Remove amino acid placeholder from tRNA structure JSONs

The ensure_cca_tail() function in generate_svgs.py appended a lowercase
'a' after CCA as an amino acid attachment placeholder. This extra
nucleotide was rendered by R2R and parsed into JSON as an uppercase "A",
causing structure diagrams to display "CCAA" instead of "CCA". The
placeholder is no longer needed since add_end_labels() in R handles the
amino acid label post-hoc. Also fix odds_ratios_filtered path in
structure vignette.

Co-Authored-By: Claude Opus 4.6 <noreply@anthropic.com>

Author: jayhesselberth

data-raw/structures/generate_svgs.py

@@ -442,23 +442,19 @@ def postprocess_svg(svg_content: str, trna_name: str) -> str:
 
 
 def ensure_cca_tail(sequence: str, structure: str) -> tuple[str, str]:
-    """Append CCA tail and amino acid placeholder to sequence if missing.
+    """Append CCA tail to sequence if missing.
 
     Most eukaryotic tRNAs in genomic sequences lack the post-transcriptionally
-    added CCA tail. We add it plus a lowercase 'a' placeholder for the amino
-    acid attachment site. This extra position can be used to visualize
-    aminoacylation state alongside modification data.
+    added CCA tail. We add it as unpaired nucleotides so the structure diagram
+    includes the full mature tRNA sequence.
     """
     upper_seq = sequence.upper()
     if upper_seq.endswith("CCA"):
-        # Already has CCA, just add amino acid placeholder
-        sequence = sequence + "a"
-        structure = structure + "."
         return sequence, structure
 
-    # Append CCA + amino acid placeholder as unpaired nucleotides
-    sequence = sequence + "CCAa"
-    structure = structure + "...."
+    # Append CCA as unpaired nucleotides
+    sequence = sequence + "CCA"
+    structure = structure + "..."
     return sequence, structure
 
 

inst/extdata/structures/Escherichia_coli/tRNA-Ala-GGC.json

@@ -455,12 +455,6 @@
       "x": 84.16,
       "y": 29.06,
       "pos": 76
-    },
-    {
-      "base": "A",
-      "x": 84.16,
-      "y": 21.5,
-      "pos": 77
     }
   ],
   "width": 154.67,
@@ -469,4 +463,4 @@
   "trna_name": "tRNA-Ala-GGC",
   "sequence": "GGGGCUAUAGCUCAGCUGGGAGAGCGCUUGCAUGGCAUGCAAGAGGUCAGCGGUUCGAUCCCGCUUAGCUCCACCA",
   "structure": "<<<<<<<..<<<<........>>>>.<<<<<.......>>>>>.....<<<<<.......>>>>>>>>>>>>...."
-}
+}

inst/extdata/structures/Escherichia_coli/tRNA-Ala-TGC.json

@@ -455,12 +455,6 @@
       "x": 84.16,
       "y": 29.06,
       "pos": 76
-    },
-    {
-      "base": "A",
-      "x": 84.16,
-      "y": 21.5,
-      "pos": 77
     }
   ],
   "width": 154.67,
@@ -469,4 +463,4 @@
   "trna_name": "tRNA-Ala-TGC",
   "sequence": "GGGGCUAUAGCUCAGCUGGGAGAGCGCCUGCUUUGCACGCAGGAGGUCUGCGGUUCGAUCCCGCAUAGCUCCACCA",
   "structure": "<<<<<<<..<<<<........>>>>.<<<<<.......>>>>>.....<<<<<.......>>>>>>>>>>>>...."
-}
+}

inst/extdata/structures/Escherichia_coli/tRNA-Arg-ACG.json

@@ -461,12 +461,6 @@
       "x": 87.22,
       "y": 29.06,
       "pos": 77
-    },
-    {
-      "base": "A",
-      "x": 87.22,
-      "y": 21.5,
-      "pos": 78
     }
   ],
   "width": 157.73,
@@ -475,4 +469,4 @@
   "trna_name": "tRNA-Arg-ACG",
   "sequence": "GCAUCCGUAGCUCAGCUGGAUAGAGUACUCGGCUACGAACCGAGCGGUCGGAGGUUCGAAUCCUCCCGGAUGCACCA",
   "structure": "<<<<<<<..<<<<.........>>>>.<<<<<.......>>>>>.....<<<<<.......>>>>>>>>>>>>...."
-}
+}

inst/extdata/structures/Escherichia_coli/tRNA-Arg-CCG.json

@@ -461,12 +461,6 @@
       "x": 87.22,
       "y": 29.06,
       "pos": 77
-    },
-    {
-      "base": "A",
-      "x": 87.22,
-      "y": 21.5,
-      "pos": 78
     }
   ],
   "width": 157.73,
@@ -475,4 +469,4 @@
   "trna_name": "tRNA-Arg-CCG",
   "sequence": "GCGCCCGUAGCUCAGCUGGAUAGAGCGCUGCCCUCCGGAGGCAGAGGUCUCAGGUUCGAAUCCUGUCGGGCGCGCCA",
   "structure": "<<<<<<<..<<<<.........>>>>.<<<<<.......>>>>>.....<<<<<.......>>>>>>>>>>>>...."
-}
+}

inst/extdata/structures/Escherichia_coli/tRNA-Arg-CCT.json

@@ -449,12 +449,6 @@
       "x": 84.16,
       "y": 29.06,
       "pos": 75
-    },
-    {
-      "base": "A",
-      "x": 84.16,
-      "y": 21.5,
-      "pos": 76
     }
   ],
   "width": 154.67,
@@ -463,4 +457,4 @@
   "trna_name": "tRNA-Arg-CCT",
   "sequence": "GUCCUCUUAGUUAAAUGGAUAUAACGAGCCCCUCCUAAGGGCUAAUUGCAGGUUCGAUUCCUGCAGGGGACACCA",
   "structure": "<<<<<<<..<<<<........>>>>.<<<<<.......>>>>>....<<<<<.......>>>>>>>>>>>>...."
-}
+}

inst/extdata/structures/Escherichia_coli/tRNA-Arg-TCT.json

@@ -461,12 +461,6 @@
       "x": 87.22,
       "y": 29.06,
       "pos": 77
-    },
-    {
-      "base": "A",
-      "x": 87.22,
-      "y": 21.5,
-      "pos": 78
     }
   ],
   "width": 157.73,
@@ -475,4 +469,4 @@
   "trna_name": "tRNA-Arg-TCT",
   "sequence": "GCGCCCUUAGCUCAGUUGGAUAGAGCAACGACCUUCUAAGUCGUGGGCCGCAGGUUCGAAUCCUGCAGGGCGCGCCA",
   "structure": "<<<<<<<..<<<<.........>>>>.<<<<<.......>>>>>.....<<<<<.......>>>>>>>>>>>>...."
-}
+}

inst/extdata/structures/Escherichia_coli/tRNA-Asn-GTT.json

@@ -455,12 +455,6 @@
       "x": 84.16,
       "y": 29.06,
       "pos": 76
-    },
-    {
-      "base": "A",
-      "x": 84.16,
-      "y": 21.5,
-      "pos": 77
     }
   ],
   "width": 154.67,
@@ -469,4 +463,4 @@
   "trna_name": "tRNA-Asn-GTT",
   "sequence": "UCCUCUGUAGUUCAGUCGGUAGAACGGCGGACUGUUAAUCCGUAUGUCACUGGUUCGAGUCCAGUCAGAGGAGCCA",
   "structure": "<<<<<<<..<<<<........>>>>.<<<<<.......>>>>>.....<<<<<.......>>>>>>>>>>>>...."
-}
+}

inst/extdata/structures/Escherichia_coli/tRNA-Asp-GTC.json

@@ -461,12 +461,6 @@
       "x": 87.22,
       "y": 29.06,
       "pos": 77
-    },
-    {
-      "base": "A",
-      "x": 87.22,
-      "y": 21.5,
-      "pos": 78
     }
   ],
   "width": 157.73,
@@ -475,4 +469,4 @@
   "trna_name": "tRNA-Asp-GTC",
   "sequence": "GGAGCGGUAGUUCAGUCGGUUAGAAUACCUGCCUGUCACGCAGGGGGUCGCGGGUUCGAGUCCCGUCCGUUCCGCCA",
   "structure": "<<<<<<<..<<<<.........>>>>.<<<<<.......>>>>>.....<<<<<.......>>>>>>>>>>>>...."
-}
+}

inst/extdata/structures/Escherichia_coli/tRNA-Cys-GCA.json

@@ -443,12 +443,6 @@
       "x": 82.21,
       "y": 29.06,
       "pos": 74
-    },
-    {
-      "base": "A",
-      "x": 82.21,
-      "y": 21.5,
-      "pos": 75
     }
   ],
   "width": 152.71,
@@ -457,4 +451,4 @@
   "trna_name": "tRNA-Cys-GCA",
   "sequence": "GGCGCGUUAACAAAGCGGUUAUGUAGCGGAUUGCAAAUCCGUCUAGUCCGGUUCGACUCCGGAACGCGCCUCCA",
   "structure": "<<<<<<<..<<<<.......>>>>.<<<<<.......>>>>>....<<<<<.......>>>>>>>>>>>>...."
-}
+}