Sassy: SIMD-accelerated Approximate String Matching

Sassy is a library and tool for searching short strings in texts, a problem that goes by many names:

• approximate string matching,
• pattern matching,
• fuzzy searching.

The motivating application is searching short (length 20 to 100) DNA sequences in a human genome or e.g. in a set of reads. Sassy generally works well for patterns/queries up to length 1000, and supports both ASCII and DNA.

Highlights:

• Sassy uses bitpacking and SIMD (both AVX and NEON supported). Its main novelty is tiling these in the text direction.
• Support for overhang alignments where the pattern extends beyond the text.
• Support for (case-insensitive) ASCII, DNA (ACGT), and IUPAC (=ACGT+NYR...) alphabets.
• Rust library (cargo add sassy), binary (cargo install sassy), Python bindings (pip install sassy-rs), and C bindings (see below).

See the paper below, and corresponding evals in evals/.

Rick Beeloo and Ragnar Groot Koerkamp.
Sassy: Searching Short DNA Strings in the 2020s.
bioRxiv, July 2025. https://doi.org/10.1101/2025.07.22.666207.

Usage

0. Rust library

A larger example can be found in src/lib.rs.

use sassy::{Searcher, Match, profiles::{Dna}, Strand};

let pattern = b"ATCG";
let text = b"AAAATTGAAA";
let k = 1;

let mut searcher = Searcher::<Dna>::new_fwd();
let matches = searcher.search(pattern, &text, k);

assert_eq!(matches.len(), 1);

assert_eq!(matches[0].text_start, 3);
assert_eq!(matches[0].text_end, 7);
assert_eq!(matches[0].cost, 1);
assert_eq!(matches[0].strand, Strand::Fwd);
assert_eq!(matches[0].cigar.to_string(), "2=1X1=");

1. Command-line interface (CLI)

Build and install using cargo:

cargo install sassy

Search a pattern ATGAGCA in text.fasta with ≤1 edit:

sassy search --pattern ATGAGCA --alphabet dna -k 1 text.fasta

or search all records of a fasta file with --pattern-fasta <fasta-file> instead of --pattern.

For the alphabets see supported alphabets

CRISPR off-target search for one or more guides in guides.txt:

sassy crispr --threads 8 --guide guides.txt --k 5 --max-n-frac 0.1 --output hits.tsv hg38.fasta

Allows <= k edits in the sgRNA, and the PAM (the last 3 characters of each guide) has to match exactly, unless --allow-pam-edits is given.

Output of the crispr command is a tab-delimited file with one row per hit, e.g.:

guide                    text_id  cost  strand  start     end       match_region             cigar
GAGTCCGAGCAGAAGAAGAANGG  chr21    5     +       5024135   5024154   GAGGCCACAGAGAAGAGGG      3=1X2=1D1=1D3=1D5=1D4=
GAGTCCGAGCAGAAGAAGAANGG  chr21    3     +       21087337  21087359  gagaccgaggagaagaaaaagg   3=1X5=1X7=1D5=
GAGTCCGAGCAGAAGAAGAANGG  chr21    3     -       9701297   9701320   GACTCGAGCATGAAGAAGAAAGG  2=1X1=1D6=1I12=
GAGTCCGAGCAGAAGAAGAANGG  chr21    5     -       46396975  46396998  CAGTCCCAGCAGACGACGGACGG  1X5=1X6=1X2=1X1=1X4=

The start and end are 0-based open-ended (i.e. 0-based inclusive of the start, but exclusive of the end), and start is always less then end (regardless of the strand). The match_region reported will be the sequence from the target file when strand is +, or the reverse complement of the sequence from the target file when strand is -, so that it matches the guide sequence. The cigar is always oriented to read left-to-right with the provided guide and match_region sequences.

Note that this searches for approximate occurrences of the guide sequence itself, and not for reverse-complement binding sites. If binding sites are to be found, please reverse-complement the input or output manually.

2. Python bindings

PyPI wheels can be installed with:

pip install sassy-rs 

import sassy

pattern = b"ACTG"
text    = b"ACGGCTACGCAGCATCATCAGCAT"

searcher = sassy.Searcher("dna") # ascii / dna / iupac
matches  = searcher.search(pattern, text, k=1)

for m in matches:
    print(m)

See python/README.md for more details.

3. C library

See c/README.md for details. Quick example:

#include "sassy.h"

int main() {
    const char* pattern = "ACTG";
    const char* text    = "ACGGCTACGCAGCATCATCAGCAT";

    // DNA alphabet, with reverse complement, without overhang.
    sassy_SearcherType* searcher = sassy_searcher("dna", true, NAN);
    sassy_Match* out_matches = NULL;
    size_t n_matches = search(searcher,
                              pattern, strlen(pattern),
                              text, strlen(text),
                              1, // k=1
                              &out_matches);

    sassy_matches_free(out_matches, n_matches);
    sassy_searcher_free(searcher);
}