🧬 PrimerLab Genomic

A modular bioinformatics framework for automated primer and probe design, built with clean architecture and reproducible workflows.

🔰 Latest Release: v1.0.0 - Stable Release 🎉

---

📋 Overview

PrimerLab Genomic is a Python-based toolkit for automated primer and probe design in molecular biology workflows. It provides a structured and reproducible framework for:

• PCR — Standard primer design with quality control
• qPCR — Probe design with thermodynamic checks
• Off-target Check — BLAST-based specificity analysis
• In-silico PCR — Virtual PCR simulation and validation

PrimerLab focuses on deterministic, transparent bioinformatics, following strict modularity and best practices.

🔑 Key Features

• End-to-End Workflow: Sequence input → Primer/Probe design → QC → Report
• Thermodynamic Validation: Secondary structure prediction via ViennaRNA
• QC Framework: Hairpins, dimers, GC%, Tm ranges, amplicon checks
• qPCR Support: TaqMan-style probe design with efficiency estimation
• Safe Execution: Timeout protection for complex sequences
• Structured Output: JSON + Markdown + HTML reports with interpretable metrics

📦 Feature Highlights

Category	Features
Primer Design	PCR, qPCR, Nested PCR, Semi-Nested PCR
Analysis	BLAST off-target, In-silico PCR, Dimer matrix
qPCR Tools	TaqMan probe design, Melt curve, Efficiency calc
Quality Control	Hairpin, Homodimer, Heterodimer, Tm balance
Species Check	Cross-reactivity, Multi-species comparison
Batch Processing	Parallel processing, SQLite caching, CSV export
Visualization	Coverage maps, Melt curves, Dimer heatmaps
Export	JSON, Markdown, HTML, Excel, IDT plate format

📚 Documentation

Resource	Link
Getting Started	Installation & Quick Start
CLI Reference	Command Reference
API Reference	Python API
Tutorials	Step-by-Step Guides
Changelog	Version History

---

🚀 Quick Start

Installation

Option 1: PyPI (Recommended)

pip install primerlab-genomic

Option 2: Docker (No setup required)

# Pull and run
docker pull ghcr.io/engkinandatama/primerlab-genomic:1.0.0
docker run ghcr.io/engkinandatama/primerlab-genomic:1.0.0 --version

# Run with your config
docker run -v $(pwd):/data ghcr.io/engkinandatama/primerlab-genomic:1.0.0 run pcr --config /data/config.yaml

Option 3: From Source (For Development)

git clone https://github.com/engkinandatama/primerlab-genomic.git
cd primerlab-genomic
pip install -e .

Optional: ViennaRNA (for Secondary Structure)

# Via pip (recommended)
pip install viennarna

# Via Conda
conda install -c bioconda viennarna

Without ViennaRNA, PrimerLab uses a fallback estimation method.

Once installed, verify the installation:

primerlab --version

---

🔧 Usage

Command-Line Interface (CLI)

PCR Workflow:

primerlab run pcr --config test_pcr.yaml

qPCR Workflow:

primerlab run qpcr --config test_qpcr.yaml

Sequence Stats (v0.1.6):

# Check sequence before design
primerlab stats input.fasta

# JSON output for pipelines
primerlab stats input.fasta --json

Quiet Mode (v0.1.6):

# Suppress warnings for scripted pipelines
primerlab run pcr --config test_pcr.yaml --quiet

In-silico PCR Simulation (v0.2.0):

# Validate primers against template
primerlab insilico -p primers.json -t template.fasta

# With custom output directory
primerlab insilico -p primers.json -t template.fasta -o results/

# JSON output for pipelines
primerlab insilico -p primers.json -t template.fasta --json

Example primers.json:

{
  "forward": "ATGGTGAGCAAGGGCGAGGAG",
  "reverse": "TTACTTGTACAGCTCGTCCATGCC"
}

Primer Compatibility Check (v0.4.0):

# Check if multiple primer pairs can work together
primerlab check-compat --primers primer_set.json

# With custom output directory
primerlab check-compat --primers primer_set.json --output results/

# Integrated with PCR design (auto-check after design)
primerlab run pcr --config design.yaml --check-compat

Example primer_set.json:

[
  {"name": "GAPDH", "fwd": "ATGGGGAAGGTGAAGGTCGG", "rev": "GGATCTCGCTCCTGGAAGATG", "tm": 60.0},
  {"name": "ACTB", "fwd": "CATGTACGTTGCTATCCAGGC", "rev": "CTCCTTAATGTCACGCACGAT", "tm": 59.0}
]

qPCR Analysis Commands (v0.6.0):

# Check TaqMan probe binding
primerlab probe-check --probe ATGCGATCGATCGATCGATCG

# Predict SYBR melt curve
primerlab melt-curve --amplicon ATGCGATCGATCGATCGATCGATCGATCGATCG --format svg

# Validate qPCR amplicon quality
primerlab amplicon-qc --amplicon ATGCGATCGATCGATCGATCGATCGATCGATCG

# Generate melt plot during workflow (v0.6.1)
primerlab run qpcr --config design.yaml --plot-melt --plot-format png

PCR Variants (v0.7.0):

# Design Nested PCR primers
primerlab nested-design --sequence "ATGC..." --outer-size 400-600 --inner-size 150-250

# Design Semi-Nested PCR (shared forward primer)
primerlab seminested-design --sequence "ATGC..." --shared forward

Analysis Tools (v0.7.1):

# Analyze primer dimer matrix
primerlab dimer-matrix --primers primers.json --format svg

# Compare batch design runs
primerlab compare-batch result1.json result2.json --format markdown

Visualization (v0.7.2):

# Generate coverage map
primerlab coverage-map --result result.json --format svg

qPCR Efficiency (v0.7.4):

# Calculate efficiency from standard curve
primerlab qpcr-efficiency calculate --data curve.json

# Predict primer efficiency
primerlab qpcr-efficiency predict --forward "ATGCATGC..." --reverse "GCATGCAT..."

Programmatic API (Python)

For integration into your own Python scripts:

from primerlab.api.public import design_pcr_primers, design_qpcr_assays

# PCR primer design
sequence = "ATGAGTAAAGGAGAAGAACTTTTCACTGGAGT..."
result = design_pcr_primers(sequence)

print(f"Forward: {result.primers['forward'].sequence}")
print(f"Reverse: {result.primers['reverse'].sequence}")
print(f"Amplicon: {result.amplicons[0].length} bp")

# qPCR assay design (with custom parameters)
config = {
    "parameters": {
        "product_size_range": [[70, 200]],
        "probe": {"tm": {"min": 68.0, "opt": 70.0, "max": 72.0}}
    }
}
result = design_qpcr_assays(sequence, config)

print(f"Probe: {result.primers['probe'].sequence}")
print(f"Efficiency: {result.efficiency}%")

---

📖 Documentation

Full documentation is available in the docs/ directory:

Section	Description
Getting Started	Installation and first steps
CLI Reference	All 25+ commands
Configuration	YAML config reference
Presets	Pre-configured parameter sets
API Reference	Programmatic interface
Features	Advanced features
Troubleshooting	Common issues and solutions

Additional Resources:

• CHANGELOG — Version history
• STRUCTURE — Project architecture
• RELEASE_NOTES — Latest release highlights

---

🧪 Example Configurations

PCR Configuration

workflow: pcr

input:
  sequence: "ATGAGTAAAGGAGAAGAACTTTTCACTGGAGT..."  # Or use sequence_path: "input.fasta"

parameters:
  primer_size: {min: 18, opt: 20, max: 24}
  tm: {min: 58.0, opt: 60.0, max: 62.0}
  product_size: {min: 200, opt: 400, max: 600}  # v0.1.1: Simplified syntax

output:
  directory: "output_pcr"

qPCR Configuration (TaqMan - Default)

workflow: qpcr
# mode: taqman (default - includes probe design)

input:
  sequence: "ATGGGGAAGGTGAAGGTCGGAGT..."

parameters:
  primer_size: {min: 18, opt: 20, max: 24}
  tm: {min: 55.0, opt: 60.0, max: 65.0}
  
  probe:
    size: {min: 18, opt: 24, max: 30}
    tm: {min: 68.0, opt: 70.0, max: 72.0}

output:
  directory: "output_qpcr"

qPCR Configuration (SYBR Green)

workflow: qpcr

parameters:
  mode: sybr  # v0.1.1: Disables probe design automatically
  
  primer_size: {min: 18, opt: 20, max: 24}
  tm: {min: 58.0, opt: 60.0, max: 62.0}
  product_size: {min: 70, opt: 100, max: 150}

output:
  directory: "output_qpcr_sybr"

---

📊 Output Overview

PrimerLab generates a structured report containing:

• Primer & Probe Details — Sequences, GC%, Tm, positions
• qPCR Metrics — Estimated amplification efficiency
• Amplicon Properties — Length, GC%, suitability
• QC Checks — Dimers, hairpins, Tm balance
• Warnings — Optimization suggestions

Run a workflow to generate your own report!

---

🏗️ Project Structure

primerlab-genomic/
├── primerlab/
│   ├── cli/              # Command-line interface
│   ├── core/             # Reusable utilities
│   │   ├── insilico/     # In-silico PCR simulation (v0.2.0)
│   │   └── tools/        # Primer3, ViennaRNA wrappers
│   ├── workflows/        # Workflow modules
│   │   ├── pcr/          # PCR workflow
│   │   └── qpcr/         # qPCR workflow
│   ├── api/              # Public API
│   └── config/           # Default configurations
├── tests/                # 1286 automated tests
├── docs/                 # User documentation
├── examples/             # Example files
│   └── insilico/         # In-silico PCR examples
└── .dev/                 # Internal dev docs

---

📌 Development Status

✅ v1.0.0 (Current)

• Performance Optimization (core/cache.py):
  • LRU caching for Tm, GC, and ΔG calculations
  • 2-5x speedup for repeated computations
• Model Standardization (v0.8.2):
  • to_dict() methods for 10+ dataclasses
  • Comprehensive STRUCTURE.md documentation
• Code Quality Foundation (v0.8.0):
  • Type hints infrastructure (mypy config)
  • Exception testing (20+ tests)
  • Flake8 fixes (8,600+ fixes)
• 1286 Tests - Comprehensive test coverage

v0.7.x Features (PCR Variants & qPCR Advanced)

• Nested PCR Design (core/variants/nested.py)
• Semi-Nested PCR (core/variants/seminested.py)
• Dimer Matrix Analysis (core/analysis/dimer_matrix.py)
• Batch Comparison (core/analysis/batch_compare.py)
• Coverage Map (core/visualization/coverage_map.py)
• qPCR Efficiency (core/qpcr/efficiency.py)
• Advanced qPCR (core/qpcr/advanced.py): HRM, dPCR, quencher recommendations

v0.6.x Features (Genotyping & Visualization)

• Allele Discrimination (core/genotyping/)
• RT-qPCR Validation (core/rtpcr/)
• Melt Curve Visualization
• CLI Commands: probe-check, melt-curve, amplicon-qc

v0.5.0 Features

• Probe Binding Simulation (TaqMan Tm calculation)
• qPCR Amplicon Validation (Length/GC/structure)
• SYBR Melt Curve Prediction

v0.4.x Features

• Primer Compatibility Check (v0.4.0)
• Amplicon Analysis (v0.4.1)
• Species Specificity (v0.4.2)
• Tm Gradient Simulation (v0.4.3)

Earlier Versions

• v0.6.x: Allele discrimination, RT-qPCR, melt curve visualization
• v0.3.x: BLAST off-target, reporting, Tm correction
• v0.2.x: In-silico PCR simulation
• v0.1.x: Core design, stats, batch processing

🛠️ Requirements

• Python 3.10+
• Primer3 (primer3-py)
• ViennaRNA for secondary structure prediction
• WSL recommended for Windows users

---

🤝 Contributing

We welcome contributions! Please read our guidelines first:

📄 CONTRIBUTING.md — How to contribute, coding standards, PR checklist

Key principles:

• No cross-layer imports
• Deterministic, reproducible outputs
• All features need tests

---

📄 License

This project is licensed under the GNU General Public License v2.0 (GPL-2.0). See the LICENSE file for details.

Note on Dependencies: This project depends on primer3-py which is licensed under GPL-2.0. As such, PrimerLab Genomic adopts the compatible GPL-2.0 license to ensure compliance and freedom for end users.

© 2025–present — Engki Nandatama

---

🙏 Acknowledgments

• Primer3 — Primary primer design engine
• ViennaRNA — Thermodynamic folding & secondary structure analysis

---

📬 Contact

For issues, suggestions, or contributions:

➡️ Open an issue on GitHub