errors when run the taxa_counts.r function

[imMMQ]

I have some trouble to run taxa_counts.r
here is the error message.

[1] "Started extracting barcode data from fastq files for T117"
Error in validObject(.Object) :
invalid class “SRFilterResult” object: superclass "Mnumeric" not defined in the environment of the object's class
Calls: [ ... SRFilterResult -> new -> initialize -> initialize -> validObject
Execution halted

I'm not sure if it's due to the format of the sequencing file. So the first a few lines of the fa file are listed below.

A00728:798:HGCG7DSX5:3:1663:21649:36511 kraken:taxid|9606
TTTCTTATATGGGGGCCTCTCTGCGCCTGCGCCGGCGCGGCGCCTTTGCGACGGCGGAGTTGCGTTCTCCTCAGCACAGACCCGGAGAGCACCGCGAGGGCGGAGCTGCGTTCTCCTCTGCACAG
A00728:798:HGCG7DSX5:3:1360:11306:28494 kraken:taxid|9606
TTTCTTATATGGGATTCCTGGGTTTAAAAGTAAAAAAATAAATATGTTTAATTTGTGAACTGATTACCATCAGAATTGTACTGTTCTGTATCCCACCAGCAATGTCTAGGAATGCCTGTTTCTCC
A00728:798:HGCG7DSX5:3:2662:6677:2315 kraken:taxid|9606
TTTCTTATATGGGATCACCAGCTGCTCCGTTCTACCATTTCTTCAGCCCTCTTGGCTGTGCCTGCGGCTCTGCCCCTCCCGTCTCTGCACCTACCACCCAGAGAGGGCTTGTTGAGCTCAGAGAT

For the same concern of the sequencing file, I tried another sample, listed here.

SRR20330330.1 1 length=150 kraken:taxid|9606
TNTGGAGGTATATGGACCGTTTTATCCATAATTATTTTTAATATATTTTTTTTTTTTTAAATTACAAATACATATTATTAAAATTTTTATAAAACAGTACACAGAAGCCAAATTTTTACACATAATATAATAACCTACCAACACATTTTA
SRR20330330.3 3 length=150 kraken:taxid|9606
GNCAGCCGTGAACCGATGGCTCTGATTCTAAAAAATAATAATATTTTTTTTTTTTTTTTGGGAGGCTGTGTGGGGGGGATCGGTTGCGCTCGGGAGTTTTAGCCCCCCCTGGGCACCATGGCAAAAACCCAACACAACAAAAAAAAAAAA
SRR20330330.4 4 length=150 kraken:taxid|9606
ANTTTCCAGATGAAGGTTTCCAAATTTGAATTTTATTATGTATATTTTTTTTTTTCTTTTAGACTGAGTCTTTCTCTGTTGCCCCGGCTGGAGTCTAGTTGCGTTGTCTCGGCTCACTCAAACCCCCACCCTCCACGTACAACTGATTCT

while I got error message again, but not the same one as the first try.

[1] "Started extracting barcode data from fastq files for CA_HPV"
Error in .Call2("XStringSet_letter_frequency", x, collapse, codes, baseOnly, :
long vectors not supported yet: memory.c:3782
Calls: [ ... .local -> .XStringSet.nucleotide_frequency -> .Call2
Execution halted

there is no sample taxa file. I'm not sure if the taxa file I used for --taxa is correct. So the first couple of lines are listed here, just in case.

<style> </style>

taxid.x	r	p	name	r1	r2	r3	p1	p2	p3	rank	CLrpmm	taxid.y	rpmm
27291	1	0	Saccharomyces paradoxus	0.8	0.6	0.8	0.33333333	0.41666667	0.33333333	S	939.562791	27291	6.67252069
28985	0.99998343	0	Kluyveromyces lactis	0.82857143	0.82857143	1	0.05833333	0.05833333	0.00277778	S	5744.24666	28985	218.858679
76775	0.8665019	1.02E-103	Malassezia restricta	0.57142857	0.89285714	0.53571429	0.2	0.01230159	0.23571429	S	14610.0636	76775	1698.82377

[CongjiaMa]

Dear Senior, may I ask your problem solving Lama? I am also learning this tool now. If it is convenient for you, could you please communicate with me via email (928508627@qq.com)? How did you resolve the error for q_df before running the final taxa.counts.r?

[imMMQ]

I tried a new taxa file with only names I wanted to extract. but I still got errors.
here is the taxa.tsv
taxa_test.tsv.txt

Here are the error massages. I tested 3 sequences of 3 patients, each of them coming from independent study. So the sequence formats look a little different. the fasta sequences of "CA_HPV" and "T117" after "Extract microbiome reads" step have been listed above. "PBMC" fasta has been listed as following, together with its error massage.

[1] "Started extracting barcode data from fastq files for CA_HPV"
Error in h(simpleError(msg, call)) :
error in evaluating the argument 'i' in selecting a method for function '[': long vectors not supported yet: memory.c:3887
Calls: [ ... .XStringSet.nucleotide_frequency -> .Call2 -> .handleSimpleError -> h
Execution halted

[1] "Started extracting barcode data from fastq files for T117"
Error in $<-.data.frame(*tmp*, umi, value = 1) :
replacement has 1 row, data has 0
Calls: $&lt;- -&gt; $&lt;-.data.frame
Execution halted

The following is "PBMC" sequences and its error massage.

A00228:279:HFWFVDMXX:1:1101:4110:1063 1:N:0:ACATTACT kraken:taxid|9606
TGGGCTGGTCGCGGTTCATGGACATTCG
A00228:279:HFWFVDMXX:1:1101:7509:1063 1:N:0:ACATTACT kraken:taxid|9606
CATGCTCGTCTCTCACACTTTTTGGCAA
A00228:279:HFWFVDMXX:1:1101:15845:1063 1:N:0:ACATTACT kraken:taxid|9606
CACTGGGAGTTACTCGTTTTCTGTGGTT

[1] "Started extracting barcode data from fastq files for PBMC"
Error in $<-.data.frame(*tmp*, umi, value = 1) :
replacement has 1 row, data has 0
Calls: $&lt;- -&gt; $&lt;-.data.frame
Execution halted

[CongjiaMa]

谢谢，已收到

[CongjiaMa]

The taxa_count.r has some bug and l have change the script .This is the script and wish your good luck. As for the errors i think you can try to exam the data you deal above , open the file and you may find some different ways.

…

------------------&nbsp;原始邮件&nbsp;------------------ 发件人: "sjdlabgroup/SAHMI" ***@***.***&gt;; 发送时间:&nbsp;2023年8月25日(星期五) 凌晨3:44 ***@***.***&gt;; ***@***.******@***.***&gt;; 主题:&nbsp;Re: [sjdlabgroup/SAHMI] errors when run the taxa_counts.r function (Issue #12) I tried a new taxa file with only names I wanted to extract. but I still got errors. here is the taxa.tsv taxa_test.tsv.txt Here are the error massages. I tested 3 sequences of 3 patients, each of them coming from independent study. So the sequence formats look a little different. the fasta sequences of "CA_HPV" and "T117" after "Extract microbiome reads" step have been listed above. "PBMC" fasta has been listed as following, together with its error massage. [1] "Started extracting barcode data from fastq files for CA_HPV" Error in h(simpleError(msg, call)) : error in evaluating the argument 'i' in selecting a method for function '[': long vectors not supported yet: memory.c:3887 Calls: [ ... .XStringSet.nucleotide_frequency -&gt; .Call2 -&gt; .handleSimpleError -&gt; h Execution halted [1] "Started extracting barcode data from fastq files for T117" Error in $<-.data.frame(*tmp*, umi, value = 1) : replacement has 1 row, data has 0 Calls: $&amp;lt;- -&amp;gt; $&amp;lt;-.data.frame Execution halted The following is "PBMC" sequences and its error massage. A00228:279:HFWFVDMXX:1:1101:4110:1063 1:N:0:ACATTACT kraken:taxid|9606 TGGGCTGGTCGCGGTTCATGGACATTCG A00228:279:HFWFVDMXX:1:1101:7509:1063 1:N:0:ACATTACT kraken:taxid|9606 CATGCTCGTCTCTCACACTTTTTGGCAA A00228:279:HFWFVDMXX:1:1101:15845:1063 1:N:0:ACATTACT kraken:taxid|9606 CACTGGGAGTTACTCGTTTTCTGTGGTT [1] "Started extracting barcode data from fastq files for PBMC" Error in $<-.data.frame(*tmp*, umi, value = 1) : replacement has 1 row, data has 0 Calls: $&amp;lt;- -&amp;gt; $&amp;lt;-.data.frame Execution halted — Reply to this email directly, view it on GitHub, or unsubscribe. You are receiving this because you commented.Message ID: ***@***.***&gt;

[tuqiang2014]

step 7. Quantitation of microbes and creating the barcode-metagenome counts matrix. What format does parameter taxa need and where can I download it? thanks~

[ejflomen]

The taxa_count.r has some bug and l have change the script .This is the script and wish your good luck.
As for the errors i think you can try to exam the data you deal above , open the file and you may find some different ways.
…

Is the taxa_counts.r script updated in the repo?

[CongjiaMa]

谢谢，已收到