Skip to content
This repository was archived by the owner on Sep 17, 2025. It is now read-only.

aomlomics/edna2obis-archive

Β 
Β 

Folders and files

NameName
Last commit message
Last commit date

Latest commit

Β 

History

73 Commits
Β 
Β 
Β 
Β 
Β 
Β 
Β 
Β 
Β 
Β 
Β 
Β 
Β 
Β 
Β 
Β 
Β 
Β 
Β 
Β 
Β 
Β 

Repository files navigation

ARCHIVE VERSION ONLY! Up to date repo at aomlomics/edna2obis

This repo was originally forked from an iOBIS Jupyter notebook Github repo, however code development has moved on to be completely different than the source material, so a fresh Github repo was created.

Introduction

DNA derived data are increasingly being used to document taxon occurrences. To ensure these data are useful to the broadest possible community, GBIF published a guide entitled "Publishing DNA-derived data through biodiversity data platforms." This guide is supported by the DNA derived data extension for Darwin Core, which incorporates MIxS terms into the Darwin Core standard.

This use case draws on both the guide and the extension to develop a workflow for incorporating a DNA derived data extension file into a Darwin Core archive.

The latest version of edna2obis (version 3) builds upon the original edna2obis, introducing new features:

  • Moved from a Jupyter Notebook to script architecture (runs in one command)
  • Specify parameters in the config.yaml, rather than in the code
  • Takes the new FAIRe NOAA eDNA data format as input, which is compatible for upload to the Ocean DNA Explorer
  • Users can choose to perform their taxonomic assignment via WoRMS or GBIF APIs
  • Improved taxonomic assignment accuracy and performance, with new caching methods
  • Users can specify which assays to NOT include species rank for taxonomic assignment (for example, Bacterial taxonomies often have the HOST organism as the species)
  • A new output file is created, taxa_assignment_INFO.csv, which gives information on how the taxonomies were assigned
  • Generates an HTML output report, edna2obis_report.html to document your run

Example data abstract:

Seawater was collected on board the NOAA ship Ronald H. Brown as part of the fourth Gulf of Mexico Ecosystems and Carbon Cycle (GOMECC-4) cruise from September 13 to October 21, 2021. Sampling for GOMECC-4 occurred along 16 coastal-offshore transects across the entire Gulf of Mexico and an additional line at 27N latitude in the Atlantic Ocean. We also collected eDNA samples near Padre Island National Seashore (U.S. National Parks Service), a barrier island located off the coast of south Texas. Vertical CTD sampling was employed at each site to measure discrete chemical, physical, and biological properties. Water sampling for DNA filtration was conducted at 54 sites and three depths per site (surface, deep chlorophyll maximum, and near bottom) to capture horizontal and vertical gradients of bacterial, protistan, and metazoan diversity across the Gulf. The resulting ASVs, their assigned taxonomy, and the metadata associated with theircollection are the input data for the OBIS conversion scripts presented here.

Published data

Input Data Format

Metadata: NOAA Omics FAIR eDNA-based metadata template

The FAIRe NOAA Google Sheet metadata template developed by NOAA Omics at AOML, and based off the FAIRe eDNA data standard. To use the sheet for your own data, run FAIRe2ODE, and it will generate the FAIRe NOAA templates in Google Sheets. Here is a filled-in example:

FAIRe_NOAA_noaa-aoml-gomecc4_SHARING

projectMetadata

Project wide (project_level) project metadata, and metadata unique to each assay

term_name project_level ssu16sv4v5-emp (1st assay) ssu18sv9-emp (2nd assay)
recordedBy Luke Thompson
recordedByID https://orcid.org/0000-0002-3911-1280
project_contact Luke Thompson
institution NOAA/AOML
institutionID https://www.aoml.noaa.gov/omics
project_name eDNA from Gulf of Mexico Ecosystems and Carbon Cruise 2021 (GOMECC-4)
project_id noaa-aoml-gomecc4
parent_project_id noaa-aoml-gomecc
study_factor water column spatial series
assay_type metabarcoding
sterilise_method After sampling, run ~1 L of 5% bleach through tubing lines, then rep...
checkls_ver FAIRe_checklist_v1.0.xlsx
mod_date 2024-10-31
license http://creativecommons.org/publicdomain/zero/1.0/legalcode
rightsHolder US Government
accessRights no rights reserved
assay_name ssu16sv4v5-emp ssu18sv9-emp
ampliconSize 411 260
code_repo https://github.com/aomlomics/gomecc
biological_rep 3

sampleMetadata

Contextual data about the samples collected. Each row is a distinct sample (Event)

samp_name materialSampleID geo_loc_name eventDate decimalLatitude decimalLongitude sampleSizeValue sampleSizeUnit env_broad_scale env_local_scale env_medium samp_collect_device samp_vol_we_dna_ext samp_mat_process size_frac
GOMECC4_27N_Sta1_Deep_A GOMECC4_27N_Sta1_Deep USA: Atlantic Ocean, east of Florida (27 N) 2021-09-14T11:00-04:00 26.997 -79.618 1920 mL marine biome [ENVO:00000447] marine mesopelagic zone [ENVO:00000213] sea water [ENVO:00002149] Niskin bottle on CTD rosette 1920 mL Pumped through Sterivex filter (0.22-Β΅m) using peristaltic pump 0.22 Β΅m
GOMECC4_27N_Sta1_Deep_B GOMECC4_PANAMACITY_Sta1_Deep USA: Atlantic Ocean, east of Florida (27 N) 2021-09-20T23:13-04:00 26.997 -79.618 1920 mL marine biome [ENVO:00000447] marine mesopelagic zone [ENVO:00000213] sea water [ENVO:00002149] Niskin bottle on CTD rosette 1920 mL Pumped through Sterivex filter (0.22-Β΅m) using peristaltic pump 0.22 Β΅m

experimentRunMetadata

Library preparation and sequencing details

samp_name assay_name pcr_plate_id lib_id seq_run_id mid_forward mid_reverse filename filename2 input_read_count
GOMECC4_NegativeControl_1 ssu16sv4v5-emp not applicable GOMECC16S_Neg1 20220613_Amplicon_PE250 TAGCAGCT CTGTGCCTA GOMECC16S_Neg1_S499_L001_R1_001.fastq.gz GOMECC16S_Neg1_S499_L001_R2_001.fastq.gz 29319
GOMECC4_NegativeControl_2 ssu16sv4v5-emp not applicable GOMECC16S_Neg2 20220613_Amplicon_PE250 TAGCAGCT CTAGGACTA GOMECC16S_Neg2_S500_L001_R1_001.fastq.gz GOMECC16S_Neg2_S500_L001_R2_001.fastq.gz 30829

analysisMetadata

Bioinformatic analysis configuration metadata. There is one analysisMetadata sheet PER analysis. Append the analysis_run_name to the filename, ex: analysisMetadata_gomecc4_16s_p1-2_v2024.10_241122.tsv

Field Value
project_id noaa-aoml-gomecc4
assay_name ssu16sv4v5-emp
analysis_run_name gomecc4_16s_p1-2_v2024.10_241122
sop_bioinformatics https://github.com/aomlomics/gomecc
trim_method cutadapt
trim_param qiime cutadapt trim-paired
demux_tool qiime2-2021.2; bcl2fastq v2.20.0
merge_tool qiime2-2021.2; DADA2 1.18
min_len_cutoff 200
otu_db Silva SSU Ref NR 99 v138.1; 515f-926r region; 10.5281/zenodo.8392695
otu_seq_comp_appr Tourmaline; qiime2-2021.2

Raw Data: ASV Taxonomies and Abundance Tables

You must have 2 raw data files associated with each analysis (analysisMetadata) in your submission. These files are generated by Tourmaline v2, AOML Omic's amplicon sequence processing workflow.

If your data was generated with Qiime2 or a previous version of Tourmaline, you can convert the table.qza, taxonomy.qza, and repseqs.qza outputs to the correct format using the create_asv_seq_taxa_obis.sh shell script.

Example:

#Run this with a qiime2 environment. 
bash create_asv_seq_taxa_obis.sh -f \
../gomecc_v2_raw/table-16S-merge.qza -t ../gomecc_v2_raw/taxonomy-16S-merge.qza -r ../gomecc_v2_raw/repseqs-16S-merge.qza \
-o ../gomecc_v2_raw/gomecc-16S-asv.tsv

Your ASV raw data files should look like this:

ASV Taxonomy Features:

featureid dna_sequence taxonomy verbatimIdentification kingdom phylum other_ranks... species Confidence
1ce3b5c6d... TACGA... Bacteria;Proteobacteria;Alphaproteoba... d__Bacteria;p__Proteoba... Bacteria Proteobacteria ... Clade_Ia 0.88
4e38e8ced... GCTACTAC... Eukaryota;Obazoa;Opisthokonta;Metazoa... Eukaryota;Obazoa;Opisthokonta;Metazoa... Eukaryota Obazoa ... Clausocalanus furcatus 0.999

NOTE: We understand taxonomy is complicated, so edna2obis is flexible and can receive any list of taxonomic ranks (as long as they are between columns verbatimIdentification and Confidence). For example, our 16S and 18S assay data use different taxonomic ranks, and even have a different number of taxonomic ranks. The code can account for this, and assigns taxonomies based on what ranks each API returns.

The verbatimIdentification strings may or may not have the prepending rank with underscores. The code will remove them during processing if they exist.

featureid is a hash of the DNA sequence, and they are unique identifiers.

Some field's values have been truncated (...) for readability in the documentation. Please include the complete data for each field in your input files.

ASV Abundance Tables:

featureid GOMECC4_BROWNSVILLE_Sta63_DCM_A GOMECC4_BROWNSVILLE_Sta63_DCM_B GOMECC4_CAMPECHE_Sta91_DCM_A
1ce3b5c6d... 0 32 2
4e38e8ced... 15 0 45

Each column name after featureid is a sample name, and must correspond with your sampleMetadata.

If your abundance tables have decimal numbers, that is okay too.

Current Repo Structure (v3.0)

edna2obis/
β”œβ”€β”€ README.md
β”œβ”€β”€ LICENSE
β”œβ”€β”€ environment.yml
β”œβ”€β”€ config.yaml   # EDIT THIS to set parameters for your run
β”œβ”€β”€ main.py
β”œβ”€β”€ .gitignore
β”œβ”€β”€ images/
β”œβ”€β”€ src-v3/
β”‚   β”œβ”€β”€ html_reporter.py
β”‚   β”œβ”€β”€ edna2obis_conversion_code.md
β”‚   β”œβ”€β”€ create_asv_seq_taxa_obis.sh
β”‚   β”œβ”€β”€ create_occurrence_core/
β”‚   β”‚   └── occurrence_builder.py   # Builds the Occurrence Core
β”‚   β”œβ”€β”€ create_dna_derived_extension/
β”‚   β”‚   └── extension_builder.py # Builds the DNA Derived Extension
β”‚   └── taxonomic_assignment/
β”‚       β”œβ”€β”€ taxa_assignment_manager.py
β”‚       β”œβ”€β”€ WoRMS_v3_matching.py    # Assigns taxonomy via WoRMS API
β”‚       └── GBIF_matching.py    # Assigns taxonomy via GBIF API
β”œβ”€β”€ raw-v3/
β”‚   β”œβ”€β”€ FAIRe_NOAA_checklist_v1.0.2.xlsx     # FAIRe NOAA data checklist
β”‚   β”œβ”€β”€ FAIRe_NOAA_noaa-aoml-gomecc4_SHARING.xlsx     # FAIRe NOAA metadata templates
β”‚   β”œβ”€β”€ asvTaxaFeatures_gomecc4_16s_p1-2_v2024.10_241122.tsv   # ASV Taxonomy Features, one per analysis
β”‚   β”œβ”€β”€ asvTaxaFeatures_gomecc4_16s_p3-6_v2024.10_241122.tsv
β”‚   β”œβ”€β”€ asvTaxaFeatures_gomecc4_18s_p1-6_v2024.10_241122.tsv
β”‚   β”œβ”€β”€ table_gomecc4_16s_p1-2_v2024.10_241122.tsv    # ASV abundance tables, one per analysis
β”‚   β”œβ”€β”€ table_gomecc4_16s_p3-6_v2024.10_241122.tsv
β”‚   β”œβ”€β”€ table_gomecc4_18s_p1-6_v2024.10_241122.tsv
β”‚   └── pr2_version_5.0.0_taxonomy.xlsx   # Optional example of a local taxonomy database
└── processed-v3/
    β”œβ”€β”€ dna_derived_extension.zip
    β”œβ”€β”€ edna2obis_report.html    # Detailed report of your edna2obis run
    β”œβ”€β”€ gbif_matches.pkl
    β”œβ”€β”€ occurrence_gbif_matched.zip
    β”œβ”€β”€ occurrence_worms_matched.zip
    └── taxa_assignment_INFO.csv    # Extra information on how taxonomic assignment was performed

πŸš€ Setup and Installation

Prerequisites

  • Conda or Anaconda installed
  • Git installed
  • At least 8GB RAM recommended
  • Internet connection required (for API calls to WoRMS/GBIF)

Quick Start

1. Clone the Repository

git clone https://github.com/aomlomics/edna2obis.git
cd edna2obis

2. Create Conda Environment

# Create the environment from the environment.yml file
conda env create -f environment.yml

# Activate the environment
conda activate edna2obis

3. Configure Your Data

Edit the config.yaml file with your data filepaths and other parameters

Key settings to update:

  • excel_file: Path to your FAIRe NOAA Excel file (data template)
  • datafiles: Paths to your ASV taxonomy and occurrence files
  • taxonomic_api_source: Choose "WoRMS" or "GBIF"
  • output_dir: Where to save results (default: "processed-v3/")

4. Run the Pipeline

python main.py

The pipeline will:

  • Load and clean your metadata (according to OBIS/GBIF)
  • Align data to Darwin Core data standard
  • Generate an Occurrence Core
  • Perform taxonomic assignment via WoRMS or GBIF APIs
  • Generate a DNA Derived Extension
  • Create an HTML report with results from your run

Output Files

The pipeline generates several files in your output directory:

  • occurrence_worms_matched.csv / occurrence_gbif_matched.csv - Final Occurrence Core with assigned taxonomies
  • taxa_assignment_INFO.csv_WoRMS / taxa_assignment_INFO_GBIF.csv - Summary of HOW taxonomies were assigned
  • dna_derived_extension.csv - DNA-Derived data extension
  • edna2obis_report.html - HTML output report

Occurrence Core (GBIF example)

occurrenceID eventID verbatimIdentification kingdom phylum class order family genus scientificName taxonRank organismQuantity organismQuantityType recordedBy materialSampleID eventDate locality decimalLatitude decimalLongitude basisOfRecord nameAccordingTo
GU190706-CTD11-220_MiFish_S30_occ_18109634cc2f8e156e5402bf13cf4502 GU190706-CTD11-220_MiFish_S30 Eukaryota;Chordata;Actinopteri;Beloniformes;Exocoetidae;Cheilopogon Animalia Chordata Beloniformes Exocoetidae Cheilopogon Cheilopogon Lowe, 1841 genus 4 DNA sequence reads Lynsey Wilcox Talbot | Katherine Silliman GU190706-CTD11-220 2019-07-06 00:00:00 USA: Gulf of Mexico -85.793 28.662 MaterialSample GBIF
GU190706-CTD11-220_MiFish_S30_occ_183bc18f3e5eac45c6dd248fb86d64bf GU190706-CTD11-220_MiFish_S30 Eukaryota;Chordata;Actinopteri;Tetraodontiformes;Tetraodontidae;Lagocephalus;Lagocephalus laevigatus Animalia Chordata Tetraodontiformes Tetraodontidae Lagocephalus Lagocephalus laevigatus (Linnaeus, 1766) species 5317 DNA sequence reads Lynsey Wilcox Talbot | Katherine Silliman GU190706-CTD11-220 2019-07-06 00:00:00 USA: Gulf of Mexico -85.793 28.662 MaterialSample GBIF

DNA Derived Extension

eventID source_mat_id samp_name env_broad_scale env_local_scale env_medium samp_vol_we_dna_ext samp_collect_device samp_mat_process size_frac concentration lib_layout seq_meth nucl_acid_ext target_gene target_subfragment pcr_primer_forward pcr_primer_reverse pcr_primer_name_forward pcr_primer_name_reverse pcr_primer_reference pcr_cond nucl_acid_amp ampliconSize otu_seq_comp_appr otu_db occurrenceID DNA_sequence concentrationUnit otu_class_appr
GU190706-CTD11-220_MiFish_S30 GU190706-CTD11-220 GU190706-CTD11-220 marine biome [ENVO:00000447] marine mesopelagic zone [ENVO:00000213] sea water [ENVO:00002149] 2 Niskin bottle Samples were vacuum-filtered through a MilliporeSigma 47 mm diameter mixed cellulose ester (MCE) filter with... 0.45 1.57 paired end Illumina MiSeq [OBI_0002003] https://doi.org/10.1002/edn3.70074 12S rRNA (SSU mitochondria) V5-V6 GTCGGTAAAACTCGTGCCAGC CATAGTGGGGTATCTAATCCCAGTTTGT MiFish-U-F MiFish-U-R2 https://doi.org/10.1098/rsos.150088 initial denaturation:98_30s; 40 cycles of denaturation: 98_20s, annealing:60_20s, elongation:72_20s; final elongation:72_5min not applicable 175 qiime2-2023.5; naive-bayes classifier; scikit-learn 0.24.1 custom GU190706-CTD11-220_MiFish_S30_occ_18109634cc2f8e156e5402bf13cf4502 CACCGCGGTTATACGAGAGGCCTAAGTTGACAGACAACGGCGTAAAGAGTGGTTAAGGAAAAATTTATACTAAAGCCGAACATCCTCAAGACTGTCGTACGTTTCCGAGGATATGAAGTCCCCCTACGAAAGTGGCTTTAACTCCCCTGACCCCACGAAAGCTGTGAC ng/Β΅l qiime2-2023.5; DADA2 1.26.0
GU190706-CTD11-220_MiFish_S30 GU190706-CTD11-220 GU190706-CTD11-220 marine biome [ENVO:00000447] marine mesopelagic zone [ENVO:00000213] sea water [ENVO:00002149] 2 Niskin bottle Samples were vacuum-filtered through a MilliporeSigma 47 mm diameter mixed cellulose ester (MCE) filter with... 0.45 1.57 paired end Illumina MiSeq [OBI_0002003] https://doi.org/10.1002/edn3.70074 12S rRNA (SSU mitochondria) V5-V6 GTCGGTAAAACTCGTGCCAGC CATAGTGGGGTATCTAATCCCAGTTTGT MiFish-U-F MiFish-U-R2 https://doi.org/10.1098/rsos.150088 initial denaturation:98_30s; 40 cycles of denaturation: 98_20s, annealing:60_20s, elongation:72_20s; final elongation:72_5min not applicable 175 qiime2-2023.5; naive-bayes classifier; scikit-learn 0.24.1 custom GU190706-CTD11-220_MiFish_S30_occ_183bc18f3e5eac45c6dd248fb86d64bf CACCGCGGTTATACGATGAAGCCCAAGTTGTTAGCCTTCGGCGTAAAGAGTGGTTAGAGTACCCCAACAAAACTAAGGCCGAACACCTTCAGGGCAGTCATACGCTTTCGAAGGCATGAAGCACACCAACGAAAGTAGCCTTACCAGACTTGAACCCACGAAAGCTAAGAT ng/Β΅l qiime2-2023.5; DADA2 1.26.0

taxa_assignment_INFO (GBIF example)

This file displays all potential taxonomic assignments for each unique taxonomy. If a taxonomic assignment appears incorrect in your Occurrence Core, you can refer to this file to explore alternative assignments.

verbatimIdentification cleanedTaxonomy selected_match scientificName confidence taxonRank taxonID kingdom phylum class order family genus match_type_debug nameAccordingTo
Bacteria Bacteria True Bacteria 97 kingdom gbif:3 Bacteria GBIF_EXACT GBIF
Eukaryota;Chordata;Actinopteri Eukaryota;Chordata;Actinopteri True Chordata 97 phylum gbif:44 Animalia Chordata GBIF_EXACT GBIF

eMoF (extendedMeasurementOrFact)

The eMoF file captures event-level measurements linked to each eventID that made it into the final occurrence file. In this workflow, eMoF rows are event-linked only (for now), so occurrenceID is intentionally left blank.

  • What it contains: One row per event per configured measurement.
  • Where it comes from: Measurement values are sourced from sampleMetadata first, otherwise experimentRunMetadata.
  • Units:
    • If the eMoF template specifies a literal unit (e.g., m, Β°C), that unit is used for every emitted row of that measurementType.
    • If the template says provided, a column named <measurementType>_unit must be present in the chosen source sheet and must be non-blank for all emitted rows.
    • If the template leaves the unit blank, output unit is blank (no auto-fallback).
  • Template: Configure measurements in raw-v3/eMoF Fields edna2obis .xlsx on the input_file sheet. Required columns: measurementType, measurementValue, measurementUnit, measurementTypeID, measurementValueID, measurementUnitID, measurementRemarks.
  • Output: Written to processed-v3/eMoF.xlsx.

eMoF Preview (example)

Below is a small, illustrative preview of the eMoF structure. Your actual content will depend on your eMoF template and metadata.

eventID occurrenceID measurementType measurementValue measurementUnit measurementTypeID measurementValueID measurementUnitID measurementRemarks
GOMECC4_27N_Sta1_Deep temperature 24.1 Β°C from CTD profile
GOMECC4_27N_Sta1_Deep salinity 36.2 PSU from CTD profile
GOMECC4_27N_Sta1_DCM chlorophyll 0.64 mg/mΒ³ fluorometric estimate

Troubleshooting

Common Issues

  1. Environment creation fails

    # Try updating conda first
    conda update conda
    conda env create -f environment.yml
  2. API timeout errors

    • Reduce worms_n_proc or gbif_n_proc in config.yaml
  3. Missing data files

    • Verify all file paths in config.yaml are correct
    • Use absolute paths if relative paths don't work

Getting Help

  • Check the HTML report for detailed error messages
  • Review the terminal output for specific error details
  • Ensure your input data follows the FAIRe NOAA format

Recommended System Requirements

  • Processing: 8GB+ RAM, 4+ CPU cores
  • Storage: ~1GB free space for large datasets
  • Network: Stable internet for API calls

Disclaimer

This repository is a scientific product and is not official communication of the National Oceanic and Atmospheric Administration, or the United States Department of Commerce. All NOAA GitHub project code is provided on an 'as is' basis and the user assumes responsibility for its use. Any claims against the Department of Commerce or Department of Commerce bureaus stemming from the use of this GitHub project will be governed by all applicable Federal law. Any reference to specific commercial products, processes, or services by service mark, trademark, manufacturer, or otherwise, does not constitute or imply their endorsement, recommendation or favoring by the Department of Commerce. The Department of Commerce seal and logo, or the seal and logo of a DOC bureau, shall not be used in any manner to imply endorsement of any commercial product or activity by DOC or the United States Government.

About

Code to convert eDNA metabarcoding data to Darwin Core for OBIS

Topics

Resources

License

Stars

Watchers

Forks

Packages

 
 
 

Contributors

Languages

  • Python 71.9%
  • HTML 27.7%
  • Shell 0.4%