Skip to content

tm-gradient.md

Latest commit

 

History

History
128 lines (94 loc) · 3.07 KB

tm-gradient.md

File metadata and controls

128 lines (94 loc) · 3.07 KB

title: "primerlab tm-gradient" description: "CLI reference for the primerlab tm-gradient command"

Simulate temperature gradients to find optimal annealing temperatures.

Synopsis

primerlab tm-gradient --primers FILE [OPTIONS]

Description

The tm-gradient command simulates primer binding efficiency across a temperature range using nearest-neighbor thermodynamics. It predicts the optimal annealing temperature for your primer set.

Arguments

Argument Required Description
--primers, -p Yes Path to primers JSON file
--template, -t No Optional template FASTA for context
--min-temp No Minimum temperature °C (default: 50.0)
--max-temp No Maximum temperature °C (default: 72.0)
--step No Temperature step °C (default: 0.5)
--output, -o No Output directory (default: tm_gradient_output)
--format No Report format: json, markdown, csv (default: json)

Examples

Basic Usage

primerlab tm-gradient --primers primers.json

Custom Temperature Range

primerlab tm-gradient \
  --primers primers.json \
  --min-temp 55 \
  --max-temp 68 \
  --step 0.5

Markdown Report

primerlab tm-gradient \
  --primers primers.json \
  --output results/ \
  --format markdown

CSV Export

primerlab tm-gradient \
  --primers primers.json \
  --format csv

Input Format

primers.json

[
  {"name": "Gene1", "forward": "ATGCGATCGATCGATCGATCG", "reverse": "CGATCGATCGATCGATCGCAT"},
  {"name": "Gene2", "forward": "GCGCGCGCGCGCGCGCGCGC", "reverse": "ATATATATATATATATATATAT"}
]

Output

Console Output

🌡️ Tm Gradient Simulation (v0.4.3)
==================================================
📂 Loading primers: primers.json
🔬 Temperature range: 50.0°C - 72.0°C (step 0.5°C)

⏳ Simulating Tm gradient for 4 primers...

==================================================
🎯 Optimal Annealing Temperature: 58.5°C
   Recommended Range: 55.0°C - 62.0°C

📊 Per-Primer Results:
   Gene1_fwd: Tm=62.3°C, Optimal=57.3°C (Grade A)
   Gene1_rev: Tm=60.8°C, Optimal=55.8°C (Grade A)
   Gene2_fwd: Tm=68.5°C, Optimal=63.5°C (Grade B)
   Gene2_rev: Tm=52.1°C, Optimal=47.1°C (Grade C)

📁 Reports saved to: tm_gradient_output
   • tm_gradient.json

Report Files

  • tm_gradient.json - Full JSON data with efficiency curves
  • tm_gradient_report.md - Markdown summary
  • tm_gradient.csv - CSV data for analysis

Thermodynamic Model

Uses Santa Lucia (1998) nearest-neighbor parameters:

  • ΔH and ΔS for each dinucleotide pair
  • Salt correction for Na+ concentration
  • Two-state binding model

Grading

Grade Score Interpretation
A ≥90 Wide temperature tolerance
B 80-89 Good stability
C 70-79 Moderate sensitivity
D 60-69 Narrow window
F <60 Redesign recommended

See Also