) ═══════════════════════════════════════════════════════════
+ • On CRAN (7): 'test-brain-atlas-plots.R:2:1', 'test-ggseg.R:8:1',
+ 'test-ggseg.R:41:1', 'test-ggseg.R:50:1', 'test-ggseg_atlas.R:94:1',
+ 'test-scale_brain.R:2:1', 'test-theme_brain.R:2:1'
+ • empty test (1): 'test-coord-funcs.R:1:1'
+
+ ══ Failed tests ════════════════════════════════════════════════════════════════
+ ── Error ('test-brain_palettes.R:10:3'): Check that palette extraction happens ok ──
+ Error in `expect_warning(length(brain_pal("aseg", 2)), 3)`: `regexp` must be a single string, `NA`, or `NULL`, not the number 3.
+ Backtrace:
+ ▆
+ 1. └─testthat::expect_warning(regexp = 3) at test-brain_palettes.R:10:3
+ 2. └─testthat:::check_string(regexp, allow_null = TRUE, allow_na = TRUE)
+ 3. └─testthat:::stop_input_type(...)
+ 4. └─rlang::abort(message, ..., call = call, arg = arg)
+
+ [ FAIL 1 | WARN 0 | SKIP 8 | PASS 106 ]
+ Error:
+ ! Test failures.
+ Execution halted
+ ```
+
+## In both
+
+* checking package subdirectories ... NOTE
+ ```
+ Problems with news in ‘NEWS.md’:
+ Cannot extract version info from the following section titles:
+ * Changes all data options to .data to decrease possibility of column naming overlap
+ ```
+
+# gips (1.2.3)
+
+* GitHub:
+* Email:
+* GitHub mirror:
+
+Run `revdepcheck::cloud_details(, "gips")` for more info
+
+## Newly broken
+
+* checking tests ... ERROR
+ ```
+ ...
+ > library(gips)
+ >
+ > test_check("gips")
+ Loading required package: MASS
+ Loading required package: mvtnorm
+ [ FAIL 2 | WARN 0 | SKIP 0 | PASS 464 ]
+
+ ══ Failed tests ════════════════════════════════════════════════════════════════
+ ── Failure ('test-log_posteriori_of_gips.R:167:3'): compare_posteriories_of_perms properly calculates ──
+ Expected `expect_output(...)` to be equal to `1/94914.4439516766`.
+ Differences:
+ `actual` is a character vector ('The permutation (1,2,3)(4,5) is 1.054e-5 times more likely than the (1,2,3,4,5) permutation.\nThat means, the second permutation is more likely.')
+ `expected` is a double vector (1.05358042292185e-05)
+
+ ── Failure ('test-log_posteriori_of_gips.R:174:3'): compare_posteriories_of_perms properly calculates ──
+ Expected `expect_output(...)` to be equal to `-log(94914.4439516766)`.
+ Differences:
+ `actual` is a character vector ('The permutation (1,2,3)(4,5) is exp(-11.461) times more likely than the (1,2,3,4,5) permutation.\nThat means, the second permutation is more likely.')
+ `expected` is a double vector (-11.4607311748255)
+
+
+ [ FAIL 2 | WARN 0 | SKIP 0 | PASS 464 ]
+ Error:
+ ! Test failures.
+ Execution halted
+ ```
+
+# graphhopper (0.1.2)
+
+* GitHub:
+* Email:
+* GitHub mirror:
+
+Run `revdepcheck::cloud_details(, "graphhopper")` for more info
+
+## Newly broken
+
+* checking tests ... ERROR
+ ```
+ ...
+ > library(graphhopper)
+ >
+ > test_check("graphhopper")
+ [ FAIL 1 | WARN 0 | SKIP 2 | PASS 6 ]
+
+ ══ Skipped tests (2) ═══════════════════════════════════════════════════════════
+ • gh_is_avialable() is not TRUE (2): 'test_route-local-gh-instance.R:10:3',
+ 'test_spt-local-gh-instance.R:4:3'
+
+ ══ Failed tests ════════════════════════════════════════════════════════════════
+ ── Error ('test_route.R:9:3'): sf LINESTRING ───────────────────────────────────
+
+ Error: `with_mock()` was deprecated in testthat 3.2.0 and is now defunct.
+ ℹ Please use `with_mocked_bindings()` instead.
+ Backtrace:
+ ▆
+ 1. └─testthat::with_mock(...) at test_route.R:9:3
+ 2. └─lifecycle::deprecate_stop("3.2.0", "with_mock()", "with_mocked_bindings()")
+ 3. └─lifecycle:::deprecate_stop0(msg)
+ 4. └─rlang::cnd_signal(...)
+
+ [ FAIL 1 | WARN 0 | SKIP 2 | PASS 6 ]
+ Error:
+ ! Test failures.
+ Execution halted
+ ```
+
+## In both
+
+* checking LazyData ... NOTE
+ ```
+ 'LazyData' is specified without a 'data' directory
+ ```
+
+# greeks (1.4.4)
+
+* GitHub:
+* Email:
+* GitHub mirror:
+
+Run `revdepcheck::cloud_details(, "greeks")` for more info
+
+## Newly broken
+
+* checking tests ... ERROR
+ ```
+ ...
+ Error in `expect(max(error) < sqrt(epsilon))`: argument "failure_message" is missing, with no default
+ Backtrace:
+ ▆
+ 1. └─testthat::expect(max(error) < sqrt(epsilon)) at test-BS_European_Greeks.R:107:3
+ 2. └─testthat::succeed(failure_message)
+ 3. └─base::paste(c(message, info), collapse = "\n")
+ ── Error ('test-BS_Geometric_Asian_Greeks.R:81:3'): BS_Geometric_Asian_Greeks is correct ──
+ Error in `expect(max(error) < sqrt(epsilon))`: argument "failure_message" is missing, with no default
+ Backtrace:
+ ▆
+ 1. └─testthat::expect(max(error) < sqrt(epsilon)) at test-BS_Geometric_Asian_Greeks.R:81:3
+ 2. └─testthat::succeed(failure_message)
+ 3. └─base::paste(c(message, info), collapse = "\n")
+ ── Error ('test-Implied_Volatility.R:90:3'): implied volatility is correct ─────
+ Error in `expect(max(abs(option_price_test - option_price)) < 1e-06)`: argument "failure_message" is missing, with no default
+ Backtrace:
+ ▆
+ 1. └─testthat::expect(...) at test-Implied_Volatility.R:90:3
+ 2. └─testthat::succeed(failure_message)
+ 3. └─base::paste(c(message, info), collapse = "\n")
+
+ [ FAIL 3 | WARN 0 | SKIP 0 | PASS 17 ]
+ Error:
+ ! Test failures.
+ Execution halted
+ ```
+
+## In both
+
+* checking installed package size ... NOTE
+ ```
+ installed size is 5.2Mb
+ sub-directories of 1Mb or more:
+ libs 4.8Mb
+ ```
+
+# HandTill2001 (1.0.2)
+
+* Email:
+* GitHub mirror:
+
+Run `revdepcheck::cloud_details(, "HandTill2001")` for more info
+
+## Newly broken
+
+* checking tests ... ERROR
+ ```
+ Running ‘runit.R’
+ Running ‘testthat.R’
+ Running the tests in ‘tests/testthat.R’ failed.
+ Complete output:
+ > library(testthat)
+ > library("HandTill2001")
+ >
+ > test_check("HandTill2001")
+ [ FAIL 1 | WARN 0 | SKIP 0 | PASS 15 ]
+
+ ══ Failed tests ════════════════════════════════════════════════════════════════
+ ── Error ('test-throw.R:5:3'): throw the HandTill2001 exception ────────────────
+ Error in `testthat::expect_error(HandTill2001:::throw(string), regexp = error_message, class = c("error", "HandTill2001", "condition"))`: `class` must be a single string or `NULL`, not a character vector.
+ Backtrace:
+ ▆
+ 1. └─testthat::expect_error(class = c("error", "HandTill2001", "condition")) at test-throw.R:5:3
+ 2. └─testthat:::check_string(class, allow_null = TRUE)
+ 3. └─testthat:::stop_input_type(...)
+ 4. └─rlang::abort(message, ..., call = call, arg = arg)
+
+ [ FAIL 1 | WARN 0 | SKIP 0 | PASS 15 ]
+ Error:
+ ! Test failures.
+ Execution halted
+ ```
+
+## In both
+
+* checking re-building of vignette outputs ... WARNING
+ ```
+ ...
+ --- re-building ‘consensus_auc.Rnw’ using Sweave
+ Loading required package: class
+ Loaded mda 0.5-5
+
+ Error: processing vignette 'consensus_auc.Rnw' failed with diagnostics:
+ Running 'texi2dvi' on 'consensus_auc.tex' failed.
+ LaTeX errors:
+ ! LaTeX Error: File `grfext.sty' not found.
+
+ Type X to quit or to proceed,
+ or enter new name. (Default extension: sty)
+
+ ! Emergency stop.
+
+
+ l.179 \RequirePackage{grfext}\relax
+ ^^M
+ ! ==> Fatal error occurred, no output PDF file produced!
+ --- failed re-building ‘consensus_auc.Rnw’
+
+ SUMMARY: processing the following file failed:
+ ‘consensus_auc.Rnw’
+
+ Error: Vignette re-building failed.
+ Execution halted
+ ```
+
+# hdcuremodels (0.0.5)
+
+* GitHub:
+* Email:
+* GitHub mirror:
+
+Run `revdepcheck::cloud_details(, "hdcuremodels")` for more info
+
+## Newly broken
+
+* checking tests ... ERROR
+ ```
+ ...
+ Number of non-zero latency covariates: 26
+
+ Mixture cure model fit using the EM algorithm
+
+ using cross-validation
+
+ Number of non-zero incidence covariates: 3
+
+ Number of non-zero latency covariates: 26
+
+ [ FAIL 1 | WARN 0 | SKIP 0 | PASS 556 ]
+
+ ══ Failed tests ════════════════════════════════════════════════════════════════
+ ── Error ('test-formula.R:11:3'): formula function works correctly ─────────────
+ Error in `expect(is.call(formula(fit)))`: argument "failure_message" is missing, with no default
+ Backtrace:
+ ▆
+ 1. └─testthat::expect(is.call(formula(fit))) at test-formula.R:11:3
+ 2. └─testthat::succeed(failure_message)
+ 3. └─base::paste(c(message, info), collapse = "\n")
+
+ [ FAIL 1 | WARN 0 | SKIP 0 | PASS 556 ]
+ Error:
+ ! Test failures.
+ Execution halted
+ ```
+
+# hedgehog (0.1)
+
+* GitHub:
+* Email:
+* GitHub mirror:
+
+Run `revdepcheck::cloud_details(, "hedgehog")` for more info
+
+## Newly broken
+
+* checking tests ... ERROR
+ ```
+ ...
+ 12. └─hedgehog:::as.expectation.error(e)
+ 13. └─testthat::expectation("error", msg, srcref)
+ 14. └─testthat::new_expectation(...)
+ 15. └─base::structure(...)
+ ── Error ('test_hedgehog.R:173:1'): can mix pure and generative in a list ──────
+ Error in `attributes(.Data) <- c(attributes(.Data), attrib)`: all attributes must have names [3 does not]
+ Backtrace:
+ ▆
+ 1. └─hedgehog::forall(...)
+ 2. └─hedgehog:::run.prop(property, tree$root, curry)
+ 3. └─base::tryCatch(...)
+ 4. └─base (local) tryCatchList(expr, classes, parentenv, handlers)
+ 5. └─base (local) tryCatchOne(expr, names, parentenv, handlers[[1L]])
+ 6. └─value[[3L]](cond)
+ 7. └─hedgehog (local) register_expectation(e)
+ 8. ├─hedgehog:::as.expectation(e)
+ 9. └─hedgehog:::as.expectation.error(e)
+ 10. └─testthat::expectation("error", msg, srcref)
+ 11. └─testthat::new_expectation(...)
+ 12. └─base::structure(...)
+
+ [ FAIL 4 | WARN 1 | SKIP 0 | PASS 27 ]
+ Error:
+ ! Test failures.
+ Execution halted
+ ```
+
+# htmltools (0.5.8.1)
+
+* GitHub:
+* Email:
+* GitHub mirror:
+
+Run `revdepcheck::cloud_details(, "htmltools")` for more info
+
+## Newly broken
+
+* checking tests ... ERROR
+ ```
+ ...
+ ══ Failed tests ════════════════════════════════════════════════════════════════
+ ── Error ('test-tag-query.R:123:3'): tagQuery()$find() ─────────────────────────
+ Error in `y$parent`: $ operator is invalid for atomic vectors
+ Backtrace:
+ ▆
+ 1. ├─testthat::expect_failure(...) at test-tag-query.R:123:3
+ 2. │ └─testthat:::capture_success_failure(expr)
+ 3. │ └─base::withCallingHandlers(...)
+ 4. └─htmltools:::expect_equal_tags(x$selectedTags(), newX$selectedTags())
+ 5. └─htmltools (local) expect_equal_tags_(x, y) at ./helper-tags.R:25:3
+ 6. └─base::Map(x, y, f = expect_equal_tags_) at ./helper-tags.R:16:7
+ 7. └─base::mapply(FUN = f, ..., SIMPLIFY = FALSE)
+ 8. └─htmltools (local) ``(dots[[1L]][[1L]], dots[[2L]][[1L]])
+ 9. └─htmltools (local) expect_equal_tags_(x$children, y$children) at ./helper-tags.R:12:7
+ 10. └─base::Map(x, y, f = expect_equal_tags_) at ./helper-tags.R:16:7
+ 11. └─base::mapply(FUN = f, ..., SIMPLIFY = FALSE)
+ 12. └─htmltools (local) ``(dots[[1L]][[1L]], dots[[2L]][[1L]])
+ 13. └─testthat::expect_equal(y$parent, NULL) at ./helper-tags.R:8:7
+ 14. └─testthat::quasi_label(enquo(object), label)
+ 15. └─rlang::eval_bare(expr, quo_get_env(quo))
+
+ [ FAIL 1 | WARN 0 | SKIP 7 | PASS 10196 ]
+ Error:
+ ! Test failures.
+ Execution halted
+ ```
+
+## In both
+
+* checking package dependencies ... NOTE
+ ```
+ Package which this enhances but not available for checking: ‘knitr’
+ ```
+
+# httptest (4.2.2)
+
+* GitHub:
+* Email:
+* GitHub mirror:
+
+Run `revdepcheck::cloud_details(, "httptest")` for more info
+
+## Newly broken
+
+* checking tests ... ERROR
+ ```
+ ...
+ 4. │ └─testthat:::expect_condition_matching_(...)
+ 5. │ └─testthat:::quasi_capture(...)
+ 6. │ ├─testthat (local) .capture(...)
+ 7. │ │ └─base::withCallingHandlers(...)
+ 8. │ └─rlang::eval_bare(quo_get_expr(.quo), quo_get_env(.quo))
+ 9. └─testthat::expect_failure(...)
+ ── Failure ('test-expect-header.R:25:7'): expect_header with fake HTTP ─────────
+ Expected zero successes.
+ Actually succeeded 1 times
+ Backtrace:
+ ▆
+ 1. ├─httptest::expect_POST(...) at test-expect-header.R:25:7
+ 2. │ └─httptest:::expect_mock_request(object, "POST ", url, " ", ...)
+ 3. │ └─request_happened()(...)
+ 4. │ └─testthat:::expect_condition_matching_(...)
+ 5. │ └─testthat:::quasi_capture(...)
+ 6. │ ├─testthat (local) .capture(...)
+ 7. │ │ └─base::withCallingHandlers(...)
+ 8. │ └─rlang::eval_bare(quo_get_expr(.quo), quo_get_env(.quo))
+ 9. └─testthat::expect_failure(...)
+
+ [ FAIL 2 | WARN 0 | SKIP 12 | PASS 289 ]
+ Error:
+ ! Test failures.
+ Execution halted
+ ```
+
+# httptest2 (1.2.1)
+
+* GitHub:
+* Email:
+* GitHub mirror:
+
+Run `revdepcheck::cloud_details(, "httptest2")` for more info
+
+## Newly broken
+
+* checking tests ... ERROR
+ ```
+ ...
+
+ Error in `mock(req)`: An unexpected request was made:
+ POST http://httpbin.not/get {"test":true}
+ Backtrace:
+ ▆
+ 1. ├─testthat::expect_failure(...) at test-expect-request.R:75:5
+ 2. │ └─testthat:::capture_success_failure(expr)
+ 3. │ └─base::withCallingHandlers(...)
+ 4. ├─httptest2::expect_POST(...)
+ 5. │ └─httptest2:::expect_request(object, "POST ", url, " ", ...)
+ 6. │ ├─base::withCallingHandlers(...)
+ 7. │ └─testthat::expect_error(...)
+ 8. │ └─testthat:::expect_condition_matching_(...)
+ 9. │ └─testthat:::quasi_capture(...)
+ 10. │ ├─testthat (local) .capture(...)
+ 11. │ │ └─base::withCallingHandlers(...)
+ 12. │ └─rlang::eval_bare(quo_get_expr(.quo), quo_get_env(.quo))
+ 13. └─httr2::req_perform(this_req)
+ 14. └─httptest2 (local) mock(req)
+ 15. └─rlang::abort(out, mockfile = req$mockfile, class = "httptest2_request")
+
+ [ FAIL 5 | WARN 0 | SKIP 2 | PASS 233 ]
+ Error:
+ ! Test failures.
+ Execution halted
+ ```
+
+# humanize (0.2.0)
+
+* GitHub:
+* Email:
+* GitHub mirror:
+
+Run `revdepcheck::cloud_details(, "humanize")` for more info
+
+## Newly broken
+
+* checking tests ... ERROR
+ ```
+ ...
+ ── Error ('test_time.R:145:3'): natural_time works as expected ─────────────────
+
+ Error: `with_mock()` was deprecated in testthat 3.2.0 and is now defunct.
+ ℹ Please use `with_mocked_bindings()` instead.
+ Backtrace:
+ ▆
+ 1. └─testthat::with_mock(...) at test_time.R:145:3
+ 2. └─lifecycle::deprecate_stop("3.2.0", "with_mock()", "with_mocked_bindings()")
+ 3. └─lifecycle:::deprecate_stop0(msg)
+ 4. └─rlang::cnd_signal(...)
+ ── Error ('test_time.R:214:3'): natural_time no months works as expected ───────
+
+ Error: `with_mock()` was deprecated in testthat 3.2.0 and is now defunct.
+ ℹ Please use `with_mocked_bindings()` instead.
+ Backtrace:
+ ▆
+ 1. └─testthat::with_mock(...) at test_time.R:214:3
+ 2. └─lifecycle::deprecate_stop("3.2.0", "with_mock()", "with_mocked_bindings()")
+ 3. └─lifecycle:::deprecate_stop0(msg)
+ 4. └─rlang::cnd_signal(...)
+
+ [ FAIL 2 | WARN 0 | SKIP 0 | PASS 96 ]
+ Error:
+ ! Test failures.
+ Execution halted
+ ```
+
+## In both
+
+* checking LazyData ... NOTE
+ ```
+ 'LazyData' is specified without a 'data' directory
+ ```
+
+# HurreconR (1.1)
+
+* GitHub:
+* Email:
+* GitHub mirror:
+
+Run `revdepcheck::cloud_details(, "HurreconR")` for more info
+
+## Newly broken
+
+* checking tests ... ERROR
+ ```
+ ...
+ >
+ > library(testthat)
+ > library(HurreconR)
+ >
+ > test_check("HurreconR")
+ Path set to /tmp/workdir/HurreconR/new/HurreconR.Rcheck/HurreconR/
+ ... Modeling site ...
+ 017 ms
+ [ FAIL 1 | WARN 1 | SKIP 0 | PASS 0 ]
+
+ ══ Failed tests ════════════════════════════════════════════════════════════════
+ ── Error ('test_HurreconR.R:14:1'): (code run outside of `test_that()`) ────────
+ Error in `expect_snapshot_value(hurrecon_summarize_site(hur_id = "AL1935-03", site_name = "Miami FL", hur_path = hur_path), test.expected, style = "serialize", cran = FALSE)`: `tolerance` must be a number, not the string "/tmp/workdir/HurreconR/new/...".
+ Backtrace:
+ ▆
+ 1. └─testthat::expect_snapshot_value(tolerance = test.expected) at test_HurreconR.R:14:1
+ 2. └─testthat:::check_number_decimal(tolerance, min = 0)
+ 3. └─testthat:::.stop_not_number(...)
+ 4. └─testthat:::stop_input_type(...)
+ 5. └─rlang::abort(message, ..., call = call, arg = arg)
+
+ [ FAIL 1 | WARN 1 | SKIP 0 | PASS 0 ]
+ Error:
+ ! Test failures.
+ Execution halted
+ ```
+
+# IMEC (0.2.0)
+
+* Email:
+* GitHub mirror:
+
+Run `revdepcheck::cloud_details(, "IMEC")` for more info
+
+## Newly broken
+
+* checking tests ... ERROR
+ ```
+ ...
+ [ FAIL 2 | WARN 2 | SKIP 1 | PASS 2 ]
+
+ ══ Skipped tests (1) ═══════════════════════════════════════════════════════════
+ • On CRAN (1): 'test-0-basictests.R:105:1'
+
+ ══ Failed tests ════════════════════════════════════════════════════════════════
+ ── Error ('test-0-basictests.R:29:3'): analytic way of calculating coherence works ──
+ Error in `expect(0 < mean(IMEC$ExplanatoryCoherenceT1[[2]]))`: argument "failure_message" is missing, with no default
+ Backtrace:
+ ▆
+ 1. └─testthat::expect(0 < mean(IMEC$ExplanatoryCoherenceT1[[2]])) at test-0-basictests.R:29:3
+ 2. └─testthat::succeed(failure_message)
+ 3. └─base::paste(c(message, info), collapse = "\n")
+ ── Error ('test-0-basictests.R:60:3'): analytic way of calculating coherence works for 1 theory ──
+ Error in `expect(0 < mean(IMEC$ExplanatoryCoherenceT1[[2]]))`: argument "failure_message" is missing, with no default
+ Backtrace:
+ ▆
+ 1. └─testthat::expect(0 < mean(IMEC$ExplanatoryCoherenceT1[[2]])) at test-0-basictests.R:60:3
+ 2. └─testthat::succeed(failure_message)
+ 3. └─base::paste(c(message, info), collapse = "\n")
+
+ [ FAIL 2 | WARN 2 | SKIP 1 | PASS 2 ]
+ Error:
+ ! Test failures.
+ Execution halted
+ ```
+
+## In both
+
+* checking LazyData ... NOTE
+ ```
+ 'LazyData' is specified without a 'data' directory
+ ```
+
+# installr (0.23.4)
+
+* GitHub:
+* Email:
+* GitHub mirror:
+
+Run `revdepcheck::cloud_details(, "installr")` for more info
+
+## Newly broken
+
+* checking tests ... ERROR
+ ```
+ ...
+ Error in `!generated_warnings`: invalid argument type
+ Backtrace:
+ ▆
+ 1. └─testthat::expect_setequal(!!generated_warnings, !!expected_warnings) at test-copy_site_files.R:213:5
+ 2. └─testthat:::check_vector(object)
+ 3. └─testthat:::is_vector(x)
+ ── Error ('test-copy_site_files.R:213:5'): Rprofile.site: TRUE, Renviron.site: FALSE, copy_site_files: NA, copy_Rprofile.site: NA, copy_question_response: FALSE ──
+ Error in `!generated_warnings`: invalid argument type
+ Backtrace:
+ ▆
+ 1. └─testthat::expect_setequal(!!generated_warnings, !!expected_warnings) at test-copy_site_files.R:213:5
+ 2. └─testthat:::check_vector(object)
+ 3. └─testthat:::is_vector(x)
+ ── Error ('test-copy_site_files.R:213:5'): Rprofile.site: FALSE, Renviron.site: FALSE, copy_site_files: NA, copy_Rprofile.site: NA, copy_question_response: FALSE ──
+ Error in `!generated_warnings`: invalid argument type
+ Backtrace:
+ ▆
+ 1. └─testthat::expect_setequal(!!generated_warnings, !!expected_warnings) at test-copy_site_files.R:213:5
+ 2. └─testthat:::check_vector(object)
+ 3. └─testthat:::is_vector(x)
+
+ [ FAIL 64 | WARN 0 | SKIP 2 | PASS 33 ]
+ Error:
+ ! Test failures.
+ Execution halted
+ ```
+
+## In both
+
+* checking Rd files ... NOTE
+ ```
+ checkRd: (-1) ask.user.yn.question.Rd:44: Lost braces; missing escapes or markup?
+ 44 | menu in the {utils} package, yesno in the {devtools} package.
+ | ^
+ checkRd: (-1) ask.user.yn.question.Rd:44: Lost braces; missing escapes or markup?
+ 44 | menu in the {utils} package, yesno in the {devtools} package.
+ | ^
+ checkRd: (-1) install.FFmpeg.Rd:25: Lost braces; missing escapes or markup?
+ 25 | This function is useful for saveVideo() in the {animation} package.
+ | ^
+ checkRd: (-1) install.SWFTools.Rd:27: Lost braces; missing escapes or markup?
+ 27 | This function is useful for saveSWF() in the {animation} package.
+ | ^
+ checkRd: (-1) os.shutdown.Rd:25: Lost braces; missing escapes or markup?
+ 25 | This function is a modified version of Yihui's shutdown function from the {fun} package.
+ | ^
+ ```
+
+# itan (3.1.1)
+
+* GitHub:
+* Email:
+* GitHub mirror:
+
+Run `revdepcheck::cloud_details(, "itan")` for more info
+
+## Newly broken
+
+* checking tests ... ERROR
+ ```
+ ...
+ Expected `actual` to be equal to `expected`.
+ Differences:
+ `actual$A` is an integer vector (6, 0, 6, 13, 17, ...)
+ `expected$A` is a double vector (6, 0, 6, 13, 17, ...)
+
+ `actual$B` is an integer vector (4, 1, 4, 22, 8, ...)
+ `expected$B` is a double vector (4, 1, 4, 22, 8, ...)
+
+ `actual$C` is an integer vector (4, 4, 26, 0, 6, ...)
+ `expected$C` is a double vector (4, 4, 26, 0, 6, ...)
+
+ `actual$D` is an integer vector (2, 33, 1, 2, 0, ...)
+ `expected$D` is a double vector (2, 33, 1, 2, 0, ...)
+
+ `actual$E` is an integer vector (21, 0, 0, 1, 7, ...)
+ `expected$E` is a double vector (21, 0, 0, 1, 7, ...)
+
+ `actual$NA` is an integer vector (2, 1, 2, 1, 1, ...)
+ `expected$NA` is a double vector (2, 1, 2, 1, 1, ...)
+
+
+ [ FAIL 4 | WARN 50 | SKIP 0 | PASS 101 ]
+ Error:
+ ! Test failures.
+ Execution halted
+ ```
+
+# latrend (1.6.2)
+
+* GitHub:
+* Email:
+* GitHub mirror:
+
+Run `revdepcheck::cloud_details(, "latrend")` for more info
+
+## Newly broken
+
+* checking tests ... ERROR
+ ```
+ ...
+ [ FAIL 1 | WARN 0 | SKIP 12 | PASS 2350 ]
+
+ ══ Skipped tests (12) ══════════════════════════════════════════════════════════
+ • On CRAN (9): 'test-crimcv.R:4:1', 'test-flexmix.R:2:1', 'test-funfem.R:3:1',
+ 'test-lcmm.R:2:1', 'test-mixak.R:2:1', 'test-mixtools.R:3:1',
+ 'test-parallel.R:1:1', 'test-stratify.R:79:3', 'test-stratify.R:89:3'
+ • empty test (1): 'test-quick.R:1:1'
+ • skipping MixTVEM tests because the TVEMMixNormal() function is not loaded
+ (1): 'test-mixtvem.R:2:1'
+ • {akmedoids} is not installed (1): 'test-akmedoids.R:2:1'
+
+ ══ Failed tests ════════════════════════════════════════════════════════════════
+ ── Failure ('test-models.R:62:3'): as.data.frame ───────────────────────────────
+ Expected `nrow(.)` to equal 0.
+ Differences:
+ target is NULL, current is numeric
+ Backtrace:
+ ▆
+ 1. ├─... %T>% ... at test-models.R:62:3
+ 2. └─testthat::expect_equal(nrow(.), 0)
+
+ [ FAIL 1 | WARN 0 | SKIP 12 | PASS 2350 ]
+ Error:
+ ! Test failures.
+ Execution halted
+ ```
+
+# leaflet.minicharts (0.6.2)
+
+* Email:
+* GitHub mirror:
+
+Run `revdepcheck::cloud_details(, "leaflet.minicharts")` for more info
+
+## Newly broken
+
+* checking tests ... ERROR
+ ```
+ ...
+ ── Error ('test-flows.R:12:1'): (code run outside of `test_that()`) ────────────
+
+ Error: `with_mock()` was deprecated in testthat 3.2.0 and is now defunct.
+ ℹ Please use `with_mocked_bindings()` instead.
+ Backtrace:
+ ▆
+ 1. └─testthat::with_mock(...) at test-flows.R:12:1
+ 2. └─lifecycle::deprecate_stop("3.2.0", "with_mock()", "with_mocked_bindings()")
+ 3. └─lifecycle:::deprecate_stop0(msg)
+ 4. └─rlang::cnd_signal(...)
+ ── Error ('test-minicharts.R:12:1'): (code run outside of `test_that()`) ───────
+
+ Error: `with_mock()` was deprecated in testthat 3.2.0 and is now defunct.
+ ℹ Please use `with_mocked_bindings()` instead.
+ Backtrace:
+ ▆
+ 1. └─testthat::with_mock(...) at test-minicharts.R:12:1
+ 2. └─lifecycle::deprecate_stop("3.2.0", "with_mock()", "with_mocked_bindings()")
+ 3. └─lifecycle:::deprecate_stop0(msg)
+ 4. └─rlang::cnd_signal(...)
+
+ [ FAIL 2 | WARN 0 | SKIP 0 | PASS 106 ]
+ Error:
+ ! Test failures.
+ Execution halted
+ ```
+
+# learnr (0.11.5)
+
+* GitHub:
+* Email:
+* GitHub mirror:
+
+Run `revdepcheck::cloud_details(, "learnr")` for more info
+
+## Newly broken
+
+* checking tests ... ERROR
+ ```
+ ...
+ ── Error ('test-options-reveal_solution.R:37:3'): Solutions are revealed or hidden with tutorial_options() ──
+ Error in `if (n_extra > 0) { lines <- c(lines, paste0("... and ", n_extra, " more.\n")) }`: missing value where TRUE/FALSE needed
+ Backtrace:
+ ▆
+ 1. ├─testthat::expect_failure(...) at test-options-reveal_solution.R:37:3
+ 2. │ └─testthat:::capture_success_failure(expr)
+ 3. │ └─base::withCallingHandlers(...)
+ 4. └─testthat::expect_match(ex_show, hidden_solution, fixed = TRUE)
+ 5. └─testthat:::expect_match_(...)
+ 6. └─testthat:::show_text(act$val, condition)
+ ── Error ('test-options-reveal_solution.R:57:3'): Solutions are revealed or hidden with global option ──
+ Error in `if (n_extra > 0) { lines <- c(lines, paste0("... and ", n_extra, " more.\n")) }`: missing value where TRUE/FALSE needed
+ Backtrace:
+ ▆
+ 1. ├─testthat::expect_failure(...) at test-options-reveal_solution.R:57:3
+ 2. │ └─testthat:::capture_success_failure(expr)
+ 3. │ └─base::withCallingHandlers(...)
+ 4. └─testthat::expect_match(ex_show, hidden_solution, fixed = TRUE)
+ 5. └─testthat:::expect_match_(...)
+ 6. └─testthat:::show_text(act$val, condition)
+
+ [ FAIL 3 | WARN 0 | SKIP 20 | PASS 790 ]
+ Error:
+ ! Test failures.
+ Execution halted
+ ```
+
+# lightr (1.9.0)
+
+* GitHub:
+* Email:
+* GitHub mirror:
+
+Run `revdepcheck::cloud_details(, "lightr")` for more info
+
+## Newly broken
+
+* checking tests ... ERROR
+ ```
+ ...
+ 1 files found; importing spectra:
+ 1 files found; importing spectra:
+ 1 files found; importing spectra:
+ [ FAIL 1 | WARN 0 | SKIP 7 | PASS 390 ]
+
+ ══ Skipped tests (7) ═══════════════════════════════════════════════════════════
+ • On CRAN (6): 'test_parsers.R:3:3', 'test_parsers.R:34:1',
+ 'test_parsers.R:81:1', 'test_parsers.R:150:1', 'test_parsers.R:156:1',
+ 'test_parsers.R:200:1'
+ • {photobiologyInOut} is not installed (1):
+ 'test_compare_photobiologyInOut.R:2:3'
+
+ ══ Failed tests ════════════════════════════════════════════════════════════════
+ ── Error ('test_convert.R:18:3'): Convert all ──────────────────────────────────
+ Error in `!tools::file_path_sans_ext(input_files)`: invalid argument type
+ Backtrace:
+ ▆
+ 1. └─testthat::expect_setequal(...) at test_convert.R:18:3
+ 2. └─testthat:::check_vector(object)
+ 3. └─testthat:::is_vector(x)
+
+ [ FAIL 1 | WARN 0 | SKIP 7 | PASS 390 ]
+ Error:
+ ! Test failures.
+ Execution halted
+ ```
+
+# lintr (3.2.0)
+
+* GitHub:
+* Email: