Skip to content

MUC1 Update #202

New issue

Have a question about this project? Sign up for a free GitHub account to open an issue and contact its maintainers and the community.

Sign up for GitHub

By clicking “Sign up for GitHub”, you agree to our terms of service and privacy statement. We’ll occasionally send you account related emails.

Already on GitHub? Sign in to your account

Merged
hdashnow merged 4 commits into from
Jun 26, 2025
Merged

MUC1 Update #202

Changes from all commits
Commits
Show all changes
4 commits
Select commit Hold shift + click to select a range
5702b4a
Update STRchive-loci.json
Macayla-weiner Jun 19, 2025
b1290c2
MUC1 pathogenic update
Macayla-weiner Jun 20, 2025
2a8d59d
motif update
Macayla-weiner Jun 22, 2025
4c0abe2
MUC1-4.json
Macayla-weiner Jun 25, 2025
File filter

Filter by extension

Filter by extension
Conversations
Failed to load comments.
Loading
Jump to
Jump to file
Failed to load files.
Loading
Diff view
Diff view
12 changes: 6 additions & 6 deletions data/STRchive-loci.json
View file
Open in desktop
Original file line number Diff line number Diff line change
Expand Up @@ -2507,16 +2507,16 @@
"disease_id": "ADTKD",
"gene_strand": "+",
"reference_motif_reference_orientation": ["GGCTNNGGGNGCGGTGGAGCCCGGGGCNGGNCTGNTNTCCGGGGCCGAGGTGACANCNTG"],
"pathogenic_motif_reference_orientation": ["GGCTNNGGGGNGCGGTGGAGCCCGGGGCNGGNCTGNTNTCCGGGGCCGAGGTGACANCNTG"],
"pathogenic_motif_gene_orientation": ["ACANCNTGGGCTNNGGGGNGCGGTGGAGCCCGGGGCNGGNCTGNTNTCCGGGGCCGAGGTG"],
"benign_motif_reference_orientation": [],
"benign_motif_gene_orientation": [],
"pathogenic_motif_reference_orientation": ["GCCCACGGTGTCACCTCGGCCCCGGACACCAGGCCGGCCCCGGGCTCCACCGCCCCCCCCA"],
"pathogenic_motif_gene_orientation": ["GCCCACGGTGTCACCTCGGCCCCGGACACCAGGCCGGCCCCGGGCTCCACCGCCCCCCCCA"],
"benign_motif_reference_orientation": ["GCCCACGGTGTCACCTCGGCCCCGGACACCAGGCCGGCCCCGGGCTCCACCGCCCCCCCA"],
"benign_motif_gene_orientation": ["GCCCACGGTGTCACCTCGGCCCCGGACACCAGGCCGGCCCCGGGCTCCACCGCCCCCCCA"],
"unknown_motif_reference_orientation": [],
"unknown_motif_gene_orientation": [],
"disease": "Autosomal dominant tubulointerstitial kidney disease",
"gene": "MUC1",
"flank_motif": null,
"locus_structure": "(GGCTNNGGGNGCGGTGGAGCCCGGGGCNGGNCTGNTNTCCGGGGCCGAGGTGACANCNTG)n",
"locus_structure": null,
"inheritance": ["AD"],
"type": "Coding",
"location_in_gene": "Exon 2",
Expand All @@ -2537,7 +2537,7 @@
"mechanism": "GoF",
"mechanism_detail": "Toxic protein product accumulates in kidneys [@genereviews:NBK153723]",
"source": [],
"details": "Disease is caused by the single base expansion of a heptanucleotide (7) cytosine homopolymer tract within one copy of a coding VNTR, resulting in a frameshift mutation. This VNTR has a 60 bp motif which ranges in copy number from 20-125 (~1.5-5 kb) and is GC-rich (>80%). The specific copy of the VNTR motif involved varies by family but is consistent within a family [@genereviews:NBK535148]. This locus is particularly difficult to genotype [@pmid:23396133; @pmid:39781475].",
"details": "Disease is caused by the single base expansion of a heptanucleotide (7) cytosine homopolymer tract within one copy of a coding VNTR, resulting in a frameshift mutation. This VNTR has a 60 bp motif, varying in length and sequence composition. This motif ranges in copy number from 20-125 (~1.5-5 kb) and is GC-rich (>80%). The specific copy of the VNTR motif involved varies by family but is consistent within a family [@genereviews:NBK535148]. This locus is particularly difficult to genotype [@pmid:23396133; @pmid:39781475]. Gamaarachchi et al. observed 20 unique VNTR haplotypes which ranged in size from 40–83 copies, with no unrelated individuals sharing the same haplotype. Unique haplotypes implied frequent independent origins of the dupC variant [@doi:10.1101/2025.03.31.646505].",
"omim": ["174000"],
"prevalence": "2.5/1000000",
"prevalence_details": "Disease is affected 1-4/1,000,000 (likely an underestimate due to unremarkable findings); repeat expansion responsibile for 95% of disease [@genereviews:NBK153723]",
Expand Down
Loading