Use all tests by lldelisle · Pull Request #664 · galaxyproject/iwc

lldelisle · 2025-02-06T11:11:24Z

I found 4 files 'tests' that were not cited in any dockstore:

for f in $(find . -name "*test*yml"); do n=$(grep -nr $(basename $f) workflows | wc -l); if [ $n = "0" ]; then echo $f; fi; done

I tried to solve all of them. I would like that authors of the workflow validate this PR:

… exists

github-actions · 2025-02-06T11:39:54Z

Test Results (powered by Planemo)

Test Summary

Test State	Count
Total	4
Passed	1
Error	3
Failure	0
Skipped	0

Errored Tests

❌ RepeatMasking-Workflow.ga_0

Execution Problem:

Unexpected HTTP status code: 400: {"err_msg":"Workflow was not invoked; the following required tools are not installed: toolshed.g2.bx.psu.edu/repos/csbl/repeatmodeler/repeatmodeler/2.0.4+galaxy1 (version 2.0.4+galaxy1)","err_code":0}

❌ pox-virus-half-genome.ga_0

Execution Problem:

Unexpected HTTP status code: 400: {"err_msg":"Workflow was not invoked; the following required tools are not installed: toolshed.g2.bx.psu.edu/repos/iuc/collection_element_identifiers/collection_element_identifiers/0.0.2 (version 0.0.2)","err_code":0}

❌ taxonomic-rank-abundance-summary-table.ga_0

Execution Problem:

Unexpected HTTP status code: 400: {"err_msg":"Workflow was not invoked; the following required tools are not installed: toolshed.g2.bx.psu.edu/repos/iuc/map_param_value/map_param_value/0.2.0 (version 0.2.0)","err_code":0}

Passed Tests

✅ pe-wgs-ivar-analysis.ga_0

Workflow invocation details

Invocation Messages

Steps

Step 1: Paired read collection for samples:
- step_state: scheduled
Step 2: Reference FASTA:
- step_state: scheduled

Step 11: toolshed.g2.bx.psu.edu/repos/iuc/qualimap_bamqc/qualimap_bamqc/2.2.2d+galaxy3:

step_state: scheduled

Jobs

Job 1:

Job state is ok

Command Line:

export JAVA_OPTS="-Djava.awt.headless=true -Xmx${GALAXY_MEMORY_MB:-1024}m" &&    ln -s '/tmp/tmp159oh6h9/files/2/6/5/dataset_2657d56f-09ca-4b88-a6f6-e192b5cc4104.dat' 'ERR4970105' &&  qualimap bamqc -bam 'ERR4970105' -outdir results -outformat html --collect-overlap-pairs -nw 400 --paint-chromosome-limits -hm 3  --skip-duplicated --skip-dup-mode 0 -nt ${GALAXY_SLOTS:-1} &&   sed 's|images_qualimapReport/||g;s|css/||g' results/qualimapReport.html > '/tmp/tmp159oh6h9/job_working_directory/000/10/outputs/dataset_e9b57dd5-a5e3-46f3-b7f2-69c8c37702d7.dat' && mkdir '/tmp/tmp159oh6h9/job_working_directory/000/10/outputs/dataset_e9b57dd5-a5e3-46f3-b7f2-69c8c37702d7_files' && mv results/css/*.css '/tmp/tmp159oh6h9/job_working_directory/000/10/outputs/dataset_e9b57dd5-a5e3-46f3-b7f2-69c8c37702d7_files' && mv results/css/*.png '/tmp/tmp159oh6h9/job_working_directory/000/10/outputs/dataset_e9b57dd5-a5e3-46f3-b7f2-69c8c37702d7_files' && if [ -d results/images_qualimapReport ]; then mv results/images_qualimapReport/* '/tmp/tmp159oh6h9/job_working_directory/000/10/outputs/dataset_e9b57dd5-a5e3-46f3-b7f2-69c8c37702d7_files' && for file in $(ls -A results/raw_data_qualimapReport); do mv "results/raw_data_qualimapReport/$file" `echo "results/$file" | sed 's/(//;s/)//'`; done fi && mv results/genome_results.txt results/summary_report.txt

Exit Code:

```
0
```

Standard Output:

Java memory size is set to 1200M
Launching application...

detected environment java options -Djava.awt.headless=true -Xmx1024m
QualiMap v.2.2.2-dev
Built on 2019-11-11 14:05

Selected tool: bamqc
Available memory (Mb): 262
Max memory (Mb): 1073
Starting bam qc....
Loading sam header...
Loading locator...
Loading reference...
Only flagged duplicate alignments will be skipped...
Number of windows: 400, effective number of windows: 399
Chunk of reads size: 1000
Number of threads: 1
Processed 50 out of 399 windows...
Processed 100 out of 399 windows...
Processed 150 out of 399 windows...
Processed 200 out of 399 windows...
Processed 250 out of 399 windows...
Processed 300 out of 399 windows...
Processed 350 out of 399 windows...
Total processed windows:399
Number of reads: 1391615
Number of valid reads: 1394916
Number of correct strand reads:0

Inside of regions...
Num mapped reads: 1391615
Num mapped first of pair: 695807
Num mapped second of pair: 695808
Num singletons: 0
Time taken to analyze reads: 19
Computing descriptors...
numberOfMappedBases: 191294294
referenceSize: 29903
numberOfSequencedBases: 191251301
numberOfAs: 58710603
Computing per chromosome statistics...
Computing histograms...
Overall analysis time: 20
end of bam qc
Computing report...
Writing HTML report...
HTML report created successfully

Finished

Traceback:

Job Parameters:

Job parameter	Parameter value
__input_ext	`"bam"`
__workflow_invocation_uuid__	`"23db0b38e47e11efb46f7c1e523efbde"`
chromInfo	`"/tmp/tmp159oh6h9/galaxy-dev/tool-data/shared/ucsc/chrom/?.len"`
dbkey	`"?"`
duplicate_skipping	`["0"]`
per_base_coverage	`false`
plot_specific	`{"genome_gc_distr": null, "homopolymer_size": "3", "n_bins": "400", "paint_chromosome_limits": true}`
stats_regions	`{"__current_case__": 0, "region_select": "all"}`

Step 12: toolshed.g2.bx.psu.edu/repos/iuc/ivar_trim/ivar_trim/1.4.2+galaxy0:

step_state: scheduled

Jobs

Job 1:

Job state is ok

Command Line:

cp '/tmp/tmp159oh6h9/files/f/3/2/dataset_f32146f0-0ebc-4d0f-87df-9d16c00d57a2.dat' bed.bed && python '/tmp/shed_dir/toolshed.g2.bx.psu.edu/repos/iuc/ivar_trim/86a20ae274fc/ivar_trim/sanitize_bed.py' bed.bed && python '/tmp/shed_dir/toolshed.g2.bx.psu.edu/repos/iuc/ivar_trim/86a20ae274fc/ivar_trim/write_amplicon_info_file.py' bed.bed amplicon_info_raw.tsv && python '/tmp/shed_dir/toolshed.g2.bx.psu.edu/repos/iuc/ivar_trim/86a20ae274fc/ivar_trim/prepare_amplicon_info.py' bed.bed amplicon_info_raw.tsv amplicon_info.tsv && ln -s '/tmp/tmp159oh6h9/files/2/6/5/dataset_2657d56f-09ca-4b88-a6f6-e192b5cc4104.dat' sorted.bam && ln -s '/tmp/tmp159oh6h9/files/_metadata_files/5/9/1/metadata_591284c9-3b3f-4b6e-866d-0c5be23ffea6.dat' sorted.bam.bai &&  ivar trim -i sorted.bam -b bed.bed -f amplicon_info.tsv -x 0 -e -m -1 -q 20 -s 4 | samtools sort -@ ${GALAXY_SLOTS:-1} -T "${TMPDIR:-.}" -o trimmed.sorted.bam -

Exit Code:

```
0
```

Standard Error:

Found 218 primers in BED file
Amplicons detected: 
[30, 410] max = 29866
[320, 726] max = 29866
[642, 1028] max = 29866
[943, 1337] max = 29866
[1242, 1651] max = 29866
[1573, 1964] max = 29866
[1868, 2269] max = 29866
[2181, 2592] max = 29866
[2504, 2904] max = 29866
[2826, 3210] max = 29866
[3144, 3531] max = 29866
[3460, 3853] max = 29866
[3771, 4164] max = 29866
[4044, 4450] max = 29866
[4294, 4696] max = 29866
[4636, 5017] max = 29866
[4939, 5321] max = 29866
[5230, 5644] max = 29866
[5563, 5957] max = 29866
[5867, 6272] max = 29866
[6167, 6550] max = 29866
[6466, 6873] max = 29866
[6718, 7117] max = 29866
[7035, 7415] max = 29866
[7305, 7694] max = 29866
[7626, 8019] max = 29866
[7943, 8341] max = 29866
[8249, 8661] max = 29866
[8595, 8983] max = 29866
[8888, 9271] max = 29866
[9204, 9585] max = 29866
[9477, 9858] max = 29866
[9784, 10171] max = 29866
[10076, 10459] max = 29866
[10362, 10763] max = 29866
[10666, 11074] max = 29866
[10999, 11394] max = 29866
[11306, 11693] max = 29866
[11555, 11949] max = 29866
[11863, 12256] max = 29866
[12110, 12490] max = 29866
[12417, 12802] max = 29866
[12710, 13096] max = 29866
[13005, 13400] max = 29866
[13307, 13699] max = 29866
[13599, 13984] max = 29866
[13918, 14299] max = 29866
[14207, 14601] max = 29866
[14545, 14926] max = 29866
[14865, 15246] max = 29866
[15171, 15560] max = 29866
[15481, 15886] max = 29866
[15827, 16209] max = 29866
[16118, 16510] max = 29866
[16416, 16833] max = 29866
[16748, 17152] max = 29866
[17065, 17452] max = 29866
[17381, 17761] max = 29866
[17674, 18062] max = 29866
[17966, 18348] max = 29866
[18253, 18672] max = 29866
[18596, 18979] max = 29866
[18896, 19297] max = 29866
[19204, 19616] max = 29866
[19548, 19939] max = 29866
[19844, 20255] max = 29866
[20172, 20572] max = 29866
[20472, 20890] max = 29866
[20786, 21169] max = 29866
[21075, 21455] max = 29866
[21357, 21743] max = 29866
[21658, 22038] max = 29866
[21961, 22346] max = 29866
[22262, 22650] max = 29866
[22516, 22903] max = 29866
[22797, 23214] max = 29866
[23122, 23522] max = 29866
[23443, 23847] max = 29866
[23789, 24169] max = 29866
[24078, 24467] max = 29866
[24391, 24789] max = 29866
[24696, 25076] max = 29866
[24978, 25369] max = 29866
[25279, 25673] max = 29866
[25601, 25994] max = 29866
[25902, 26315] max = 29866
[26197, 26590] max = 29866
[26520, 26913] max = 29866
[26835, 27227] max = 29866
[27141, 27533] max = 29866
[27446, 27854] max = 29866
[27784, 28172] max = 29866
[28081, 28464] max = 29866
[28394, 28779] max = 29866
[28677, 29063] max = 29866
[28985, 29378] max = 29866
[29288, 29693] max = 29866
[29486, 29866] max = 29866
Reading from sorted.bam
Minimum Read Length based on 1000 reads: 39
Processed 1000000 reads ... 

-------
Results: 
Primer Name	Read Count
nCoV-2019_1_LEFT	1385
nCoV-2019_1_RIGHT	1174
nCoV-2019_2_LEFT	1669
nCoV-2019_2_RIGHT	2343
nCoV-2019_3_LEFT	2238
nCoV-2019_3_RIGHT	4041
nCoV-2019_4_LEFT	2942
nCoV-2019_4_RIGHT	3938
nCoV-2019_5_LEFT	1606
nCoV-2019_5_RIGHT	1345
nCoV-2019_6_LEFT	651
nCoV-2019_6_RIGHT	1315
nCoV-2019_7_LEFT	852
nCoV-2019_7_LEFT_alt0	108
nCoV-2019_7_RIGHT	8
nCoV-2019_7_RIGHT_alt5	622
nCoV-2019_8_LEFT	1216
nCoV-2019_8_RIGHT	3597
nCoV-2019_9_LEFT	2467
nCoV-2019_9_LEFT_alt4	0
nCoV-2019_9_RIGHT	7
nCoV-2019_9_RIGHT_alt2	1652
nCoV-2019_10_LEFT	6538
nCoV-2019_10_RIGHT	4831
nCoV-2019_11_LEFT	3342
nCoV-2019_11_RIGHT	2458
nCoV-2019_12_LEFT	1450
nCoV-2019_12_RIGHT	1202
nCoV-2019_13_LEFT	2273
nCoV-2019_13_RIGHT	1293
nCoV-2019_14_LEFT	2826
nCoV-2019_14_LEFT_alt4	141
nCoV-2019_14_RIGHT	620
nCoV-2019_14_RIGHT_alt2	3428
nCoV-2019_15_LEFT	1
nCoV-2019_15_LEFT_alt1	3399
nCoV-2019_15_RIGHT	6
nCoV-2019_15_RIGHT_alt3	1157
nCoV-2019_16_LEFT	2393
nCoV-2019_16_RIGHT	1227
nCoV-2019_17_LEFT	2630
nCoV-2019_17_RIGHT	2522
nCoV-2019_18_LEFT	130
nCoV-2019_18_LEFT_alt2	5697
nCoV-2019_18_RIGHT	4304
nCoV-2019_18_RIGHT_alt1	0
nCoV-2019_19_LEFT	1843
nCoV-2019_19_RIGHT	1083
nCoV-2019_20_LEFT	2240
nCoV-2019_20_RIGHT	1541
nCoV-2019_21_LEFT	1
nCoV-2019_21_LEFT_alt2	5867
nCoV-2019_21_RIGHT	3
nCoV-2019_21_RIGHT_alt0	1326
nCoV-2019_22_LEFT	3630
nCoV-2019_22_RIGHT	3860
nCoV-2019_23_LEFT	2712
nCoV-2019_23_RIGHT	1203
nCoV-2019_24_LEFT	2555
nCoV-2019_24_RIGHT	1224
nCoV-2019_25_LEFT	1746
nCoV-2019_25_RIGHT	2301
nCoV-2019_26_LEFT	4702
nCoV-2019_26_RIGHT	2711
nCoV-2019_27_LEFT	8047
nCoV-2019_27_RIGHT	3288
nCoV-2019_28_LEFT	1354
nCoV-2019_28_RIGHT	2726
nCoV-2019_29_LEFT	236
nCoV-2019_29_RIGHT	1801
nCoV-2019_30_LEFT	1663
nCoV-2019_30_RIGHT	4528
nCoV-2019_31_LEFT	3944
nCoV-2019_31_RIGHT	3538
nCoV-2019_32_LEFT	3587
nCoV-2019_32_RIGHT	1826
nCoV-2019_33_LEFT	705
nCoV-2019_33_RIGHT	2058
nCoV-2019_34_LEFT	3937
nCoV-2019_34_RIGHT	3606
nCoV-2019_35_LEFT	3929
nCoV-2019_35_RIGHT	4540
nCoV-2019_36_LEFT	3802
nCoV-2019_36_RIGHT	5022
nCoV-2019_37_LEFT	7095
nCoV-2019_37_RIGHT	1546
nCoV-2019_38_LEFT	4168
nCoV-2019_38_RIGHT	9163
nCoV-2019_39_LEFT	9474
nCoV-2019_39_RIGHT	4028
nCoV-2019_40_LEFT	5270
nCoV-2019_40_RIGHT	2221
nCoV-2019_41_LEFT	4810
nCoV-2019_41_RIGHT	2952
nCoV-2019_42_LEFT	2283
nCoV-2019_42_RIGHT	6248
nCoV-2019_43_LEFT	3277
nCoV-2019_43_RIGHT	1304
nCoV-2019_44_LEFT	17
nCoV-2019_44_LEFT_alt3	7727
nCoV-2019_44_RIGHT	664
nCoV-2019_44_RIGHT_alt0	8646
nCoV-2019_45_LEFT	1164
nCoV-2019_45_LEFT_alt2	409
nCoV-2019_45_RIGHT	23
nCoV-2019_45_RIGHT_alt7	943
nCoV-2019_46_LEFT	0
nCoV-2019_46_LEFT_alt1	806
nCoV-2019_46_RIGHT	0
nCoV-2019_46_RIGHT_alt2	2028
nCoV-2019_47_LEFT	2998
nCoV-2019_47_RIGHT	3861
nCoV-2019_48_LEFT	2245
nCoV-2019_48_RIGHT	2645
nCoV-2019_49_LEFT	5492
nCoV-2019_49_RIGHT	5519
nCoV-2019_50_LEFT	2393
nCoV-2019_50_RIGHT	1717
nCoV-2019_51_LEFT	2880
nCoV-2019_51_RIGHT	3017
nCoV-2019_52_LEFT	3554
nCoV-2019_52_RIGHT	2718
nCoV-2019_53_LEFT	5757
nCoV-2019_53_RIGHT	3106
nCoV-2019_54_LEFT	2947
nCoV-2019_54_RIGHT	2577
nCoV-2019_55_LEFT	2453
nCoV-2019_55_RIGHT	5660
nCoV-2019_56_LEFT	2387
nCoV-2019_56_RIGHT	4915
nCoV-2019_57_LEFT	10504
nCoV-2019_57_RIGHT	6840
nCoV-2019_58_LEFT	2872
nCoV-2019_58_RIGHT	2854
nCoV-2019_59_LEFT	1020
nCoV-2019_59_RIGHT	1303
nCoV-2019_60_LEFT	4249
nCoV-2019_60_RIGHT	4847
nCoV-2019_61_LEFT	4272
nCoV-2019_61_RIGHT	6480
nCoV-2019_62_LEFT	3802
nCoV-2019_62_RIGHT	3944
nCoV-2019_63_LEFT	2696
nCoV-2019_63_RIGHT	2453
nCoV-2019_64_LEFT	780
nCoV-2019_64_RIGHT	843
nCoV-2019_65_LEFT	1060
nCoV-2019_65_RIGHT	3393
nCoV-2019_66_LEFT	2044
nCoV-2019_66_RIGHT	655
nCoV-2019_67_LEFT	1499
nCoV-2019_67_RIGHT	839
nCoV-2019_68_LEFT	5096
nCoV-2019_68_RIGHT	1495
nCoV-2019_69_LEFT	3000
nCoV-2019_69_RIGHT	2953
nCoV-2019_70_LEFT	984
nCoV-2019_70_RIGHT	712
nCoV-2019_71_LEFT	864
nCoV-2019_71_RIGHT	4277
nCoV-2019_72_LEFT	7080
nCoV-2019_72_RIGHT	2247
nCoV-2019_73_LEFT	1262
nCoV-2019_73_RIGHT	855
nCoV-2019_74_LEFT	104
nCoV-2019_74_RIGHT	477
nCoV-2019_75_LEFT	1901
nCoV-2019_75_RIGHT	1370
nCoV-2019_76_LEFT	0
nCoV-2019_76_LEFT_alt3	114
nCoV-2019_76_RIGHT	34
nCoV-2019_76_RIGHT_alt0	225
nCoV-2019_77_LEFT	2926
nCoV-2019_77_RIGHT	6778
nCoV-2019_78_LEFT	1790
nCoV-2019_78_RIGHT	1729
nCoV-2019_79_LEFT	1426
nCoV-2019_79_RIGHT	1785
nCoV-2019_80_LEFT	3718
nCoV-2019_80_RIGHT	2494
nCoV-2019_81_LEFT	2018
nCoV-2019_81_RIGHT	2255
nCoV-2019_82_LEFT	7360
nCoV-2019_82_RIGHT	1952
nCoV-2019_83_LEFT	2964
nCoV-2019_83_RIGHT	18
nCoV-2019_84_LEFT	2870
nCoV-2019_84_RIGHT	4069
nCoV-2019_85_LEFT	3830
nCoV-2019_85_RIGHT	1767
nCoV-2019_86_LEFT	2117
nCoV-2019_86_RIGHT	1820
nCoV-2019_87_LEFT	2067
nCoV-2019_87_RIGHT	2201
nCoV-2019_88_LEFT	2892
nCoV-2019_88_RIGHT	6758
nCoV-2019_89_LEFT	30
nCoV-2019_89_LEFT_alt2	1044
nCoV-2019_89_RIGHT	121
nCoV-2019_89_RIGHT_alt4	1538
nCoV-2019_90_LEFT	3133
nCoV-2019_90_RIGHT	2588
nCoV-2019_91_LEFT	1109
nCoV-2019_91_RIGHT	675
nCoV-2019_92_LEFT	2173
nCoV-2019_92_RIGHT	851
nCoV-2019_93_LEFT	2829
nCoV-2019_93_RIGHT	4277
nCoV-2019_94_LEFT	5272
nCoV-2019_94_RIGHT	3632
nCoV-2019_95_LEFT	1784
nCoV-2019_95_RIGHT	594
nCoV-2019_96_LEFT	1842
nCoV-2019_96_RIGHT	1885
nCoV-2019_97_LEFT	1907
nCoV-2019_97_RIGHT	6074
nCoV-2019_98_LEFT	5277
nCoV-2019_98_RIGHT	1789

Trimmed primers from 39.55% (549744) of reads.
3.09% (42885) of reads were quality trimmed below the minimum length of 39 bp and were not written to file.
59.09% (821323) of reads started outside of primer regions. Since the -e flag was given, these reads were written to file.
0.36% (5040) reads were ignored because they did not fall within an amplicon
16.81% (233696) of reads had their insert size smaller than their read length

Traceback:

Job Parameters:

Job parameter	Parameter value
__input_ext	`"input"`
__workflow_invocation_uuid__	`"23db0b38e47e11efb46f7c1e523efbde"`
amplicons	`{"__current_case__": 0, "filter_by": "yes_compute"}`
chromInfo	`"/tmp/tmp159oh6h9/galaxy-dev/tool-data/shared/ucsc/chrom/?.len"`
dbkey	`"?"`
inc_primers	`true`
min_len	`"30"`
min_qual	`"20"`
primer	`{"__current_case__": 0, "input_bed": {"values": [{"id": 2, "src": "hda"}]}, "source": "history"}`
primer_pos_wiggle	`"0"`
trimmed_length	`{"__current_case__": 1, "filter": "auto"}`
window_width	`"4"`

Step 13: __FLATTEN__:
- step_state: scheduled
- Jobs
  - Job 1:
    - Job state is ok
    Traceback:
    Job Parameters:
    - Job parameter Parameter value
      
      __workflow_invocation_uuid__ "23db0b38e47e11efb46f7c1e523efbde"
      
      input {"values": [{"id": 8, "src": "hdca"}]}
      
      join_identifier "_"

Step 14: toolshed.g2.bx.psu.edu/repos/iuc/ivar_variants/ivar_variants/1.4.2+galaxy1:

step_state: scheduled

Jobs

Job 1:

Job state is ok

Command Line:

ln -s '/tmp/tmp159oh6h9/files/6/2/7/dataset_627d5910-8b40-424f-9d44-9bd5ee21ab01.dat' ref.fa && ln -s '/tmp/tmp159oh6h9/files/f/3/2/dataset_f326c0b6-dac9-4c8b-bfd4-e89b41dd7d55.dat' sorted.bam && samtools mpileup -A -d 0 --reference ref.fa -B -Q 0 sorted.bam | ivar variants -p variants -q 20 -t 0.7 && python '/tmp/shed_dir/toolshed.g2.bx.psu.edu/repos/iuc/ivar_variants/194e3ceee923/ivar_variants/ivar_variants_to_vcf.py'  variants.tsv variants.vcf

Exit Code:

```
0
```

Standard Error:

[mpileup] 1 samples in 1 input files
[mpileup] Max depth set to maximum value (2147483647)
[E::faidx_adjust_position] The sequence "NC_045512.2" was not found
[E::faidx_adjust_position] The sequence "NC_045512.2" was not found
[E::faidx_adjust_position] The sequence "NC_045512.2" was not found
[E::faidx_adjust_position] The sequence "NC_045512.2" was not found
[E::faidx_adjust_position] The sequence "NC_045512.2" was not found
[E::faidx_adjust_position] The sequence "NC_045512.2" was not found
[E::faidx_adjust_position] The sequence "NC_045512.2" was not found
[E::faidx_adjust_position] The sequence "NC_045512.2" was not found
[E::faidx_adjust_position] The sequence "NC_045512.2" was not found
[E::faidx_adjust_position] The sequence "NC_045512.2" was not found
[E::faidx_adjust_position] The sequence "NC_045512.2" was not found
[E::faidx_adjust_position] The sequence "NC_045512.2" was not found
[E::faidx_adjust_position] The sequence "NC_045512.2" was not found
[E::faidx_adjust_position] The sequence "NC_045512.2" was not found
[E::faidx_adjust_position] The sequence "NC_045512.2" was not found
[E::faidx_adjust_position] The sequence "NC_045512.2" was not found
[E::faidx_adjust_position] The sequence "NC_045512.2" was not found
[E::faidx_adjust_position] The sequence "NC_045512.2" was not found
[E::faidx_adjust_position] The sequence "NC_045512.2" was not found
[E::faidx_adjust_position] The sequence "NC_045512.2" was not found
[E::faidx_adjust_position] The sequence "NC_045512.2" was not found
[E::faidx_adjust_position] The sequence "NC_045512.2" was not found
[E::faidx_adjust_position] The sequence "NC_045512.2" was not found
[E::faidx_adjust_position] The sequence "NC_045512.2" was not found
[E::faidx_adjust_position] The sequence "NC_045512.2" was not found
[E::faidx_adjust_position] The sequence "NC_045512.2" was not found
[E::faidx_adjust_position] The sequence "NC_045512.2" was not found
[E::faidx_adjust_position] The sequence "NC_045512.2" was not found
[E::faidx_adjust_position] The sequence "NC_045512.2" was not found
[E::faidx_adjust_position] The sequence "NC_045512.2" was not found
[E::faidx_adjust_position] The sequence "NC_045512.2" was not found
[E::faidx_adjust_position] The sequence "NC_045512.2" was not found
[E::faidx_adjust_position] The sequence "NC_045512.2" was not found
[E::faidx_adjust_position] The sequence "NC_045512.2" was not found
[E::faidx_adjust_position] The sequence "NC_045512.2" was not found
[E::faidx_adjust_position] The sequence "NC_045512.2" was not found
[E::faidx_adjust_position] The sequence "NC_045512.2" was not found
[E::faidx_adjust_position] The sequence "NC_045512.2" was not found
[E::faidx_adjust_position] The sequence "NC_045512.2" was not found
[E::faidx_adjust_position] The sequence "NC_045512.2" was not found
[E::faidx_adjust_position] The sequence "NC_045512.2" was not found
[E::faidx_adjust_position] The sequence "NC_045512.2" was not found
[E::faidx_adjust_position] The sequence "NC_045512.2" was not found
[E::faidx_adjust_position] The sequence "NC_045512.2" was not found
[E::faidx_adjust_position] The sequence "NC_045512.2" was not found
[E::faidx_adjust_position] The sequence "NC_045512.2" was not found
[E::faidx_adjust_position] The sequence "NC_045512.2" was not found
[E::faidx_adjust_position] The sequence "NC_045512.2" was not found
[E::faidx_adjust_position] The sequence "NC_045512.2" was not found
[E::faidx_adjust_position] The sequence "NC_045512.2" was not found
[E::faidx_adjust_position] The sequence "NC_045512.2" was not found
[E::faidx_adjust_position] The sequence "NC_045512.2" was not found
[E::faidx_adjust_position] The sequence "NC_045512.2" was not found
[E::faidx_adjust_position] The sequence "NC_045512.2" was not found
[E::faidx_adjust_position] The sequence "NC_045512.2" was not found
[E::faidx_adjust_position] The sequence "NC_045512.2" was not found
[E::faidx_adjust_position] The sequence "NC_045512.2" was not found
[E::faidx_adjust_position] The sequence "NC_045512.2" was not found
[E::faidx_adjust_position] The sequence "NC_045512.2" was not found
[E::faidx_adjust_position] The sequence "NC_045512.2" was not found
[E::faidx_adjust_position] The sequence "NC_045512.2" was not found
[E::faidx_adjust_position] The sequence "NC_045512.2" was not found
[E::faidx_adjust_position] The sequence "NC_045512.2" was not found
[E::faidx_adjust_position] The sequence "NC_045512.2" was not found
[E::faidx_adjust_position] The sequence "NC_045512.2" was not found
[E::faidx_adjust_position] The sequence "NC_045512.2" was not found
[E::faidx_adjust_position] The sequence "NC_045512.2" was not found
[E::faidx_adjust_position] The sequence "NC_045512.2" was not found
[E::faidx_adjust_position] The sequence "NC_045512.2" was not found
[E::faidx_adjust_position] The sequence "NC_045512.2" was not found
[E::faidx_adjust_position] The sequence "NC_045512.2" was not found
[E::faidx_adjust_position] The sequence "NC_045512.2" was not found
[E::faidx_adjust_position] The sequence "NC_045512.2" was not found
[E::faidx_adjust_position] The sequence "NC_045512.2" was not found
[E::faidx_adjust_position] The sequence "NC_045512.2" was not found
[E::faidx_adjust_position] The sequence "NC_045512.2" was not found
[E::faidx_adjust_position] The sequence "NC_045512.2" was not found
[E::faidx_adjust_position] The sequence "NC_045512.2" was not found
[E::faidx_adjust_position] The sequence "NC_045512.2" was not found
[E::faidx_adjust_position] The sequence "NC_045512.2" was not found
[E::faidx_adjust_position] The sequence "NC_045512.2" was not found
[E::faidx_adjust_position] The sequence "NC_045512.2" was not found
[E::faidx_adjust_position] The sequence "NC_045512.2" was not found
[E::faidx_adjust_position] The sequence "NC_045512.2" was not found
[E::faidx_adjust_position] The sequence "NC_045512.2" was not found
[E::faidx_adjust_position] The sequence "NC_045512.2" was not found
[E::faidx_adjust_position] The sequence "NC_045512.2" was not found
[E::faidx_adjust_position] The sequence "NC_045512.2" was not found
[E::faidx_adjust_position] The sequence "NC_045512.2" was not found
[E::faidx_adjust_position] The sequence "NC_045512.2" was not found
[E::faidx_adjust_position] The sequence "NC_045512.2" was not found
[E::faidx_adjust_position] The sequence "NC_045512.2" was not found
[E::faidx_adjust_position] The sequence "NC_045512.2" was not found
[E::faidx_adjust_position] The sequence "NC_045512.2" was not found
[E::faidx_adjust_position] The sequence "NC_045512.2" was not found
[E::faidx_adjust_position] The sequence "NC_045512.2" was not found
[E::faidx_adjust_position] The sequence "NC_045512.2" was not found
[E::faidx_adjust_position] The sequence "NC_045512.2" was not found
[E::faidx_adjust_position] The sequence "NC_045512.2" was not found
[E::faidx_adjust_position] The sequence "NC_045512.2" was not found
[E::faidx_adjust_position] The sequence "NC_045512.2" was not found
[E::faidx_adjust_position] The sequence "NC_045512.2" was not found
[E::faidx_adjust_position] The sequence "NC_045512.2" was not found
[E::faidx_adjust_position] The sequence "NC_045512.2" was not found
[E::faidx_adjust_position] The sequence "NC_045512.2" was not found
[E::faidx_adjust_position] The sequence "NC_045512.2" was not found
[E::faidx_adjust_position] The sequence "NC_045512.2" was not found
[E::faidx_adjust_position] The sequence "NC_045512.2" was not found
[E::faidx_adjust_position] The sequence "NC_045512.2" was not found
[E::faidx_adjust_position] The sequence "NC_045512.2" was not found
[E::faidx_adjust_position] The sequence "NC_045512.2" was not found
[E::faidx_adjust_position] The sequence "NC_045512.2" was not found
[E::faidx_adjust_position] The sequence "NC_045512.2" was not found
[E::faidx_adjust_position] The sequence "NC_045512.2" was not found
[E::faidx_adjust_position] The sequence "NC_045512.2" was not found
[E::faidx_adjust_position] The sequence "NC_045512.2" was not found
[E::faidx_adjust_position] The sequence "NC_045512.2" was not found
[E::faidx_adjust_position] The sequence "NC_045512.2" was not found
[E::faidx_adjust_position] The sequence "NC_045512.2" was not found
[E::faidx_adjust_position] The sequence "NC_045512.2" was not found
[E::faidx_adjust_position] The sequence "NC_045512.2" was not found
[E::faidx_adjust_position] The sequence "NC_045512.2" was not found
[E::faidx_adjust_position] The sequence "NC_045512.2" was not found
[E::faidx_adjust_position] The sequence "NC_045512.2" was not found
[E::faidx_adjust_position] The sequence "NC_045512.2" was not found
[E::faidx_adjust_position] The sequence "NC_045512.2" was not found
[E::faidx_adjust_position] The sequence "NC_045512.2" was not found
[E::faidx_adjust_position] The sequence "NC_045512.2" was not found
[E::faidx_adjust_position] The sequence "NC_045512.2" was not found
[E::faidx_adjust_position] The sequence "NC_045512.2" was not found
[E::faidx_adjust_position] The sequence "NC_045512.2" was not found
[E::faidx_adjust_position] The sequence "NC_045512.2" was not found
[E::faidx_adjust_position] The sequence "NC_045512.2" was not found
[E::faidx_adjust_position] The sequence "NC_045512.2" was not found
[E::faidx_adjust_position] The sequence "NC_045512.2" was not found
[E::faidx_adjust_position] The sequence "NC_045512.2" was not found
[E::faidx_adjust_position] The sequence "NC_045512.2" was not found
[E::faidx_adjust_position] The sequence "NC_045512.2" was not found
[E::faidx_adjust_position] The sequence "NC_045512.2" was not found
[E::faidx_adjust_position] The sequence "NC_045512.2" was not found
[E::faidx_adjust_position] The sequence "NC_045512.2" was not found
[E::faidx_adjust_position] The sequence "NC_045512.2" was not found
[E::faidx_adjust_position] The sequence "NC_045512.2" was not found
[E::faidx_adjust_position] The sequence "NC_045512.2" was not found
[E::faidx_adjust_position] The sequence "NC_045512.2" was not found
[E::faidx_adjust_position] The sequence "NC_045512.2" was not found
[E::faidx_adjust_position] The sequence "NC_045512.2" was not found
[E::faidx_adjust_position] The sequence "NC_045512.2" was not found
[E::faidx_adjust_position] The sequence "NC_045512.2" was not found
[E::faidx_adjust_position] The sequence "NC_045512.2" was not found
[E::faidx_adjust_position] The sequence "NC_045512.2" was not found
[E::faidx_adjust_position] The sequence "NC_045512.2" was not found
[E::faidx_adjust_position] The sequence "NC_045512.2" was not found
[E::faidx_adjust_position] The sequence "NC_045512.2" was not found
[E::faidx_adjust_position] The sequence "NC_045512.2" was not found
[E::faidx_adjust_position] The sequence "NC_045512.2" was not found
[E::faidx_adjust_position] The sequence "NC_045512.2" was not found
[E::faidx_adjust_position] The sequence "NC_045512.2" was not found
[E::faidx_adjust_position] The sequence "NC_045512.2" was not found
[E::faidx_adjust_position] The sequence "NC_045512.2" was not found
[E::faidx_adjust_position] The sequence "NC_045512.2" was not found
[E::faidx_adjust_position] The sequence "NC_045512.2" was not found
[E::faidx_adjust_position] The sequence "NC_045512.2" was not found
[E::faidx_adjust_position] The sequence "NC_045512.2" was not found
[E::faidx_adjust_position] The sequence "NC_045512.2" was not found
[E::faidx_adjust_position] The sequence "NC_045512.2" was not found
[E::faidx_adjust_position] The sequence "NC_045512.2" was not found
[E::faidx_adjust_position] The sequence "NC_045512.2" was not found
[E::faidx_adjust_position] The sequence "NC_045512.2" was not found
[E::faidx_adjust_position] The sequence "NC_045512.2" was not found
[E::faidx_adjust_position] The sequence "NC_045512.2" was not found
[E::faidx_adjust_position] The sequence "NC_045512.2" was not found
[E::faidx_adjust_position] The sequence "NC_045512.2" was not found
[E::faidx_adjust_position] The sequence "NC_045512.2" was not found
[E::faidx_adjust_position] The sequence "NC_045512.2" was not found
[E::faidx_adjust_position] The sequence "NC_045512.2" was not found
[E::faidx_adjust_position] The sequence "NC_045512.2" was not found
[E::faidx_adjust_position] The sequence "NC_045512.2" was not found
[E::faidx_adjust_position] The sequence "NC_045512.2" was not found
[E::faidx_adjust_position] The sequence "NC_045512.2" was not found
[E::faidx_adjust_position] The sequence "NC_045512.2" was not found
[E::faidx_adjust_position] The sequence "NC_045512.2" was not found
[E::faidx_adjust_position] The sequence "NC_045512.2" was not found
[E::faidx_adjust_position] The sequence "NC_045512.2" was not found
[E::faidx_adjust_position] The sequence "NC_045512.2" was not found
[E::faidx_adjust_position] The sequence "NC_045512.2" was not found
[E::faidx_adjust_position] The sequence "NC_045512.2" was not found
[E::faidx_adjust_position] The sequence "NC_045512.2" was not found
[E::faidx_adjust_position] The sequence "NC_045512.2" was not found
[E::faidx_adjust_position] The sequence "NC_045512.2" was not found
[E::faidx_adjust_position] The sequence "NC_045512.2" was not found
[E::faidx_adjust_position] The sequence "NC_045512.2" was not found
[E::faidx_adjust_position] The sequence "NC_045512.2" was not found
[E::faidx_adjust_position] The sequence "NC_045512.2" was not found
[E::faidx_adjust_position] The sequence "NC_045512.2" was not found
[E::faidx_adjust_position] The sequence "NC_045512.2" was not found
[E::faidx_adjust_position] The sequence "NC_045512.2" was not found
[E::faidx_adjust_position] The sequence "NC_045512.2" was not found
[E::faidx_adjust_position] The sequence "NC_045512.2" was not found
[E::faidx_adjust_position] The sequence "NC_045512.2" was not found
[E::faidx_adjust_position] The sequence "NC_045512.2" was not found
[E::faidx_adjust_position] The sequence "NC_045512.2" was not found
[E::faidx_adjust_position] The sequence "NC_045512.2" was not found
[E::faidx_adjust_position] The sequence "NC_045512.2" was not found
[E::faidx_adjust_position] The sequence "NC_045512.2" was not found
[E::faidx_adjust_position] The sequence "NC_045512.2" was not found
[E::faidx_adjust_position] The sequence "NC_045512.2" was not found
[E::faidx_adjust_position] The sequence "NC_045512.2" was not found
[E::faidx_adjust_position] The sequence "NC_045512.2" was not found
[E::faidx_adjust_position] The sequence "NC_045512.2" was not found
[E::faidx_adjust_position] The sequence "NC_045512.2" was not found
[E::faidx_adjust_position] The sequence "NC_045512.2" was not found
[E::faidx_adjust_position] The sequence "NC_045512.2" was not found
[E::faidx_adjust_position] The sequence "NC_045512.2" was not found
[E::faidx_adjust_position] The sequence "NC_045512.2" was not found
[E::faidx_adjust_position] The sequence "NC_045512.2" was not found
[E::faidx_adjust_position] The sequence "NC_045512.2" was not found
[E::faidx_adjust_position] The sequence "NC_045512.2" was not found
[E::faidx_adjust_position] The sequence "NC_045512.2" was not found
[E::faidx_adjust_position] The sequence "NC_045512.2" was not found
[E::faidx_adjust_position] The sequence "NC_045512.2" was not found
[E::faidx_adjust_position] The sequence "NC_045512.2" was not found
[E::faidx_adjust_position] The sequence "NC_045512.2" was not found
[E::faidx_adjust_position] The sequence "NC_045512.2" was not found
[E::faidx_adjust_position] The sequence "NC_045512.2" was not found
[E::faidx_adjust_position] The sequence "NC_045512.2" was not found
[E::faidx_adjust_position] The sequence "NC_045512.2" was not found
[E::faidx_adjust_position] The sequence "NC_045512.2" was not found
[E::faidx_adjust_position] The sequence "NC_045512.2" was not found
[E::faidx_adjust_position] The sequence "NC_045512.2" was not found
[E::faidx_adjust_position] The sequence "NC_045512.2" was not found
[E::faidx_adjust_position] The sequence "NC_045512.2" was not found
[E::faidx_adjust_position] The sequence "NC_045512.2" was not found
[E::faidx_adjust_position] The sequence "NC_045512.2" was not found
[E::faidx_adjust_position] The sequence "NC_045512.2" was not found
[E::faidx_adjust_position] The sequence "NC_045512.2" was not found
[E::faidx_adjust_position] The sequence "NC_045512.2" was not found
[E::faidx_adjust_position] The sequence "NC_045512.2" was not found
[E::faidx_adjust_position] The sequence "NC_045512.2" was not found
[E::faidx_adjust_position] The sequence
..
idx_adjust_position] The sequence "NC_045512.2" was not found
[E::faidx_adjust_position] The sequence "NC_045512.2" was not found
[E::faidx_adjust_position] The sequence "NC_045512.2" was not found
[E::faidx_adjust_position] The sequence "NC_045512.2" was not found
[E::faidx_adjust_position] The sequence "NC_045512.2" was not found
[E::faidx_adjust_position] The sequence "NC_045512.2" was not found
[E::faidx_adjust_position] The sequence "NC_045512.2" was not found
[E::faidx_adjust_position] The sequence "NC_045512.2" was not found
[E::faidx_adjust_position] The sequence "NC_045512.2" was not found
[E::faidx_adjust_position] The sequence "NC_045512.2" was not found
[E::faidx_adjust_position] The sequence "NC_045512.2" was not found
[E::faidx_adjust_position] The sequence "NC_045512.2" was not found
[E::faidx_adjust_position] The sequence "NC_045512.2" was not found
[E::faidx_adjust_position] The sequence "NC_045512.2" was not found
[E::faidx_adjust_position] The sequence "NC_045512.2" was not found
[E::faidx_adjust_position] The sequence "NC_045512.2" was not found
[E::faidx_adjust_position] The sequence "NC_045512.2" was not found
[E::faidx_adjust_position] The sequence "NC_045512.2" was not found
[E::faidx_adjust_position] The sequence "NC_045512.2" was not found
[E::faidx_adjust_position] The sequence "NC_045512.2" was not found
[E::faidx_adjust_position] The sequence "NC_045512.2" was not found
[E::faidx_adjust_position] The sequence "NC_045512.2" was not found
[E::faidx_adjust_position] The sequence "NC_045512.2" was not found
[E::faidx_adjust_position] The sequence "NC_045512.2" was not found
[E::faidx_adjust_position] The sequence "NC_045512.2" was not found
[E::faidx_adjust_position] The sequence "NC_045512.2" was not found
[E::faidx_adjust_position] The sequence "NC_045512.2" was not found
[E::faidx_adjust_position] The sequence "NC_045512.2" was not found
[E::faidx_adjust_position] The sequence "NC_045512.2" was not found
[E::faidx_adjust_position] The sequence "NC_045512.2" was not found
[E::faidx_adjust_position] The sequence "NC_045512.2" was not found
[E::faidx_adjust_position] The sequence "NC_045512.2" was not found
[E::faidx_adjust_position] The sequence "NC_045512.2" was not found
[E::faidx_adjust_position] The sequence "NC_045512.2" was not found
[E::faidx_adjust_position] The sequence "NC_045512.2" was not found
[E::faidx_adjust_position] The sequence "NC_045512.2" was not found
[E::faidx_adjust_position] The sequence "NC_045512.2" was not found
[E::faidx_adjust_position] The sequence "NC_045512.2" was not found
[E::faidx_adjust_position] The sequence "NC_045512.2" was not found
[E::faidx_adjust_position] The sequence "NC_045512.2" was not found
[E::faidx_adjust_position] The sequence "NC_045512.2" was not found
[E::faidx_adjust_position] The sequence "NC_045512.2" was not found
[E::faidx_adjust_position] The sequence "NC_045512.2" was not found
[E::faidx_adjust_position] The sequence "NC_045512.2" was not found
[E::faidx_adjust_position] The sequence "NC_045512.2" was not found
[E::faidx_adjust_position] The sequence "NC_045512.2" was not found
[E::faidx_adjust_position] The sequence "NC_045512.2" was not found
[E::faidx_adjust_position] The sequence "NC_045512.2" was not found
[E::faidx_adjust_position] The sequence "NC_045512.2" was not found
[E::faidx_adjust_position] The sequence "NC_045512.2" was not found
[E::faidx_adjust_position] The sequence "NC_045512.2" was not found
[E::faidx_adjust_position] The sequence "NC_045512.2" was not found
[E::faidx_adjust_position] The sequence "NC_045512.2" was not found
[E::faidx_adjust_position] The sequence "NC_045512.2" was not found
[E::faidx_adjust_position] The sequence "NC_045512.2" was not found
[E::faidx_adjust_position] The sequence "NC_045512.2" was not found
[E::faidx_adjust_position] The sequence "NC_045512.2" was not found
[E::faidx_adjust_position] The sequence "NC_045512.2" was not found
[E::faidx_adjust_position] The sequence "NC_045512.2" was not found
[E::faidx_adjust_position] The sequence "NC_045512.2" was not found
[E::faidx_adjust_position] The sequence "NC_045512.2" was not found
[E::faidx_adjust_position] The sequence "NC_045512.2" was not found
[E::faidx_adjust_position] The sequence "NC_045512.2" was not found
[E::faidx_adjust_position] The sequence "NC_045512.2" was not found
[E::faidx_adjust_position] The sequence "NC_045512.2" was not found
[E::faidx_adjust_position] The sequence "NC_045512.2" was not found
[E::faidx_adjust_position] The sequence "NC_045512.2" was not found
[E::faidx_adjust_position] The sequence "NC_045512.2" was not found
[E::faidx_adjust_position] The sequence "NC_045512.2" was not found
[E::faidx_adjust_position] The sequence "NC_045512.2" was not found
[E::faidx_adjust_position] The sequence "NC_045512.2" was not found
[E::faidx_adjust_position] The sequence "NC_045512.2" was not found
[E::faidx_adjust_position] The sequence "NC_045512.2" was not found
[E::faidx_adjust_position] The sequence "NC_045512.2" was not found
[E::faidx_adjust_position] The sequence "NC_045512.2" was not found
[E::faidx_adjust_position] The sequence "NC_045512.2" was not found
[E::faidx_adjust_position] The sequence "NC_045512.2" was not found
[E::faidx_adjust_position] The sequence "NC_045512.2" was not found
[E::faidx_adjust_position] The sequence "NC_045512.2" was not found
[E::faidx_adjust_position] The sequence "NC_045512.2" was not found
[E::faidx_adjust_position] The sequence "NC_045512.2" was not found
[E::faidx_adjust_position] The sequence "NC_045512.2" was not found
[E::faidx_adjust_position] The sequence "NC_045512.2" was not found
[E::faidx_adjust_position] The sequence "NC_045512.2" was not found
[E::faidx_adjust_position] The sequence "NC_045512.2" was not found
[E::faidx_adjust_position] The sequence "NC_045512.2" was not found
[E::faidx_adjust_position] The sequence "NC_045512.2" was not found
[E::faidx_adjust_position] The sequence "NC_045512.2" was not found
[E::faidx_adjust_position] The sequence "NC_045512.2" was not found
[E::faidx_adjust_position] The sequence "NC_045512.2" was not found
[E::faidx_adjust_position] The sequence "NC_045512.2" was not found
[E::faidx_adjust_position] The sequence "NC_045512.2" was not found
[E::faidx_adjust_position] The sequence "NC_045512.2" was not found
[E::faidx_adjust_position] The sequence "NC_045512.2" was not found
[E::faidx_adjust_position] The sequence "NC_045512.2" was not found
[E::faidx_adjust_position] The sequence "NC_045512.2" was not found
[E::faidx_adjust_position] The sequence "NC_045512.2" was not found
[E::faidx_adjust_position] The sequence "NC_045512.2" was not found
[E::faidx_adjust_position] The sequence "NC_045512.2" was not found
[E::faidx_adjust_position] The sequence "NC_045512.2" was not found
[E::faidx_adjust_position] The sequence "NC_045512.2" was not found
[E::faidx_adjust_position] The sequence "NC_045512.2" was not found
[E::faidx_adjust_position] The sequence "NC_045512.2" was not found
[E::faidx_adjust_position] The sequence "NC_045512.2" was not found
[E::faidx_adjust_position] The sequence "NC_045512.2" was not found
[E::faidx_adjust_position] The sequence "NC_045512.2" was not found
[E::faidx_adjust_position] The sequence "NC_045512.2" was not found
[E::faidx_adjust_position] The sequence "NC_045512.2" was not found
[E::faidx_adjust_position] The sequence "NC_045512.2" was not found
[E::faidx_adjust_position] The sequence "NC_045512.2" was not found
[E::faidx_adjust_position] The sequence "NC_045512.2" was not found
[E::faidx_adjust_position] The sequence "NC_045512.2" was not found
[E::faidx_adjust_position] The sequence "NC_045512.2" was not found
[E::faidx_adjust_position] The sequence "NC_045512.2" was not found
[E::faidx_adjust_position] The sequence "NC_045512.2" was not found
[E::faidx_adjust_position] The sequence "NC_045512.2" was not found
[E::faidx_adjust_position] The sequence "NC_045512.2" was not found
[E::faidx_adjust_position] The sequence "NC_045512.2" was not found
[E::faidx_adjust_position] The sequence "NC_045512.2" was not found
[E::faidx_adjust_position] The sequence "NC_045512.2" was not found
[E::faidx_adjust_position] The sequence "NC_045512.2" was not found
[E::faidx_adjust_position] The sequence "NC_045512.2" was not found
[E::faidx_adjust_position] The sequence "NC_045512.2" was not found
[E::faidx_adjust_position] The sequence "NC_045512.2" was not found
[E::faidx_adjust_position] The sequence "NC_045512.2" was not found
[E::faidx_adjust_position] The sequence "NC_045512.2" was not found
[E::faidx_adjust_position] The sequence "NC_045512.2" was not found
[E::faidx_adjust_position] The sequence "NC_045512.2" was not found
[E::faidx_adjust_position] The sequence "NC_045512.2" was not found
[E::faidx_adjust_position] The sequence "NC_045512.2" was not found
[E::faidx_adjust_position] The sequence "NC_045512.2" was not found
[E::faidx_adjust_position] The sequence "NC_045512.2" was not found
[E::faidx_adjust_position] The sequence "NC_045512.2" was not found
[E::faidx_adjust_position] The sequence "NC_045512.2" was not found
[E::faidx_adjust_position] The sequence "NC_045512.2" was not found
[E::faidx_adjust_position] The sequence "NC_045512.2" was not found
[E::faidx_adjust_position] The sequence "NC_045512.2" was not found
[E::faidx_adjust_position] The sequence "NC_045512.2" was not found
[E::faidx_adjust_position] The sequence "NC_045512.2" was not found
[E::faidx_adjust_position] The sequence "NC_045512.2" was not found
[E::faidx_adjust_position] The sequence "NC_045512.2" was not found
[E::faidx_adjust_position] The sequence "NC_045512.2" was not found
[E::faidx_adjust_position] The sequence "NC_045512.2" was not found
[E::faidx_adjust_position] The sequence "NC_045512.2" was not found
[E::faidx_adjust_position] The sequence "NC_045512.2" was not found
[E::faidx_adjust_position] The sequence "NC_045512.2" was not found
[E::faidx_adjust_position] The sequence "NC_045512.2" was not found
[E::faidx_adjust_position] The sequence "NC_045512.2" was not found
[E::faidx_adjust_position] The sequence "NC_045512.2" was not found
[E::faidx_adjust_position] The sequence "NC_045512.2" was not found
[E::faidx_adjust_position] The sequence "NC_045512.2" was not found
[E::faidx_adjust_position] The sequence "NC_045512.2" was not found
[E::faidx_adjust_position] The sequence "NC_045512.2" was not found
[E::faidx_adjust_position] The sequence "NC_045512.2" was not found
[E::faidx_adjust_position] The sequence "NC_045512.2" was not found
[E::faidx_adjust_position] The sequence "NC_045512.2" was not found
[E::faidx_adjust_position] The sequence "NC_045512.2" was not found
[E::faidx_adjust_position] The sequence "NC_045512.2" was not found
[E::faidx_adjust_position] The sequence "NC_045512.2" was not found
[E::faidx_adjust_position] The sequence "NC_045512.2" was not found
[E::faidx_adjust_position] The sequence "NC_045512.2" was not found
[E::faidx_adjust_position] The sequence "NC_045512.2" was not found
[E::faidx_adjust_position] The sequence "NC_045512.2" was not found
[E::faidx_adjust_position] The sequence "NC_045512.2" was not found
[E::faidx_adjust_position] The sequence "NC_045512.2" was not found
[E::faidx_adjust_position] The sequence "NC_045512.2" was not found
[E::faidx_adjust_position] The sequence "NC_045512.2" was not found
[E::faidx_adjust_position] The sequence "NC_045512.2" was not found
[E::faidx_adjust_position] The sequence "NC_045512.2" was not found
[E::faidx_adjust_position] The sequence "NC_045512.2" was not found
[E::faidx_adjust_position] The sequence "NC_045512.2" was not found
[E::faidx_adjust_position] The sequence "NC_045512.2" was not found
[E::faidx_adjust_position] The sequence "NC_045512.2" was not found
[E::faidx_adjust_position] The sequence "NC_045512.2" was not found
[E::faidx_adjust_position] The sequence "NC_045512.2" was not found
[E::faidx_adjust_position] The sequence "NC_045512.2" was not found
[E::faidx_adjust_position] The sequence "NC_045512.2" was not found
[E::faidx_adjust_position] The sequence "NC_045512.2" was not found
[E::faidx_adjust_position] The sequence "NC_045512.2" was not found
[E::faidx_adjust_position] The sequence "NC_045512.2" was not found
[E::faidx_adjust_position] The sequence "NC_045512.2" was not found
[E::faidx_adjust_position] The sequence "NC_045512.2" was not found
[E::faidx_adjust_position] The sequence "NC_045512.2" was not found
[E::faidx_adjust_position] The sequence "NC_045512.2" was not found
[E::faidx_adjust_position] The sequence "NC_045512.2" was not found
[E::faidx_adjust_position] The sequence "NC_045512.2" was not found
[E::faidx_adjust_position] The sequence "NC_045512.2" was not found
[E::faidx_adjust_position] The sequence "NC_045512.2" was not found
[E::faidx_adjust_position] The sequence "NC_045512.2" was not found
[E::faidx_adjust_position] The sequence "NC_045512.2" was not found
[E::faidx_adjust_position] The sequence "NC_045512.2" was not found
[E::faidx_adjust_position] The sequence "NC_045512.2" was not found
[E::faidx_adjust_position] The sequence "NC_045512.2" was not found
[E::faidx_adjust_position] The sequence "NC_045512.2" was not found
[E::faidx_adjust_position] The sequence "NC_045512.2" was not found
[E::faidx_adjust_position] The sequence "NC_045512.2" was not found
[E::faidx_adjust_position] The sequence "NC_045512.2" was not found
[E::faidx_adjust_position] The sequence "NC_045512.2" was not found
[E::faidx_adjust_position] The sequence "NC_045512.2" was not found
[E::faidx_adjust_position] The sequence "NC_045512.2" was not found
[E::faidx_adjust_position] The sequence "NC_045512.2" was not found
[E::faidx_adjust_position] The sequence "NC_045512.2" was not found
[E::faidx_adjust_position] The sequence "NC_045512.2" was not found
[E::faidx_adjust_position] The sequence "NC_045512.2" was not found
[E::faidx_adjust_position] The sequence "NC_045512.2" was not found
[E::faidx_adjust_position] The sequence "NC_045512.2" was not found
[E::faidx_adjust_position] The sequence "NC_045512.2" was not found
[E::faidx_adjust_position] The sequence "NC_045512.2" was not found
[E::faidx_adjust_position] The sequence "NC_045512.2" was not found
[E::faidx_adjust_position] The sequence "NC_045512.2" was not found
[E::faidx_adjust_position] The sequence "NC_045512.2" was not found
[E::faidx_adjust_position] The sequence "NC_045512.2" was not found
[E::faidx_adjust_position] The sequence "NC_045512.2" was not found
[E::faidx_adjust_position] The sequence "NC_045512.2" was not found
[E::faidx_adjust_position] The sequence "NC_045512.2" was not found
[E::faidx_adjust_position] The sequence "NC_045512.2" was not found
[E::faidx_adjust_position] The sequence "NC_045512.2" was not found
[E::faidx_adjust_position] The sequence "NC_045512.2" was not found
[E::faidx_adjust_position] The sequence "NC_045512.2" was not found
[E::faidx_adjust_position] The sequence "NC_045512.2" was not found
[E::faidx_adjust_position] The sequence "NC_045512.2" was not found
[E::faidx_adjust_position] The sequence "NC_045512.2" was not found
[E::faidx_adjust_position] The sequence "NC_045512.2" was not found
[E::faidx_adjust_position] The sequence "NC_045512.2" was not found
[E::faidx_adjust_position] The sequence "NC_045512.2" was not found
[E::faidx_adjust_position] The sequence "NC_045512.2" was not found
[E::faidx_adjust_position] The sequence "NC_045512.2" was not found
[E::faidx_adjust_position] The sequence "NC_045512.2" was not found
[E::faidx_adjust_position] The sequence "NC_045512.2" was not found
[E::faidx_adjust_position] The sequence "NC_045512.2" was not found
[E::faidx_adjust_position] The sequence "NC_045512.2" was not found
[E::faidx_adjust_position] The sequence "NC_045512.2" was not found
[E::faidx_adjust_position] The sequence "NC_045512.2" was not found
[E::faidx_adjust_position] The sequence "NC_045512.2" was not found
[E::faidx_adjust_position] The sequence "NC_045512.2" was not found
[E::faidx_adjust_position] The sequence "NC_045512.2" was not found
[E::faidx_adjust_position] The sequence "NC_045512.2" was not found
[E::faidx_adjust_position] The sequence "NC_045512.2" was not found
[E::faidx_adjust_position] The sequence "NC_045512.2" was not found
[E::faidx_adjust_position] The sequence "NC_045512.2" was not found
[E::faidx_adjust_position] The sequence "NC_045512.2" was not found

Standard Output:

A GFF file containing the open reading frames (ORFs) has not been provided. Amino acid translation will not be done.
A reference sequence has not been supplied. Amino acid translation will not be done.
sample	DEL	INS	SNP
variants	0	0	29782

Traceback:

Job Parameters:

Job parameter	Parameter value
__input_ext	`"input"`
__workflow_invocation_uuid__	`"23db0b38e47e11efb46f7c1e523efbde"`
chromInfo	`"/tmp/tmp159oh6h9/galaxy-dev/tool-data/shared/ucsc/chrom/?.len"`
dbkey	`"?"`
min_freq	`"0.7"`
min_qual	`"20"`
output_format	`{"__current_case__": 1, "choice": "tabular_and_vcf", "gtf": null, "pass_only": false}`

Step 15: toolshed.g2.bx.psu.edu/repos/iuc/ivar_consensus/ivar_consensus/1.4.2+galaxy0:

step_state: scheduled

Jobs

Job 1:

Job state is ok

Command Line:

ln -s '/tmp/tmp159oh6h9/files/f/3/2/dataset_f326c0b6-dac9-4c8b-bfd4-e89b41dd7d55.dat' sorted.bam && samtools mpileup -A -a -d 0 -Q 0 sorted.bam | ivar consensus -p consensus -q 20 -t 0.7 -c 0.8 -m 50 -n N && sed -i "s|consensus|ERR4970105|" consensus.fa

Exit Code:

```
0
```

Standard Error:

[mpileup] 1 samples in 1 input files
[mpileup] Max depth set to maximum value (2147483647)

Standard Output:

Minimum Quality: 20
Threshold: 0.7
Minimum depth: 50
Minimum Insert Threshold: 0.8
Regions with depth less than minimum depth covered by: N
Reference length: 29903
Positions with 0 depth: 121
Positions with depth below 50: 121

Traceback:

Job Parameters:

Job parameter	Parameter value
__input_ext	`"input"`
__workflow_invocation_uuid__	`"23db0b38e47e11efb46f7c1e523efbde"`
chromInfo	`"/tmp/tmp159oh6h9/galaxy-dev/tool-data/shared/ucsc/chrom/?.len"`
dbkey	`"?"`
depth_action	`"-n N"`
filter_depth	`"false"`
gap	`"true"`
min_depth	`"50"`
min_freq	`"0.7"`
min_indel_freq	`"0.8"`
min_qual	`"20"`

Step 16: Quality Control Report:

step_state: scheduled

Jobs

Job 1:

Job state is ok

Command Line:

die() { echo "$@" 1>&2 ; exit 1; } &&  mkdir multiqc_WDir &&   mkdir multiqc_WDir/fastp_0 &&    ln -s '/tmp/tmp159oh6h9/files/7/5/9/dataset_75989557-cf31-455b-bc3d-445846e4d65a.dat' 'multiqc_WDir/fastp_0/ERR4970105fastp.json' && grep -q "report_title" 'multiqc_WDir/fastp_0/ERR4970105fastp.json' || die "'report_title' or 'report_title' not found in the file" && mkdir multiqc_WDir/samtools_1 &&    mkdir 'multiqc_WDir/samtools_1/stats_0' &&      grep -q 'This file was produced by samtools stats' /tmp/tmp159oh6h9/files/9/d/d/dataset_9dd93237-450b-419a-929e-9ee0d052dbf9.dat || die "Module 'samtools: 'This file was produced by samtools stats' not found in the file 'ERR4970105'" && ln -s '/tmp/tmp159oh6h9/files/9/d/d/dataset_9dd93237-450b-419a-929e-9ee0d052dbf9.dat' 'multiqc_WDir/samtools_1/stats_0/ERR4970105'  &&    mkdir multiqc_WDir/qualimap_2 &&  sample="$(grep 'bam file = ' /tmp/tmp159oh6h9/files/3/f/3/dataset_3f37865f-314d-483b-8a9a-76b29787ad80.dat | sed 's/bam file = //g' | sed 's: ::g')" && dir_name="multiqc_WDir/qualimap_2/${sample}" && mkdir -p ${dir_name} && filepath_1="${dir_name}/genome_results.txt" && ln -sf '/tmp/tmp159oh6h9/files/3/f/3/dataset_3f37865f-314d-483b-8a9a-76b29787ad80.dat' ${filepath_1} && nested_dir_name="${dir_name}/raw_data_qualimapReport/" && mkdir -p ${nested_dir_name} && filepath_2="${nested_dir_name}/coverage_histogram.txt" && ln -sf '/tmp/tmp159oh6h9/files/9/1/6/dataset_91628b29-c61d-44c6-a472-07040b62bee2.dat' ${filepath_2} && nested_dir_name="${dir_name}/raw_data_qualimapReport/" && mkdir -p ${nested_dir_name} && filepath_3="${nested_dir_name}/mapped_reads_gc-content_distribution.txt" && ln -sf '/tmp/tmp159oh6h9/files/f/5/5/dataset_f553a160-f2c4-47f5-9287-e4f33009c4ca.dat' ${filepath_3} &&   multiqc multiqc_WDir --filename 'report'

Exit Code:

```
0
```

Standard Error:

  /// MultiQC 🔍 | v1.11

|           multiqc | MultiQC Version v1.27 now available!
|           multiqc | Search path : /tmp/tmp159oh6h9/job_working_directory/000/15/working/multiqc_WDir
|          qualimap | Found 1 BamQC reports
|          samtools | Found 1 stats reports
|             fastp | Found 1 reports
|           multiqc | Compressing plot data
|           multiqc | Report      : report.html
|           multiqc | Data        : report_data
|           multiqc | MultiQC complete

Standard Output:

|         searching | ━━━━━━━━━━━━━━━━━━━━━━━━━━━━━━━━━━━━━━━━ 100% 5/5

Traceback:

Job Parameters:

Job parameter	Parameter value
__input_ext	`"input"`
__workflow_invocation_uuid__	`"23db0b38e47e11efb46f7c1e523efbde"`
chromInfo	`"/tmp/tmp159oh6h9/galaxy-dev/tool-data/shared/ucsc/chrom/?.len"`
comment	`""`
dbkey	`"?"`
export	`false`
flat	`false`
results	`[{"__index__": 0, "software_cond": {"__current_case__": 7, "input": {"values": [{"id": 4, "src": "hdca"}]}, "software": "fastp"}}, {"__index__": 1, "software_cond": {"__current_case__": 24, "output": [{"__index__": 0, "type": {"__current_case__": 0, "input": {"values": [{"id": 6, "src": "hdca"}]}, "type": "stats"}}], "software": "samtools"}}, {"__index__": 2, "software_cond": {"__current_case__": 20, "input": {"values": [{"id": 11, "src": "hdca"}]}, "software": "qualimap"}}]`
saveLog	`false`
title	`""`

Step 17: Annotated variants:

step_state: scheduled

Jobs

Job 1:

Job state is ok

Command Line:

snpEff -Xmx${GALAXY_MEMORY_MB:-8192}m eff -i vcf -o vcf -upDownStreamLen 0 -stats '/tmp/tmp159oh6h9/job_working_directory/000/16/outputs/dataset_75a3fd9a-82c6-458b-aa4a-bc03d5561067.dat' -noLog  NC_045512.2  '/tmp/tmp159oh6h9/files/d/b/4/dataset_db4b6b40-0583-457b-8716-ce2558b3d030.dat' > '/tmp/tmp159oh6h9/job_working_directory/000/16/outputs/dataset_e6fb5719-1844-428e-a6b2-4174edfb191b.dat'  && mkdir '/tmp/tmp159oh6h9/job_working_directory/000/16/outputs/dataset_75a3fd9a-82c6-458b-aa4a-bc03d5561067_files' && mv '/tmp/tmp159oh6h9/job_working_directory/000/16/outputs/dataset_75a3fd9a-82c6-458b-aa4a-bc03d5561067.dat.genes.txt' '/tmp/tmp159oh6h9/job_working_directory/000/16/outputs/dataset_75a3fd9a-82c6-458b-aa4a-bc03d5561067_files/dataset_75a3fd9a-82c6-458b-aa4a-bc03d5561067.dat.genes.txt'

Exit Code:

```
0
```

Traceback:

Job Parameters:

Job parameter	Parameter value
__input_ext	`"vcf"`
__workflow_invocation_uuid__	`"23db0b38e47e11efb46f7c1e523efbde"`
annotations	`None`
chr	`""`
chromInfo	`"/tmp/tmp159oh6h9/galaxy-dev/tool-data/shared/ucsc/chrom/?.len"`
csvStats	`false`
dbkey	`"?"`
filter	`{"__current_case__": 0, "specificEffects": "no"}`
filterOut	`None`
generate_stats	`true`
genome_version	`"NC_045512.2"`
inputFormat	`"vcf"`
intervals	`None`
noLog	`true`
offset	`"default"`
outputConditional	`{"__current_case__": 0, "outputFormat": "vcf"}`
transcripts	`None`
udLength	`"0"`

Step 18: Consensus genome (masked for depth):

step_state: scheduled

Jobs

Job 1:

Job state is ok

Command Line:

sed --sandbox -r -f '/tmp/tmp159oh6h9/job_working_directory/000/17/configs/tmpfhmzpvk8' '/tmp/tmp159oh6h9/files/d/0/7/dataset_d0753a83-0268-4af7-b2ed-689c516eb1d1.dat' > '/tmp/tmp159oh6h9/job_working_directory/000/17/outputs/dataset_6a55d075-2631-4212-b42a-b73721af3183.dat'

Exit Code:

```
0
```

Traceback:

Job Parameters:

Job parameter	Parameter value
__input_ext	`"fasta"`
__workflow_invocation_uuid__	`"23db0b38e47e11efb46f7c1e523efbde"`
adv_opts	`{"__current_case__": 0, "adv_opts_selector": "basic"}`
chromInfo	`"/tmp/tmp159oh6h9/galaxy-dev/tool-data/shared/ucsc/chrom/?.len"`
code	`"/^>/s/Consensus_(.)_threshold_./\\1/"`
dbkey	`"?"`

Step 19: toolshed.g2.bx.psu.edu/repos/bgruening/text_processing/tp_cat/0.1.1:

step_state: scheduled

Jobs

Job 1:

Job state is ok

Command Line:

cat '/tmp/tmp159oh6h9/files/6/a/5/dataset_6a55d075-2631-4212-b42a-b73721af3183.dat' >> '/tmp/tmp159oh6h9/job_working_directory/000/18/outputs/dataset_2f77381d-e0cb-4f8d-8966-b5a4312db19a.dat' && exit 0

Exit Code:

```
0
```

Traceback:

Job Parameters:

Job parameter	Parameter value
__input_ext	`"fasta"`
__workflow_invocation_uuid__	`"23db0b38e47e11efb46f7c1e523efbde"`
chromInfo	`"/tmp/tmp159oh6h9/galaxy-dev/tool-data/shared/ucsc/chrom/?.len"`
dbkey	`"?"`
queries	`[]`

Step 20: toolshed.g2.bx.psu.edu/repos/iuc/pangolin/pangolin/4.3+galaxy1:

step_state: scheduled

Jobs

Job 1:

Job state is ok

Command Line:

ln -s '/tmp/tmp159oh6h9/files/2/f/7/dataset_2f77381d-e0cb-4f8d-8966-b5a4312db19a.dat' query.fa && pangolin --threads ${GALAXY_SLOTS:-1} --tempdir "${TMPDIR:-.}" --analysis-mode usher --outfile report.csv --max-ambig 0.5 --min-length 10000  query.fa && csvtk csv2tab report.csv > '/tmp/tmp159oh6h9/job_working_directory/000/19/outputs/dataset_4f5b414a-0bc4-4b06-8db1-6c93b8912838.dat'

Exit Code:

```
0
```

Standard Error:

Building DAG of jobs...
Using shell: /bin/bash
Provided cores: 1 (use --cores to define parallelism)
Rules claiming more threads will be scaled down.
Job stats:
job                      count    min threads    max threads
---------------------  -------  -------------  -------------
align_to_reference           1              1              1
all                          1              1              1
cache_sequence_assign        1              1              1
create_seq_hash              1              1              1
get_constellations           1              1              1
merged_info                  1              1              1
scorpio                      1              1              1
sequence_qc                  1              1              1
total                        8              1              1

Select jobs to execute...
Building DAG of jobs...
Using shell: /bin/bash
Provided cores: 1 (use --cores to define parallelism)
Rules claiming more threads will be scaled down.
Select jobs to execute...
Select jobs to execute...
Building DAG of jobs...
Using shell: /bin/bash
Provided cores: 1 (use --cores to define parallelism)
Rules claiming more threads will be scaled down.
Select jobs to execute...
Select jobs to execute...
Building DAG of jobs...
Using shell: /bin/bash
Provided cores: 1 (use --cores to define parallelism)
Rules claiming more threads will be scaled down.
Select jobs to execute...
Select jobs to execute...
Building DAG of jobs...
Using shell: /bin/bash
Provided cores: 1 (use --cores to define parallelism)
Rules claiming more threads will be scaled down.
Select jobs to execute...
Select jobs to execute...
Building DAG of jobs...
Using shell: /bin/bash
Provided cores: 1 (use --cores to define parallelism)
Rules claiming more threads will be scaled down.
Select jobs to execute...
Select jobs to execute...
Building DAG of jobs...
Using shell: /bin/bash
Provided cores: 1 (use --cores to define parallelism)
Rules claiming more threads will be scaled down.
Select jobs to execute...
Select jobs to execute...
Building DAG of jobs...
Using shell: /bin/bash
Provided cores: 1 (use --cores to define parallelism)
Rules claiming more threads will be scaled down.
Select jobs to execute...
Select jobs to execute...
Complete log: .snakemake/log/2025-02-06T113827.568740.snakemake.log
Building DAG of jobs...
Using shell: /bin/bash
Provided cores: 1 (use --cores to define parallelism)
Rules claiming more threads will be scaled down.
Job stats:
job                count    min threads    max threads
---------------  -------  -------------  -------------
all                    1              1              1
usher_cache            1              1              1
usher_inference        1              1              1
usher_to_report        1              1              1
total                  4              1              1

Select jobs to execute...
Building DAG of jobs...
Using shell: /bin/bash
Provided cores: 1 (use --cores to define parallelism)
Rules claiming more threads will be scaled down.
Select jobs to execute...
Select jobs to execute...
Select jobs to execute...
Building DAG of jobs...
Using shell: /bin/bash
Provided cores: 1 (use --cores to define parallelism)
Rules claiming more threads will be scaled down.
Select jobs to execute...
Select jobs to execute...
Complete log: .snakemake/log/2025-02-06T113837.721174.snakemake.log

Standard Output:

�[32m****
Query sequences collapsed from �[0m1�[32m to �[0m1�[32m unique sequences.�[0m
�[32m****
�[0m1�[32m sequences assigned via designations.�[0m
�[32m****
Running sequence QC�[0m
�[32mTotal passing QC: �[0m1
Using UShER as inference engine.
�[32m****
Pangolin running in usher mode.
****�[0m
Converting minimum length of 10000.0 to maximum ambiguity of 0.666.
�[32mMaximum ambiguity allowed is 0.5.
****�[0m
�[32mQuery file:	�[0m/tmp/tmp159oh6h9/job_working_directory/000/19/working/query.fa
�[32m****
Data files found:�[0m
usher_pb:	/usr/local/lib/python3.8/site-packages/pangolin_data/data/lineageTree.pb
�[32m****�[0m
�[32m****
Output file written to: �[0m/tmp/tmp159oh6h9/job_working_directory/000/19/working/report.csv

Traceback:

Job Parameters:

Job parameter	Parameter value
__input_ext	`"input"`
__workflow_invocation_uuid__	`"23db0b38e47e11efb46f7c1e523efbde"`
alignment	`false`
chromInfo	`"/tmp/tmp159oh6h9/galaxy-dev/tool-data/shared/ucsc/chrom/?.len"`
constellations	`{"__current_case__": 0, "source": "default"}`
db	`{"__current_case__": 0, "source": "download"}`
dbkey	`"?"`
engine	`{"__current_case__": 0, "analysis_mode": "usher", "pangolin_data": {"__current_case__": 0, "source": "default"}}`
expanded_lineage	`false`
include_header	`true`
max_ambig	`"0.5"`
min_length	`"10000"`
usher	`"false"`

Step 3: Primer BED:
- step_state: scheduled

Step 21: toolshed.g2.bx.psu.edu/repos/iuc/nextclade/nextclade/2.7.0+galaxy0:

step_state: scheduled

Jobs

Job 1:

Job state is ok

Command Line:

nextclade dataset get -n 'sars-cov-2' -o db &&  ln -s '/tmp/tmp159oh6h9/files/2/f/7/dataset_2f77381d-e0cb-4f8d-8966-b5a4312db19a.dat' query.fa &&  nextclade run --input-dataset db/ --output-tsv '/tmp/tmp159oh6h9/job_working_directory/000/20/outputs/dataset_1936e9b9-97a0-425d-9eed-61258b4dd43b.dat' query.fa

Exit Code:

```
0
```

Traceback:

Job Parameters:

Job parameter	Parameter value
__input_ext	`"input"`
__workflow_invocation_uuid__	`"23db0b38e47e11efb46f7c1e523efbde"`
adv	`{"__current_case__": 1, "advanced_options": "no"}`
chromInfo	`"/tmp/tmp159oh6h9/galaxy-dev/tool-data/shared/ucsc/chrom/?.len"`
db	`{"__current_case__": 1, "source": "download"}`
dbkey	`"?"`
include_header	`true`
organism	`"sars-cov-2"`
outputs	`["report_tsv"]`

Step 4: Read fraction to call variant:
- step_state: scheduled
Step 5: Minimum quality score to call base:
- step_state: scheduled

Step 6: fastp: Trimmed Illumina Reads:

step_state: scheduled

Jobs

Job 1:

Job state is ok

Command Line:

ln -s '/tmp/tmp159oh6h9/files/5/d/3/dataset_5d31b9fd-1dbe-4b86-bcc6-3c0f9bc5041a.dat' 'ERR4970105.fastq.gz' && ln -s '/tmp/tmp159oh6h9/files/2/8/8/dataset_28822bdc-093d-4f21-8332-43acafac2759.dat' 'ERR4970105_R2.fastq.gz' &&    fastp  --thread ${GALAXY_SLOTS:-1} --report_title 'fastp report for ERR4970105.fastq.gz'   -i 'ERR4970105.fastq.gz' -o first.fastq.gz  -I 'ERR4970105_R2.fastq.gz' -O second.fastq.gz       --detect_adapter_for_pe                                          &&  mv first.fastq.gz '/tmp/tmp159oh6h9/job_working_directory/000/5/outputs/dataset_5ab2873e-b3ea-47c8-928c-1c0b3aeeb315.dat' && mv second.fastq.gz '/tmp/tmp159oh6h9/job_working_directory/000/5/outputs/dataset_58977187-4bd5-4696-9e86-20b319ff6976.dat'

Exit Code:

```
0
```

Standard Error:

Detecting adapter sequence for read1...
CTCTCCTAGCACCATCATCATACACAGTTCTTGCTGTCATAAGGATTAGTAACACTACAG

Detecting adapter sequence for read2...
CTCTCCTAGCACCATCATCATACACAGTTCTTGCTGTCATAAGGATTAGTAACACTACAG

Read1 before filtering:
total reads: 707690
total bases: 97405232
Q20 bases: 93166566(95.6484%)
Q30 bases: 89404089(91.7857%)

Read2 before filtering:
total reads: 707690
total bases: 97415128
Q20 bases: 93483015(95.9635%)
Q30 bases: 89513507(91.8887%)

Read1 after filtering:
total reads: 696698
total bases: 95828657
Q20 bases: 91755464(95.7495%)
Q30 bases: 88071968(91.9057%)

Read2 after filtering:
total reads: 696698
total bases: 95840876
Q20 bases: 92079323(96.0752%)
Q30 bases: 88192318(92.0195%)

Filtering result:
reads passed filter: 1393396
reads failed due to low quality: 5474
reads failed due to too many N: 8
reads failed due to too short: 16502
reads with adapter trimmed: 12822
bases trimmed due to adapters: 646899

Duplication rate: 21.3582%

Insert size peak (evaluated by paired-end reads): 180

JSON report: fastp.json
HTML report: fastp.html

fastp --thread 1 --report_title fastp report for ERR4970105.fastq.gz -i ERR4970105.fastq.gz -o first.fastq.gz -I ERR4970105_R2.fastq.gz -O second.fastq.gz --detect_adapter_for_pe 
fastp v0.23.2, time used: 22 seconds

Traceback:

Job Parameters:

Job parameter	Parameter value
__input_ext	`"fastqsanger.gz"`
__workflow_invocation_uuid__	`"23db0b38e47e11efb46f7c1e523efbde"`
chromInfo	`"/tmp/tmp159oh6h9/galaxy-dev/tool-data/shared/ucsc/chrom/?.len"`
dbkey	`"?"`
filter_options	`{"length_filtering_options": {"disable_length_filtering": false, "length_limit": null, "length_required": null}, "low_complexity_filter": {"complexity_threshold": null, "enable_low_complexity_filter": false}, "quality_filtering_options": {"disable_quality_filtering": false, "n_base_limit": null, "qualified_quality_phred": null, "unqualified_percent_limit": null}}`
output_options	`{"report_html": true, "report_json": true}`
overrepresented_sequence_analysis	`{"overrepresentation_analysis": false, "overrepresentation_sampling": null}`
read_mod_options	`{"base_correction_options": {"correction": false}, "cutting_by_quality_options": {"cut_by_quality3": false, "cut_by_quality5": false, "cut_mean_quality": null, "cut_window_size": null}, "polyg_tail_trimming": {"__current_case__": 1, "poly_g_min_len": null, "trimming_select": ""}, "polyx_tail_trimming": {"__current_case__": 1, "polyx_trimming_select": ""}, "umi_processing": {"umi": false, "umi_len": null, "umi_loc": "", "umi_prefix": ""}}`
single_paired	`{"__current_case__": 2, "adapter_trimming_options": {"adapter_sequence1": "", "adapter_sequence2": "", "disable_adapter_trimming": false}, "global_trimming_options": {"trim_front1": null, "trim_front2": null, "trim_tail1": null, "trim_tail2": null}, "paired_input": {"values": [{"id": 1, "src": "dce"}]}, "single_paired_selector": "paired_collection"}`

Step 7: Rename reference to NC_045512.2:

step_state: scheduled

Jobs

Job 1:

Job state is ok

Command Line:

sed --sandbox -r -f '/tmp/tmp159oh6h9/job_working_directory/000/6/configs/tmpta029__o' '/tmp/tmp159oh6h9/files/6/2/7/dataset_627d5910-8b40-424f-9d44-9bd5ee21ab01.dat' > '/tmp/tmp159oh6h9/job_working_directory/000/6/outputs/dataset_755c9aa6-77e4-4823-8087-e98ac175cf27.dat'

Exit Code:

```
0
```

Traceback:

Job Parameters:

Job parameter	Parameter value
__input_ext	`"fasta"`
__workflow_invocation_uuid__	`"23db0b38e47e11efb46f7c1e523efbde"`
adv_opts	`{"__current_case__": 0, "adv_opts_selector": "basic"}`
chromInfo	`"/tmp/tmp159oh6h9/galaxy-dev/tool-data/shared/ucsc/chrom/?.len"`
code	`"/^>/s/^>MN908947.3/>NC_045512.2/"`
dbkey	`"?"`

Step 8: toolshed.g2.bx.psu.edu/repos/devteam/bwa/bwa_mem/0.7.17.2:

step_state: scheduled

Jobs

Job 1:

Job state is ok

Command Line:

set -o | grep -q pipefail && set -o pipefail;  ln -s '/tmp/tmp159oh6h9/files/7/5/5/dataset_755c9aa6-77e4-4823-8087-e98ac175cf27.dat' 'localref.fa' && bwa index 'localref.fa' &&    bwa mem  -t "${GALAXY_SLOTS:-1}" -v 1                 'localref.fa' '/tmp/tmp159oh6h9/files/5/a/b/dataset_5ab2873e-b3ea-47c8-928c-1c0b3aeeb315.dat' '/tmp/tmp159oh6h9/files/5/8/9/dataset_58977187-4bd5-4696-9e86-20b319ff6976.dat'  | samtools sort -@${GALAXY_SLOTS:-2} -T "${TMPDIR:-.}" -O bam -o '/tmp/tmp159oh6h9/job_working_directory/000/7/outputs/dataset_82b77205-1b88-47b2-a31f-75c78dfd894a.dat'

Exit Code:

```
0
```

Standard Error:

[bwa_index] Pack FASTA... 0.00 sec
[bwa_index] Construct BWT for the packed sequence...
[bwa_index] 0.00 seconds elapse.
[bwa_index] Update BWT... 0.00 sec
[bwa_index] Pack forward-only FASTA... 0.00 sec
[bwa_index] Construct SA from BWT and Occ... 0.00 sec
[main] Version: 0.7.17-r1188
[main] CMD: bwa index localref.fa
[main] Real time: 0.012 sec; CPU: 0.008 sec
[M::mem_pestat] skip orientation FF as there are not enough pairs
[M::mem_pestat] analyzing insert size distribution for orientation FR...
[M::mem_pestat] (25, 50, 75) percentile: (130, 183, 250)
[M::mem_pestat] low and high boundaries for computing mean and std.dev: (1, 490)
[M::mem_pestat] mean and std.dev: (192.95, 81.20)
[M::mem_pestat] low and high boundaries for proper pairs: (1, 610)
[M::mem_pestat] skip orientation RF as there are not enough pairs
[M::mem_pestat] skip orientation RR as there are not enough pairs
[M::mem_pestat] skip orientation FF as there are not enough pairs
[M::mem_pestat] analyzing insert size distribution for orientation FR...
[M::mem_pestat] (25, 50, 75) percentile: (139, 196, 270)
[M::mem_pestat] low and high boundaries for computing mean and std.dev: (1, 532)
[M::mem_pestat] mean and std.dev: (204.90, 83.45)
[M::mem_pestat] low and high boundaries for proper pairs: (1, 663)
[M::mem_pestat] analyzing insert size distribution for orientation RF...
[M::mem_pestat] (25, 50, 75) percentile: (290, 300, 443)
[M::mem_pestat] low and high boundaries for computing mean and std.dev: (1, 749)
[M::mem_pestat] mean and std.dev: (360.62, 102.45)
[M::mem_pestat] low and high boundaries for proper pairs: (1, 902)
[M::mem_pestat] skip orientation RR as there are not enough pairs
[M::mem_pestat] skip orientation RF
[M::mem_pestat] skip orientation FF as there are not enough pairs
[M::mem_pestat] analyzing insert size distribution for orientation FR...
[M::mem_pestat] (25, 50, 75) percentile: (136, 186, 265)
[M::mem_pestat] low and high boundaries for computing mean and std.dev: (1, 523)
[M::mem_pestat] mean and std.dev: (199.40, 83.35)
[M::mem_pestat] low and high boundaries for proper pairs: (1, 652)
[M::mem_pestat] analyzing insert size distribution for orientation RF...
[M::mem_pestat] (25, 50, 75) percentile: (813, 882, 897)
[M::mem_pestat] low and high boundaries for computing mean and std.dev: (645, 1065)
[M::mem_pestat] mean and std.dev: (882.10, 28.87)
[M::mem_pestat] low and high boundaries for proper pairs: (561, 1149)
[M::mem_pestat] skip orientation RR as there are not enough pairs
[M::mem_pestat] skip orientation RF
[M::mem_pestat] skip orientation FF as there are not enough pairs
[M::mem_pestat] analyzing insert size distribution for orientation FR...
[M::mem_pestat] (25, 50, 75) percentile: (143, 209, 286)
[M::mem_pestat] low and high boundaries for computing mean and std.dev: (1, 572)
[M::mem_pestat] mean and std.dev: (214.20, 87.11)
[M::mem_pestat] low and high boundaries for proper pairs: (1, 715)
[M::mem_pestat] analyzing insert size distribution for orientation RF...
[M::mem_pestat] (25, 50, 75) percentile: (255, 270, 376)
[M::mem_pestat] low and high boundaries for computing mean and std.dev: (13, 618)
[M::mem_pestat] mean and std.dev: (282.23, 41.67)
[M::mem_pestat] low and high boundaries for proper pairs: (1, 739)
[M::mem_pestat] skip orientation RR as there are not enough pairs
[M::mem_pestat] skip orientation RF
[M::mem_pestat] skip orientation FF as there are not enough pairs
[M::mem_pestat] analyzing insert size distribution for orientation FR...
[M::mem_pestat] (25, 50, 75) percentile: (150, 209, 287)
[M::mem_pestat] low and high boundaries for computing mean and std.dev: (1, 561)
[M::mem_pestat] mean and std.dev: (216.92, 86.29)
[M::mem_pestat] low and high boundaries for proper pairs: (1, 698)
[M::mem_pestat] skip orientation RF as there are not enough pairs
[M::mem_pestat] skip orientation RR as there are not enough pairs
[M::mem_pestat] analyzing insert size distribution for orientation FF...
[M::mem_pestat] (25, 50, 75) percentile: (115, 176, 216)
[M::mem_pestat] low and high boundaries for computing mean and std.dev: (1, 418)
[M::mem_pestat] mean and std.dev: (158.75, 57.01)
[M::mem_pestat] low and high boundaries for proper pairs: (1, 519)
[M::mem_pestat] analyzing insert size distribution for orientation FR...
[M::mem_pestat] (25, 50, 75) percentile: (137, 195, 271)
[M::mem_pestat] low and high boundaries for computing mean and std.dev: (1, 539)
[M::mem_pestat] mean and std.dev: (203.52, 83.62)
[M::mem_pestat] low and high boundaries for proper pairs: (1, 673)
[M::mem_pestat] analyzing insert size distribution for orientation RF...
[M::mem_pestat] (25, 50, 75) percentile: (266, 302, 4639)
[M::mem_pestat] low and high boundaries for computing mean and std.dev: (1, 13385)
[M::mem_pestat] mean and std.dev: (2099.47, 2124.22)
[M::mem_pestat] low and high boundaries for proper pairs: (1, 17758)
[M::mem_pestat] analyzing insert size distribution for orientation RR...
[M::mem_pestat] (25, 50, 75) percentile: (136, 150, 200)
[M::mem_pestat] low and high boundaries for computing mean and std.dev: (8, 328)
[M::mem_pestat] mean and std.dev: (159.05, 47.82)
[M::mem_pestat] low and high boundaries for proper pairs: (1, 392)
[M::mem_pestat] skip orientation FF
[M::mem_pestat] skip orientation RF
[M::mem_pestat] skip orientation RR
[M::mem_pestat] skip orientation FF as there are not enough pairs
[M::mem_pestat] analyzing insert size distribution for orientation FR...
[M::mem_pestat] (25, 50, 75) percentile: (145, 204, 274)
[M::mem_pestat] low and high boundaries for computing mean and std.dev: (1, 532)
[M::mem_pestat] mean and std.dev: (209.72, 85.57)
[M::mem_pestat] low and high boundaries for proper pairs: (1, 661)
[M::mem_pestat] analyzing insert size distribution for orientation RF...
[M::mem_pestat] (25, 50, 75) percentile: (428, 567, 992)
[M::mem_pestat] low and high boundaries for computing mean and std.dev: (1, 2120)
[M::mem_pestat] mean and std.dev: (576.70, 310.31)
[M::mem_pestat] low and high boundaries for proper pairs: (1, 2684)
[M::mem_pestat] skip orientation RR as there are not enough pairs
[M::mem_pestat] skip orientation RF
[M::mem_pestat] skip orientation FF as there are not enough pairs
[M::mem_pestat] analyzing insert size distribution for orientation FR...
[M::mem_pestat] (25, 50, 75) percentile: (141, 204, 283)
[M::mem_pestat] low and high boundaries for computing mean and std.dev: (1, 567)
[M::mem_pestat] mean and std.dev: (211.20, 85.86)
[M::mem_pestat] low and high boundaries for proper pairs: (1, 709)
[M::mem_pestat] analyzing insert size distribution for orientation RF...
[M::mem_pestat] (25, 50, 75) percentile: (300, 391, 4477)
[M::mem_pestat] low and high boundaries for computing mean and std.dev: (1, 12831)
[M::mem_pestat] mean and std.dev: (1720.00, 1974.77)
[M::mem_pestat] low and high boundaries for proper pairs: (1, 17008)
[M::mem_pestat] skip orientation RR as there are not enough pairs
[M::mem_pestat] skip orientation RF
[M::mem_pestat] skip orientation FF as there are not enough pairs
[M::mem_pestat] analyzing insert size distribution for orientation FR...
[M::mem_pestat] (25, 50, 75) percentile: (136, 184, 263)
[M::mem_pestat] low and high boundaries for computing mean and std.dev: (1, 517)
[M::mem_pestat] mean and std.dev: (198.45, 84.26)
[M::mem_pestat] low and high boundaries for proper pairs: (1, 644)
[M::mem_pestat] skip orientation RF as there are not enough pairs
[M::mem_pestat] skip orientation RR as there are not enough pairs
[M::mem_pestat] skip orientation FF as there are not enough pairs
[M::mem_pestat] analyzing insert size distribution for orientation FR...
[M::mem_pestat] (25, 50, 75) percentile: (142, 205, 272)
[M::mem_pestat] low and high boundaries for computing mean and std.dev: (1, 532)
[M::mem_pestat] mean and std.dev: (207.61, 82.10)
[M::mem_pestat] low and high boundaries for proper pairs: (1, 662)
[M::mem_pestat] skip orientation RF as there are not enough pairs
[M::mem_pestat] skip orientation RR as there are not enough pairs
[M::mem_pestat] skip orientation FF as there are not enough pairs
[M::mem_pestat] analyzing insert size distribution for orientation FR...
[M::mem_pestat] (25, 50, 75) percentile: (139, 203, 279)
[M::mem_pestat] low and high boundaries for computing mean and std.dev: (1, 559)
[M::mem_pestat] mean and std.dev: (209.05, 86.27)
[M::mem_pestat] low and high boundaries for proper pairs: (1, 699)
[M::mem_pestat] skip orientation RF as there are not enough pairs
[M::mem_pestat] skip orientation RR as there are not enough pairs
[M::mem_pestat] skip orientation FF as there are not enough pairs
[M::mem_pestat] analyzing insert size distribution for orientation FR...
[M::mem_pestat] (25, 50, 75) percentile: (130, 189, 270)
[M::mem_pestat] low and high boundaries for computing mean and std.dev: (1, 550)
[M::mem_pestat] mean and std.dev: (201.34, 88.48)
[M::mem_pestat] low and high boundaries for proper pairs: (1, 690)
[M::mem_pestat] analyzing insert size distribution for orientation RF...
[M::mem_pestat] (25, 50, 75) percentile: (934, 1043, 1585)
[M::mem_pestat] low and high boundaries for computing mean and std.dev: (1, 2887)
[M::mem_pestat] mean and std.dev: (1098.42, 421.00)
[M::mem_pestat] low and high boundaries for proper pairs: (1, 3538)
[M::mem_pestat] skip orientation RR as there are not enough pairs
[M::mem_pestat] skip orientation RF
[M::mem_pestat] skip orientation FF as there are not enough pairs
[M::mem_pestat] analyzing insert size distribution for orientation FR...
[M::mem_pestat] (25, 50, 75) percentile: (136, 200, 274)
[M::mem_pestat] low and high boundaries for computing mean and std.dev: (1, 550)
[M::mem_pestat] mean and std.dev: (206.67, 86.89)
[M::mem_pestat] low and high boundaries for proper pairs: (1, 688)
[M::mem_pestat] analyzing insert size distribution for orientation RF...
[M::mem_pestat] (25, 50, 75) percentile: (222, 297, 385)
[M::mem_pestat] low and high boundaries for computing mean and std.dev: (1, 711)
[M::mem_pestat] mean and std.dev: (278.50, 84.25)
[M::mem_pestat] low and high boundaries for proper pairs: (1, 874)
[M::mem_pestat] skip orientation RR as there are not enough pairs
[M::mem_pestat] skip orientation RF
[M::mem_pestat] skip orientation FF as there are not enough pairs
[M::mem_pestat] analyzing insert size distribution for orientation FR...
[M::mem_pestat] (25, 50, 75) percentile: (136, 189, 262)
[M::mem_pestat] low and high boundaries for computing mean and std.dev: (1, 514)
[M::mem_pestat] mean and std.dev: (199.95, 84.39)
[M::mem_pestat] low and high boundaries for proper pairs: (1, 640)
[M::mem_pestat] analyzing insert size distribution for orientation RF...
[M::mem_pestat] (25, 50, 75) percentile: (372, 407, 3499)
[M::mem_pestat] low and high boundaries for computing mean and std.dev: (1, 9753)
[M::mem_pestat] mean and std.dev: (2040.64, 2446.78)
[M::mem_pestat] low and high boundaries for proper pairs: (1, 12880)
[M::mem_pestat] skip orientation RR as there are not enough pairs
[M::mem_pestat] skip orientation RF
[M::mem_pestat] skip orientation FF as there are not enough pairs
[M::mem_pestat] analyzing insert size distribution for orientation FR...
[M::mem_pestat] (25, 50, 75) percentile: (146, 208, 279)
[M::mem_pestat] low and high boundaries for computing mean and std.dev: (1, 545)
[M::mem_pestat] mean and std.dev: (213.16, 83.22)
[M::mem_pestat] low and high boundaries for proper pairs: (1, 678)
[M::mem_pestat] skip orientation RF as there are not enough pairs
[M::mem_pestat] skip orientation RR as there are not enough pairs
[M::mem_pestat] skip orientation FF as there are not enough pairs
[M::mem_pestat] analyzing insert size distribution for orientation FR...
[M::mem_pestat] (25, 50, 75) percentile: (136, 187, 261)
[M::mem_pestat] low and high boundaries for computing mean and std.dev: (1, 511)
[M::mem_pestat] mean and std.dev: (199.31, 84.30)
[M::mem_pestat] low and high boundaries for proper pairs: (1, 636)
[M::mem_pestat] analyzing insert size distribution for orientation RF...
[M::mem_pestat] (25, 50, 75) percentile: (376, 790, 4533)
[M::mem_pestat] low and high boundaries for computing mean and std.dev: (1, 12847)
[M::mem_pestat] mean and std.dev: (2119.62, 2619.33)
[M::mem_pestat] low and high boundaries for proper pairs: (1, 17004)
[M::mem_pestat] skip orientation RR as there are not enough pairs
[M::mem_pestat] skip orientation RF
[M::mem_pestat] skip orientation FF as there are not enough pairs
[M::mem_pestat] analyzing insert size distribution for orientation FR...
[M::mem_pestat] (25, 50, 75) percentile: (140, 199, 267)
[M::mem_pestat] low and high boundaries for computing mean and std.dev: (1, 521)
[M::mem_pestat] mean and std.dev: (204.55, 82.72)
[M::mem_pestat] low and high boundaries for proper pairs: (1, 648)
[M::mem_pestat] skip orientation RF as there are not enough pairs
[M::mem_pestat] skip orientation RR as there are not enough pairs
[M::mem_pestat] skip orientation FF as there are not enough pairs
[M::mem_pestat] analyzing insert size distribution for orientation FR...
[M::mem_pestat] (25, 50, 75) percentile: (130, 189, 267)
[M::mem_pestat] low and high boundaries for computing mean and std.dev: (1, 541)
[M::mem_pestat] mean and std.dev: (200.01, 87.54)
[M::mem_pestat] low and high boundaries for proper pairs: (1, 678)
[M::mem_pestat] analyzing insert size distribution for orientation RF...
[M::mem_pestat] (25, 50, 75) percentile: (387, 508, 4514)
[M::mem_pestat] low and high boundaries for computing mean and std.dev: (1, 12768)
[M::mem_pestat] mean and std.dev: (2167.80, 2908.67)
[M::mem_pestat] low and high boundaries for proper pairs: (1, 16895)
[M::mem_pestat] skip orientation RR as there are not enough pairs
[M::mem_pestat] skip orientation RF
[M::mem_pestat] skip orientation FF as there are not enough pairs
[M::mem_pestat] analyzing insert size distribution for orientation FR...
[M::mem_pestat] (25, 50, 75) percentile: (131, 185, 259)
[M::mem_pestat] low and high boundaries for computing mean and std.dev: (1, 515)
[M::mem_pestat] mean and std.dev: (196.72, 84.31)
[M::mem_pestat] low and high boundaries for proper pairs: (1, 643)
[M::mem_pestat] analyzing insert size distribution for orientation RF...
[M::mem_pestat] (25, 50, 75) percentile: (333, 502, 1062)
[M::mem_pestat] low and high boundaries for computing mean and std.dev: (1, 2520)
[M::mem_pestat] mean and std.dev: (647.26, 361.81)
[M::mem_pestat] low and high boundaries for proper pairs: (1, 3249)
[M::mem_pestat] skip orientation RR as there are not enough pairs
[M::mem_pestat] skip orientation RF
[M::mem_pestat] analyzing insert size distribution for orientation FF...
[M::mem_pestat] (25, 50, 75) percentile: (120, 181, 239)
[M::mem_pestat] low and high boundaries for computing mean and std.dev: (1, 477)
[M::mem_pestat] mean and std.dev: (178.59, 80.72)
[M::mem_pestat] low and high boundaries for proper pairs: (1, 596)
[M::mem_pestat] analyzing insert size distribution for orientation FR...
[M::mem_pestat] (25, 50, 75) percentile: (151, 210, 285)
[M::mem_pestat] low and high boundaries for computing mean and std.dev: (1, 553)
[M::mem_pestat] mean and std.dev: (213.74, 81.61)
[M::mem_pestat] low and high boundaries for proper pairs: (1, 687)
[M::mem_pestat] analyzing insert size distribution for orientation RF...
[M::mem_pestat] (25, 50, 75) percentile: (258, 337, 437)
[M::mem_pestat] low and high boundaries for computing mean and std.dev: (1, 795)
[M::mem_pestat] mean and std.dev: (336.62, 78.55)
[M::mem_pestat] low and high boundaries for proper pairs: (1, 974)
[M::mem_pestat] analyzing insert size distribution for orientation RR...
[M::mem_pestat] (25, 50, 75) percentile: (117, 152, 226)
[M::mem_pestat] low and high boundaries for computing mean and std.dev: (1, 444)
[M::mem_pestat] mean and std.dev: (164.20, 75.05)
[M::mem_pestat] low and high boundaries for proper pairs: (1, 553)
[M::mem_pestat] skip orientation FF
[M::mem_pestat] skip orientation RF
[M::mem_pestat] skip orientation RR
[main] Version: 0.7.17-r1188
[main] CMD: bwa mem -t 1 -v 1 localref.fa /tmp/tmp159oh6h9/files/5/a/b/dataset_5ab2873e-b3ea-47c8-928c-1c0b3aeeb315.dat /tmp/tmp159oh6h9/files/5/8/9/dataset_58977187-4bd5-4696-9e86-20b319ff6976.dat
[main] Real time: 38.671 sec; CPU: 35.156 sec

Traceback:

Job Parameters:

Job parameter	Parameter value
__input_ext	`"fasta"`
__workflow_invocation_uuid__	`"23db0b38e47e11efb46f7c1e523efbde"`
analysis_type	`{"__current_case__": 0, "analysis_type_selector": "illumina"}`
chromInfo	`"/tmp/tmp159oh6h9/galaxy-dev/tool-data/shared/ucsc/chrom/?.len"`
dbkey	`"?"`
fastq_input	`{"__current_case__": 2, "fastq_input1": {"values": [{"id": 4, "src": "dce"}]}, "fastq_input_selector": "paired_collection", "iset_stats": ""}`
output_sort	`"coordinate"`
reference_source	`{"__current_case__": 1, "index_a": "auto", "ref_file": {"values": [{"id": 9, "src": "hda"}]}, "reference_source_selector": "history"}`
rg	`{"__current_case__": 3, "rg_selector": "do_not_set"}`

Step 9: toolshed.g2.bx.psu.edu/repos/devteam/samtools_stats/samtools_stats/2.0.4:

step_state: scheduled

Jobs

Job 1:

Job state is ok

Command Line:

addthreads=${GALAXY_SLOTS:-1} && (( addthreads-- )) &&   ln -s '/tmp/tmp159oh6h9/files/8/2/b/dataset_82b77205-1b88-47b2-a31f-75c78dfd894a.dat' infile && ln -s '/tmp/tmp159oh6h9/files/_metadata_files/3/f/9/metadata_3f9f2d3c-fc5d-4268-9e1a-175b95853237.dat' infile.bai &&       samtools stats       -@ $addthreads infile   > '/tmp/tmp159oh6h9/job_working_directory/000/8/outputs/dataset_9dd93237-450b-419a-929e-9ee0d052dbf9.dat'

Exit Code:

```
0
```

Traceback:

Job Parameters:

Job parameter	Parameter value
__input_ext	`"input"`
__workflow_invocation_uuid__	`"23db0b38e47e11efb46f7c1e523efbde"`
addref_cond	`{"__current_case__": 0, "addref_select": "no"}`
chromInfo	`"/tmp/tmp159oh6h9/galaxy-dev/tool-data/shared/ucsc/chrom/?.len"`
cond_region	`{"__current_case__": 0, "select_region": "no"}`
cov_threshold	`None`
coverage_cond	`{"__current_case__": 0, "coverage_select": "no"}`
dbkey	`"?"`
filter_by_flags	`{"__current_case__": 1, "filter_flags": "nofilter"}`
gc_depth	`None`
insert_size	`None`
most_inserts	`None`
read_group	`None`
read_length	`None`
remove_dups	`false`
remove_overlaps	`false`
sparse	`false`
split_output_cond	`{"__current_case__": 0, "split_output_selector": "no"}`
trim_quality	`None`

Step 10: toolshed.g2.bx.psu.edu/repos/iuc/samtools_view/samtools_view/1.15.1+galaxy0:

step_state: scheduled

Jobs

Job 1:

Job state is ok

Command Line:

addthreads=${GALAXY_SLOTS:-1} && (( addthreads-- )) &&   addmemory=${GALAXY_MEMORY_MB_PER_SLOT:-768} && ((addmemory=addmemory*75/100)) &&        ln -s '/tmp/tmp159oh6h9/files/8/2/b/dataset_82b77205-1b88-47b2-a31f-75c78dfd894a.dat' infile && ln -s '/tmp/tmp159oh6h9/files/_metadata_files/3/f/9/metadata_3f9f2d3c-fc5d-4268-9e1a-175b95853237.dat' infile.bai &&               samtools view -@ $addthreads -b  -q 20 -f 3 -F 0 -G 0    -o outfile      infile

Exit Code:

```
0
```

Traceback:

Job Parameters:

Job parameter	Parameter value
__input_ext	`"input"`
__workflow_invocation_uuid__	`"23db0b38e47e11efb46f7c1e523efbde"`
addref_cond	`{"__current_case__": 0, "addref_select": "no"}`
chromInfo	`"/tmp/tmp159oh6h9/galaxy-dev/tool-data/shared/ucsc/chrom/?.len"`
dbkey	`"?"`
mode	{"__current_case__": 1, "filter_config": {"cigarcons": null, "cond_region": {"__current_case__": 0, "select_region": "no"}, "cond_rg": {"__current_case__": 0, "select_rg": "no"}, "exclusive_filter": null, "exclusive_filter_all": null, "inclusive_filter": ["1", "2"], "library": "", "qname_file": null, "quality": "20", "tag": null}, "output_options": {"__current_case__": 0, "adv_output": {"collapsecigar": false, "readtags": []}, "complementary_output": false, "output_format": {"__current_case__": 2, "oformat": "bam"}, "reads_report_type": "retained"}, "outtype": "selected_reads", "subsample_config": {"subsampling_mode": {"__current_case__": 0, "factor": "1.0", "seed": null, "select_subsample": "fraction"}}}

Other invocation details
- history_id
  - f5366c08e3b79691
- history_state
  - ok
- invocation_id
  - f5366c08e3b79691
- invocation_state
  - scheduled
- workflow_id
  - f5366c08e3b79691

github-actions · 2025-02-06T11:52:16Z

Test Results (powered by Planemo)

Test Summary

Test State	Count
Total	4
Passed	2
Error	2
Failure	0
Skipped	0

Errored Tests

❌ RepeatMasking-Workflow.ga_0

Execution Problem:

Failed to run workflow, at least one job is in [error] state.

Workflow invocation details

Invocation Messages

Steps

Step 1: input:
- step_state: scheduled

Step 2: toolshed.g2.bx.psu.edu/repos/csbl/repeatmodeler/repeatmodeler/2.0.4+galaxy1:

step_state: scheduled

Jobs

Job 1:

Job state is ok

Command Line:

BuildDatabase -name 'rmdb' '/tmp/tmp83tdp1e8/files/1/b/a/dataset_1ba272e1-d39d-43f3-a871-3692f6ebd458.dat'  &&  RepeatModeler -database 'rmdb' -threads ${GALAXY_SLOTS:-1}

Exit Code:

```
0
```

Standard Output:

Building database rmdb:
  Reading /tmp/tmp83tdp1e8/files/1/b/a/dataset_1ba272e1-d39d-43f3-a871-3692f6ebd458.dat...
Number of sequences (bp) added to database: 1 ( 5942969 bp )
WARNING: RepeatModeler is a computationally intensive program.
         It is recommended that for anything other than debugging
         purposes the program should run with greater than eight
         threads (-threads #).

RepeatModeler Version 2.0.4
===========================
Using output directory = /tmp/tmp83tdp1e8/job_working_directory/000/2/working/RM_10.ThuFeb61134202025
Search Engine = rmblast 2.13.0+
Threads = 1
Dependencies: TRF 4.09, RECON , RepeatScout 1.0.6, RepeatMasker 4.1.5
LTR Structural Analysis: Disabled [use -LTRStruct to enable]
Random Number Seed: 1738841660
Database = /tmp/tmp83tdp1e8/job_working_directory/000/2/working/rmdb 
  - Sequences = 1
  - Bases = 5942969
Storage Throughput = good ( 778.28 MB/s )

Ready to start the sampling process.
INFO: The runtime of RepeatModeler heavily depends on the quality of the assembly
      and the repetitive content of the sequences.  It is not imperative
      that RepeatModeler completes all rounds in order to obtain useful
      results.  At the completion of each round, the files ( consensi.fa, and
      families.stk ) found in:
      /tmp/tmp83tdp1e8/job_working_directory/000/2/working/RM_10.ThuFeb61134202025/ 
      will contain all results produced thus far. These files may be 
      manually copied and run through RepeatClassifier should the program
      be terminated early.


RepeatModeler Round # 1
========================
Searching for Repeats
 -- Sampling from the database...
   - Gathering up to 40000000 bp
   - Final Sample Size = 5942880 bp ( 5942880 non ambiguous )
   - Num Contigs Represented = 1
   - Sequence extraction : 00:00:01 (hh:mm:ss) Elapsed Time
 -- Running RepeatScout on the sequences...
   - RepeatScout: Running build_lmer_table ( l = 13 )..
   - RepeatScout: Running RepeatScout.. : 160 raw families identified
   - RepeatScout: Running filtering stage.. 158 families remaining
   - RepeatScout: 00:00:52 (hh:mm:ss) Elapsed Time
   - Large Satellite Filtering.. : 0 found in 00:00:01 (hh:mm:ss) Elapsed Time
   - Collecting repeat instances...: 00:00:29 (hh:mm:ss) Elapsed Time
Refinement: 00:00:14 (hh:mm:ss) Elapsed Time
Family Refinement: 00:00:14 (hh:mm:ss) Elapsed Time
Round Time: 00:01:37 (hh:mm:ss) Elapsed Time : 7 families discovered.


RepeatModeler Round # 2
========================
Searching for Repeats
 -- Sampling from the database...
   - Gathering up to 10000000 bp
   - Sequence extraction : 00:00:01 (hh:mm:ss) Elapsed Time
 -- Running TRFMask on the sequence...
       14 Tandem Repeats Masked
   - TRFMask time 00:00:03 (hh:mm:ss) Elapsed Time
 -- Masking repeats from the previous rounds...
    -- Collecting 320 ranges...
       307 repeats masked totaling 112527 bp(s).
   - TE Masking time 00:00:03 (hh:mm:ss) Elapsed Time
 -- Sample Stats:
       Sample Size 5942880 bp
       Num Contigs Represented = 1
       Non ambiguous bp:
             Initial: 5942880 bp
             After Masking: 5828367 bp
             Masked: 1.93 % 
 -- Input Database Coverage: 5942880 bp out of 5942969 bp ( 100.00 % )
Sampling Time: 00:00:07 (hh:mm:ss) Elapsed Time
Running all-by-other comparisons...
  - Total Comparisons = 11026
        1% completed,  00:11:01 (hh:mm:ss) est. time remaining.
        2% completed,  00:10:18 (hh:mm:ss) est. time remaining.
        3% completed,  00:10:00 (hh:mm:ss) est. time remaining.
        5% completed,  00:9:30 (hh:mm:ss) est. time remaining.
        6% completed,  00:9:38 (hh:mm:ss) est. time remaining.
        7% completed,  00:9:18 (hh:mm:ss) est. time remaining.
        9% completed,  00:9:22 (hh:mm:ss) est. time remaining.
       10% completed,  00:9:14 (hh:mm:ss) est. time remaining.
       11% completed,  00:9:00 (hh:mm:ss) est. time remaining.
       13% completed,  00:8:54 (hh:mm:ss) est. time remaining.
       14% completed,  00:8:48 (hh:mm:ss) est. time remaining.
       15% completed,  00:8:37 (hh:mm:ss) est. time remaining.
       16% completed,  00:8:27 (hh:mm:ss) est. time remaining.
       17% completed,  00:8:17 (hh:mm:ss) est. time remaining.
       19% completed,  00:8:12 (hh:mm:ss) est. time remaining.
       20% completed,  00:8:04 (hh:mm:ss) est. time remaining.
       21% completed,  00:7:52 (hh:mm:ss) est. time remaining.
       22% completed,  00:7:47 (hh:mm:ss) est. time remaining.
       23% completed,  00:7:40 (hh:mm:ss) est. time remaining.
       25% completed,  00:7:36 (hh:mm:ss) est. time remaining.
       26% completed,  00:7:28 (hh:mm:ss) est. time remaining.
       27% completed,  00:7:24 (hh:mm:ss) est. time remaining.
       28% completed,  00:7:14 (hh:mm:ss) est. time remaining.
       29% completed,  00:7:10 (hh:mm:ss) est. time remaining.
       30% completed,  00:7:01 (hh:mm:ss) est. time remaining.
       31% completed,  00:6:55 (hh:mm:ss) est. time remaining.
       33% completed,  00:6:49 (hh:mm:ss) est. time remaining.
       34% completed,  00:6:40 (hh:mm:ss) est. time remaining.
       35% completed,  00:6:35 (hh:mm:ss) est. time remaining.
       36% completed,  00:6:27 (hh:mm:ss) est. time remaining.
       37% completed,  00:6:21 (hh:mm:ss) est. time remaining.
       38% completed,  00:6:16 (hh:mm:ss) est. time remaining.
       39% completed,  00:6:09 (hh:mm:ss) est. time remaining.
       40% completed,  00:6:03 (hh:mm:ss) est. time remaining.
       41% completed,  00:5:56 (hh:mm:ss) est. time remaining.
       42% completed,  00:5:48 (hh:mm:ss) est. time remaining.
       43% completed,  00:5:43 (hh:mm:ss) est. time remaining.
       44% completed,  00:5:38 (hh:mm:ss) est. time remaining.
       45% completed,  00:5:32 (hh:mm:ss) est. time remaining.
       46% completed,  00:5:26 (hh:mm:ss) est. time remaining.
       47% completed,  00:5:19 (hh:mm:ss) est. time remaining.
       48% completed,  00:5:13 (hh:mm:ss) est. time remaining.
       49% completed,  00:5:07 (hh:mm:ss) est. time remaining.
       50% completed,  00:5:03 (hh:mm:ss) est. time remaining.
       51% completed,  00:4:56 (hh:mm:ss) est. time remaining.
       52% completed,  00:4:51 (hh:mm:ss) est. time remaining.
       53% completed,  00:4:45 (hh:mm:ss) est. time remaining.
       54% completed,  00:4:39 (hh:mm:ss) est. time remaining.
       55% completed,  00:4:34 (hh:mm:ss) est. time remaining.
       56% completed,  00:4:28 (hh:mm:ss) est. time remaining.
       56% completed,  00:4:23 (hh:mm:ss) est. time remaining.
       57% completed,  00:4:18 (hh:mm:ss) est. time remaining.
       58% completed,  00:4:13 (hh:mm:ss) est. time remaining.
       59% completed,  00:4:07 (hh:mm:ss) est. time remaining.
       60% completed,  00:4:02 (hh:mm:ss) est. time remaining.
       61% completed,  00:3:57 (hh:mm:ss) est. time remaining.
       62% completed,  00:3:51 (hh:mm:ss) est. time remaining.
       62% completed,  00:3:46 (hh:mm:ss) est. time remaining.
       63% completed,  00:3:41 (hh:mm:ss) est. time remaining.
       64% completed,  00:3:36 (hh:mm:ss) est. time remaining.
       65% completed,  00:3:31 (hh:mm:ss) est. time remaining.
       66% completed,  00:3:26 (hh:mm:ss) est. time remaining.
       66% completed,  00:3:22 (hh:mm:ss) est. time remaining.
       67% completed,  00:3:17 (hh:mm:ss) est. time remaining.
       68% completed,  00:3:13 (hh:mm:ss) est. time remaining.
       69% completed,  00:3:08 (hh:mm:ss) est. time remaining.
       69% completed,  00:3:04 (hh:mm:ss) est. time remaining.
       70% completed,  00:2:59 (hh:mm:ss) est. time remaining.
       71% completed,  00:2:55 (hh:mm:ss) est. time remaining.
       72% completed,  00:2:50 (hh:mm:ss) est. time remaining.
       72% completed,  00:2:46 (hh:mm:ss) est. time remaining.
       73% completed,  00:2:42 (hh:mm:ss) est. time remaining.
       74% completed,  00:2:37 (hh:mm:ss) est. time remaining.
       74% completed,  00:2:33 (hh:mm:ss) est. time remaining.
       75% completed,  00:2:29 (hh:mm:ss) est. time remaining.
       76% completed,  00:2:25 (hh:mm:ss) est. time remaining.
       76% completed,  00:2:21 (hh:mm:ss) est. time remaining.
       77% completed,  00:2:17 (hh:mm:ss) est. time remaining.
       78% completed,  00:2:13 (hh:mm:ss) est. time remaining.
       78% completed,  00:2:10 (hh:mm:ss) est. time remaining.
       79% completed,  00:2:06 (hh:mm:ss) est. time remaining.
       79% completed,  00:2:02 (hh:mm:ss) est. time remaining.
       80% completed,  00:1:58 (hh:mm:ss) est. time remaining.
       81% completed,  00:1:55 (hh:mm:ss) est. time remaining.
       81% completed,  00:1:51 (hh:mm:ss) est. time remaining.
       82% completed,  00:1:48 (hh:mm:ss) est. time remaining.
       82% completed,  00:1:44 (hh:mm:ss) est. time remaining.
       83% completed,  00:1:41 (hh:mm:ss) est. time remaining.
       83% completed,  00:1:38 (hh:mm:ss) est. time remaining.
       84% completed,  00:1:34 (hh:mm:ss) est. time remaining.
       85% completed,  00:1:31 (hh:mm:ss) est. time remaining.
       85% completed,  00:1:28 (hh:mm:ss) est. time remaining.
       86% completed,  00:1:25 (hh:mm:ss) est. time remaining.
       86% completed,  00:1:22 (hh:mm:ss) est. time remaining.
       87% completed,  00:1:19 (hh:mm:ss) est. time remaining.
       87% completed,  00:1:16 (hh:mm:ss) est. time remaining.
       87% completed,  00:1:13 (hh:mm:ss) est. time remaining.
       88% completed,  00:1:10 (hh:mm:ss) est. time remaining.
       88% completed,  00:1:07 (hh:mm:ss) est. time remaining.
       89% completed,  00:1:05 (hh:mm:ss) est. time remaining.
       89% completed,  00:1:02 (hh:mm:ss) est. time remaining.
       90% completed,  00:1:00 (hh:mm:ss) est. time remaining.
       90% completed,  00:0:57 (hh:mm:ss) est. time remaining.
       91% completed,  00:0:54 (hh:mm:ss) est. time remaining.
       91% completed,  00:0:52 (hh:mm:ss) est. time remaining.
       91% completed,  00:0:50 (hh:mm:ss) est. time remaining.
       92% completed,  00:0:47 (hh:mm:ss) est. time remaining.
       92% completed,  00:0:45 (hh:mm:ss) est. time remaining.
       92% completed,  00:0:43 (hh:mm:ss) est. time remaining.
       93% completed,  00:0:41 (hh:mm:ss) est. time remaining.
       93% completed,  00:0:39 (hh:mm:ss) est. time remaining.
       93% completed,  00:0:36 (hh:mm:ss) est. time remaining.
       94% completed,  00:0:34 (hh:mm:ss) est. time remaining.
       94% completed,  00:0:33 (hh:mm:ss) est. time remaining.
       94% completed,  00:0:31 (hh:mm:ss) est. time remaining.
       95% completed,  00:0:29 (hh:mm:ss) est. time remaining.
       95% completed,  00:0:27 (hh:mm:ss) est. time remaining.
       95% completed,  00:0:25 (hh:mm:ss) est. time remaining.
       96% completed,  00:0:24 (hh:mm:ss) est. time remaining.
       96% completed,  00:0:22 (hh:mm:ss) est. time remaining.
       96% completed,  00:0:20 (hh:mm:ss) est. time remaining.
       96% completed,  00:0:19 (hh:mm:ss) est. time remaining.
       97% completed,  00:0:18 (hh:mm:ss) est. time remaining.
       97% completed,  00:0:16 (hh:mm:ss) est. time remaining.
       97% completed,  00:0:15 (hh:mm:ss) est. time remaining.
       97% completed,  00:0:14 (hh:mm:ss) est. time remaining.
       97% completed,  00:0:12 (hh:mm:ss) est. time remaining.
       98% completed,  00:0:11 (hh:mm:ss) est. time remaining.
       98% completed,  00:0:10 (hh:mm:ss) est. time remaining.
       98% completed,  00:0:09 (hh:mm:ss) est. time remaining.
       98% completed,  00:0:08 (hh:mm:ss) est. time remaining.
       98% completed,  00:0:07 (hh:mm:ss) est. time remaining.
       98% completed,  00:0:06 (hh:mm:ss) est. time remaining.
       99% completed,  00:0:05 (hh:mm:ss) est. time remaining.
       99% completed,  00:0:05 (hh:mm:ss) est. time remaining.
       99% completed,  00:0:04 (hh:mm:ss) est. time remaining.
       99% completed,  00:0:03 (hh:mm:ss) est. time remaining.
       99% completed,  00:0:03 (hh:mm:ss) est. time remaining.
       99% completed,  00:0:02 (hh:mm:ss) est. time remaining.
       99% completed,  00:0:02 (hh:mm:ss) est. time remaining.
       99% completed,  00:0:01 (hh:mm:ss) est. time remaining.
       99% completed,  00:0:01 (hh:mm:ss) est. time remaining.
       99% completed,  00:0:00 (hh:mm:ss) est. time remaining.
       99% completed,  00:0:00 (hh:mm:ss) est. time remaining.
       99% completed,  00:0:00 (hh:mm:ss) est. time remaining.
       99% completed,  00:0:00 (hh:mm:ss) est. time remaining.
       99% completed,  00:0:00 (hh:mm:ss) est. time remaining.
      100% completed,  00:0:00 (hh:mm:ss) est. time remaining.
Comparison Time: 00:10:14 (hh:mm:ss) Elapsed Time, 4895 HSPs Collected
  - RECON: Running imagespread..
RECON Elapsed: 00:00:00 (hh:mm:ss) Elapsed Time
  - RECON: Running initial definition of elements ( eledef )..
RECON Elapsed: 00:00:00 (hh:mm:ss) Elapsed Time
  - RECON: Running re-definition of elements ( eleredef )..
RECON Elapsed: 00:00:01 (hh:mm:ss) Elapsed Time
  - RECON: Running re-definition of edges ( edgeredef )..
RECON Elapsed: 00:00:01 (hh:mm:ss) Elapsed Time
  - RECON: Running family definition ( famdef )..
RECON Elapsed: 00:00:00 (hh:mm:ss) Elapsed Time
  - Obtaining element sequences
Number of families returned by RECON: 809
Processing families with greater than 15 elements
Instance Gathering: 00:00:00 (hh:mm:ss) Elapsed Time
About to run 3 refinement jobs
Refinement: 00:02:16 (hh:mm:ss) Elapsed Time
Family Refinement: 00:02:16 (hh:mm:ss) Elapsed Time
Round Time: 00:12:39 (hh:mm:ss) Elapsed Time : 3 families discovered.

RepeatScout/RECON discovery complete: 10 families found


RepeatClassifier Version 2.0.4
======================================
  - Looking for Simple and Low Complexity sequences..
  - Looking for similarity to known repeat proteins..
  - Looking for similarity to known repeat consensi..
Classification Time: 00:02:00 (hh:mm:ss) Elapsed Time


Program Time: 00:16:16 (hh:mm:ss) Elapsed Time
Working directory:  /tmp/tmp83tdp1e8/job_working_directory/000/2/working/RM_10.ThuFeb61134202025
may be deleted unless there were problems with the run.

The results have been saved to:
  /tmp/tmp83tdp1e8/job_working_directory/000/2/working/rmdb-families.fa  - Consensus sequences for each family identified.
  /tmp/tmp83tdp1e8/job_working_directory/000/2/working/rmdb-families.stk - Seed alignments for each family identified.
  /tmp/tmp83tdp1e8/job_working_directory/000/2/working/rmdb-rmod.log     - Execution log.  Useful for reproducing results.

The RepeatModeler stockholm file is formatted so that it can
easily be submitted to the Dfam database.  Please consider contributing
curated families to this open database and be a part of this growing
community resource.  For more information contact help@dfam.org.

Traceback:

Job Parameters:

Job parameter	Parameter value
__input_ext	`"input"`
__workflow_invocation_uuid__	`"2ffb8730e47e11efb46f7c1e5218c549"`
chromInfo	`"/tmp/tmp83tdp1e8/galaxy-dev/tool-data/shared/ucsc/chrom/?.len"`
dbkey	`"?"`

Step 3: toolshed.g2.bx.psu.edu/repos/bgruening/repeat_masker/repeatmasker_wrapper/4.1.5+galaxy0:

step_state: scheduled

Jobs

Job 1:

Job state is error

Command Line:

RM_PATH=$(which RepeatMasker) && if [ -z "$RM_PATH" ] ; then echo "Failed to find RepeatMasker in PATH ($PATH)" >&2 ; exit 1 ; fi &&  if [ -z "$RM_LIB_PATH" ] ; then RM_LIB_PATH=$(dirname $RM_PATH)/../share/RepeatMasker/Libraries ; fi &&  ln -s '/tmp/tmp83tdp1e8/files/f/2/a/dataset_f2a2d1ea-38fe-486f-ba39-ffc74b66b7bb.dat' rm_input.fasta &&  RepeatMasker -dir $(pwd) -libdir $RM_LIB_PATH -species '' -parallel ${GALAXY_SLOTS:-1} -gff -excln            -frag 40000      -xsmall  rm_input.fasta && mv rm_input.fasta.masked '/tmp/tmp83tdp1e8/job_working_directory/000/3/outputs/dataset_97e553bc-134b-417a-ab5f-88d19e2a5203.dat' && sed -E 's/^ *// ; s/ *$//; s/\+ //; s/ +/\t/g ;  1,2c SW score\t% div.\t% del.\t% ins.\tquery sequence\tpos in  query: begin\tend\t(left)\trepeat\tclass/family\tpos in repeat: begin\tend\t(left)\tID' rm_input.fasta.out >'/tmp/tmp83tdp1e8/job_working_directory/000/3/outputs/dataset_cdd4edeb-2ee4-4e10-a3e4-501f10bb69d9.dat' && mv rm_input.fasta.tbl '/tmp/tmp83tdp1e8/job_working_directory/000/3/outputs/dataset_e3de12c3-e793-4beb-a3b9-c1ca71aa6255.dat' && mv rm_input.fasta.out.gff '/tmp/tmp83tdp1e8/job_working_directory/000/3/outputs/dataset_77a5c2a3-52fd-4dce-96b8-5f3b57da64d3.dat' && if [ -f 'rm_input.fasta.cat.gz' ]; then zcat 'rm_input.fasta.cat.gz' > '/tmp/tmp83tdp1e8/job_working_directory/000/3/outputs/dataset_d004ed34-d1f8-4d46-b627-94518ea7a915.dat'; else mv rm_input.fasta.cat '/tmp/tmp83tdp1e8/job_working_directory/000/3/outputs/dataset_d004ed34-d1f8-4d46-b627-94518ea7a915.dat'; fi

Exit Code:

```
255
```

Standard Error:

Species "homo sapiens" is not known to RepeatMasker.  There may
not be any TE families defined in the libraries for this
species/clade or there may be an error in the spelling.
Please check your entry against the NCBI Taxonomy database
and/or try using a broader clade or related species instead.
The full list of species/clades defined in the library may be
obtained using the famdb.py script.

Standard Output:

RepeatMasker version 4.1.5
Search Engine: NCBI/RMBLAST [ 2.14.1+ ]

Using Master RepeatMasker Database: /usr/local/bin/../share/RepeatMasker/Libraries/RepeatMaskerLib.h5
  Title    : 
  Version  : 
  Date     : 
  Families :

Traceback:

Job Parameters:

Job parameter	Parameter value
__input_ext	`"input"`
__workflow_invocation_uuid__	`"2ffb8730e47e11efb46f7c1e5218c549"`
advanced	`{"alu": false, "div": false, "frag": "40000", "gc": null, "gccalc": false, "invert_alignments": false, "is_clip": false, "is_only": false, "keep_alignments": false, "no_is": false, "nocut": false, "noint": false, "nolow": false, "norna": false, "poly": false, "primspec": false, "rodspec": false, "search_speed": "", "xout": false}`
chromInfo	`"/tmp/tmp83tdp1e8/galaxy-dev/tool-data/shared/ucsc/chrom/?.len"`
dbkey	`"?"`
excln	`true`
gff	`true`
repeat_source	`{"__current_case__": 0, "source_type": "dfam", "species_source": {"__current_case__": 1, "species_from_list": "no", "species_name": ""}}`
xsmall	`true`

Other invocation details
- error_message
  - Failed to run workflow, at least one job is in [error] state.
- history_id
  - 9cd1cda445f38c7e
- history_state
  - error
- invocation_id
  - 9cd1cda445f38c7e
- invocation_state
  - scheduled
- workflow_id
  - 9cd1cda445f38c7e

❌ pox-virus-half-genome.ga_0

Execution Problem:

Failed to upload data, upload state is [error].

Passed Tests

✅ pe-wgs-ivar-analysis.ga_0

Workflow invocation details

Invocation Messages

Steps

Step 1: Paired read collection for samples:
- step_state: scheduled
Step 2: Reference FASTA:
- step_state: scheduled

Step 11: toolshed.g2.bx.psu.edu/repos/iuc/qualimap_bamqc/qualimap_bamqc/2.2.2d+galaxy3:

step_state: scheduled

Jobs

Job 1:

Job state is ok

Command Line:

export JAVA_OPTS="-Djava.awt.headless=true -Xmx${GALAXY_MEMORY_MB:-1024}m" &&    ln -s '/tmp/tmp_78p4i9b/files/e/b/d/dataset_ebd05745-c8ca-487e-b92a-e685b3a6dab5.dat' 'ERR4970105' &&  qualimap bamqc -bam 'ERR4970105' -outdir results -outformat html --collect-overlap-pairs -nw 400 --paint-chromosome-limits -hm 3  --skip-duplicated --skip-dup-mode 0 -nt ${GALAXY_SLOTS:-1} &&   sed 's|images_qualimapReport/||g;s|css/||g' results/qualimapReport.html > '/tmp/tmp_78p4i9b/job_working_directory/000/10/outputs/dataset_6fc2185a-1efe-49d0-8e83-9a07a64cc134.dat' && mkdir '/tmp/tmp_78p4i9b/job_working_directory/000/10/outputs/dataset_6fc2185a-1efe-49d0-8e83-9a07a64cc134_files' && mv results/css/*.css '/tmp/tmp_78p4i9b/job_working_directory/000/10/outputs/dataset_6fc2185a-1efe-49d0-8e83-9a07a64cc134_files' && mv results/css/*.png '/tmp/tmp_78p4i9b/job_working_directory/000/10/outputs/dataset_6fc2185a-1efe-49d0-8e83-9a07a64cc134_files' && if [ -d results/images_qualimapReport ]; then mv results/images_qualimapReport/* '/tmp/tmp_78p4i9b/job_working_directory/000/10/outputs/dataset_6fc2185a-1efe-49d0-8e83-9a07a64cc134_files' && for file in $(ls -A results/raw_data_qualimapReport); do mv "results/raw_data_qualimapReport/$file" `echo "results/$file" | sed 's/(//;s/)//'`; done fi && mv results/genome_results.txt results/summary_report.txt

Exit Code:

```
0
```

Standard Output:

Java memory size is set to 1200M
Launching application...

detected environment java options -Djava.awt.headless=true -Xmx1024m
QualiMap v.2.2.2-dev
Built on 2019-11-11 14:05

Selected tool: bamqc
Available memory (Mb): 262
Max memory (Mb): 1073
Starting bam qc....
Loading sam header...
Loading locator...
Loading reference...
Only flagged duplicate alignments will be skipped...
Number of windows: 400, effective number of windows: 399
Chunk of reads size: 1000
Number of threads: 1
Processed 50 out of 399 windows...
Processed 100 out of 399 windows...
Processed 150 out of 399 windows...
Processed 200 out of 399 windows...
Processed 250 out of 399 windows...
Processed 300 out of 399 windows...
Processed 350 out of 399 windows...
Total processed windows:399
Number of reads: 1391615
Number of valid reads: 1394916
Number of correct strand reads:0

Inside of regions...
Num mapped reads: 1391615
Num mapped first of pair: 695807
Num mapped second of pair: 695808
Num singletons: 0
Time taken to analyze reads: 17
Computing descriptors...
numberOfMappedBases: 191294294
referenceSize: 29903
numberOfSequencedBases: 191251301
numberOfAs: 58710603
Computing per chromosome statistics...
Computing histograms...
Overall analysis time: 19
end of bam qc
Computing report...
Writing HTML report...
HTML report created successfully

Finished

Traceback:

Job Parameters:

Job parameter	Parameter value
__input_ext	`"bam"`
__workflow_invocation_uuid__	`"73f8bafce47e11efb46f6045bd4853a8"`
chromInfo	`"/tmp/tmp_78p4i9b/galaxy-dev/tool-data/shared/ucsc/chrom/?.len"`
dbkey	`"?"`
duplicate_skipping	`["0"]`
per_base_coverage	`false`
plot_specific	`{"genome_gc_distr": null, "homopolymer_size": "3", "n_bins": "400", "paint_chromosome_limits": true}`
stats_regions	`{"__current_case__": 0, "region_select": "all"}`

Step 12: toolshed.g2.bx.psu.edu/repos/iuc/ivar_trim/ivar_trim/1.4.2+galaxy0:

step_state: scheduled

Jobs

Job 1:

Job state is ok

Command Line:

cp '/tmp/tmp_78p4i9b/files/5/0/7/dataset_5072322f-5cef-4a80-b5ac-9b700cfa6d41.dat' bed.bed && python '/tmp/shed_dir/toolshed.g2.bx.psu.edu/repos/iuc/ivar_trim/86a20ae274fc/ivar_trim/sanitize_bed.py' bed.bed && python '/tmp/shed_dir/toolshed.g2.bx.psu.edu/repos/iuc/ivar_trim/86a20ae274fc/ivar_trim/write_amplicon_info_file.py' bed.bed amplicon_info_raw.tsv && python '/tmp/shed_dir/toolshed.g2.bx.psu.edu/repos/iuc/ivar_trim/86a20ae274fc/ivar_trim/prepare_amplicon_info.py' bed.bed amplicon_info_raw.tsv amplicon_info.tsv && ln -s '/tmp/tmp_78p4i9b/files/e/b/d/dataset_ebd05745-c8ca-487e-b92a-e685b3a6dab5.dat' sorted.bam && ln -s '/tmp/tmp_78p4i9b/files/_metadata_files/5/a/9/metadata_5a95ad93-02a9-4b9a-9c32-7aa00a79e347.dat' sorted.bam.bai &&  ivar trim -i sorted.bam -b bed.bed -f amplicon_info.tsv -x 0 -e -m -1 -q 20 -s 4 | samtools sort -@ ${GALAXY_SLOTS:-1} -T "${TMPDIR:-.}" -o trimmed.sorted.bam -

Exit Code:

```
0
```

Standard Error:

Found 218 primers in BED file
Amplicons detected: 
[30, 410] max = 29866
[320, 726] max = 29866
[642, 1028] max = 29866
[943, 1337] max = 29866
[1242, 1651] max = 29866
[1573, 1964] max = 29866
[1868, 2269] max = 29866
[2181, 2592] max = 29866
[2504, 2904] max = 29866
[2826, 3210] max = 29866
[3144, 3531] max = 29866
[3460, 3853] max = 29866
[3771, 4164] max = 29866
[4044, 4450] max = 29866
[4294, 4696] max = 29866
[4636, 5017] max = 29866
[4939, 5321] max = 29866
[5230, 5644] max = 29866
[5563, 5957] max = 29866
[5867, 6272] max = 29866
[6167, 6550] max = 29866
[6466, 6873] max = 29866
[6718, 7117] max = 29866
[7035, 7415] max = 29866
[7305, 7694] max = 29866
[7626, 8019] max = 29866
[7943, 8341] max = 29866
[8249, 8661] max = 29866
[8595, 8983] max = 29866
[8888, 9271] max = 29866
[9204, 9585] max = 29866
[9477, 9858] max = 29866
[9784, 10171] max = 29866
[10076, 10459] max = 29866
[10362, 10763] max = 29866
[10666, 11074] max = 29866
[10999, 11394] max = 29866
[11306, 11693] max = 29866
[11555, 11949] max = 29866
[11863, 12256] max = 29866
[12110, 12490] max = 29866
[12417, 12802] max = 29866
[12710, 13096] max = 29866
[13005, 13400] max = 29866
[13307, 13699] max = 29866
[13599, 13984] max = 29866
[13918, 14299] max = 29866
[14207, 14601] max = 29866
[14545, 14926] max = 29866
[14865, 15246] max = 29866
[15171, 15560] max = 29866
[15481, 15886] max = 29866
[15827, 16209] max = 29866
[16118, 16510] max = 29866
[16416, 16833] max = 29866
[16748, 17152] max = 29866
[17065, 17452] max = 29866
[17381, 17761] max = 29866
[17674, 18062] max = 29866
[17966, 18348] max = 29866
[18253, 18672] max = 29866
[18596, 18979] max = 29866
[18896, 19297] max = 29866
[19204, 19616] max = 29866
[19548, 19939] max = 29866
[19844, 20255] max = 29866
[20172, 20572] max = 29866
[20472, 20890] max = 29866
[20786, 21169] max = 29866
[21075, 21455] max = 29866
[21357, 21743] max = 29866
[21658, 22038] max = 29866
[21961, 22346] max = 29866
[22262, 22650] max = 29866
[22516, 22903] max = 29866
[22797, 23214] max = 29866
[23122, 23522] max = 29866
[23443, 23847] max = 29866
[23789, 24169] max = 29866
[24078, 24467] max = 29866
[24391, 24789] max = 29866
[24696, 25076] max = 29866
[24978, 25369] max = 29866
[25279, 25673] max = 29866
[25601, 25994] max = 29866
[25902, 26315] max = 29866
[26197, 26590] max = 29866
[26520, 26913] max = 29866
[26835, 27227] max = 29866
[27141, 27533] max = 29866
[27446, 27854] max = 29866
[27784, 28172] max = 29866
[28081, 28464] max = 29866
[28394, 28779] max = 29866
[28677, 29063] max = 29866
[28985, 29378] max = 29866
[29288, 29693] max = 29866
[29486, 29866] max = 29866
Reading from sorted.bam
Minimum Read Length based on 1000 reads: 39
Processed 1000000 reads ... 

-------
Results: 
Primer Name	Read Count
nCoV-2019_1_LEFT	1385
nCoV-2019_1_RIGHT	1174
nCoV-2019_2_LEFT	1669
nCoV-2019_2_RIGHT	2343
nCoV-2019_3_LEFT	2238
nCoV-2019_3_RIGHT	4041
nCoV-2019_4_LEFT	2942
nCoV-2019_4_RIGHT	3938
nCoV-2019_5_LEFT	1606
nCoV-2019_5_RIGHT	1345
nCoV-2019_6_LEFT	651
nCoV-2019_6_RIGHT	1315
nCoV-2019_7_LEFT	852
nCoV-2019_7_LEFT_alt0	108
nCoV-2019_7_RIGHT	8
nCoV-2019_7_RIGHT_alt5	622
nCoV-2019_8_LEFT	1216
nCoV-2019_8_RIGHT	3597
nCoV-2019_9_LEFT	2467
nCoV-2019_9_LEFT_alt4	0
nCoV-2019_9_RIGHT	7
nCoV-2019_9_RIGHT_alt2	1652
nCoV-2019_10_LEFT	6538
nCoV-2019_10_RIGHT	4831
nCoV-2019_11_LEFT	3342
nCoV-2019_11_RIGHT	2458
nCoV-2019_12_LEFT	1450
nCoV-2019_12_RIGHT	1202
nCoV-2019_13_LEFT	2273
nCoV-2019_13_RIGHT	1293
nCoV-2019_14_LEFT	2826
nCoV-2019_14_LEFT_alt4	141
nCoV-2019_14_RIGHT	620
nCoV-2019_14_RIGHT_alt2	3428
nCoV-2019_15_LEFT	1
nCoV-2019_15_LEFT_alt1	3399
nCoV-2019_15_RIGHT	6
nCoV-2019_15_RIGHT_alt3	1157
nCoV-2019_16_LEFT	2393
nCoV-2019_16_RIGHT	1227
nCoV-2019_17_LEFT	2630
nCoV-2019_17_RIGHT	2522
nCoV-2019_18_LEFT	130
nCoV-2019_18_LEFT_alt2	5697
nCoV-2019_18_RIGHT	4304
nCoV-2019_18_RIGHT_alt1	0
nCoV-2019_19_LEFT	1843
nCoV-2019_19_RIGHT	1083
nCoV-2019_20_LEFT	2240
nCoV-2019_20_RIGHT	1541
nCoV-2019_21_LEFT	1
nCoV-2019_21_LEFT_alt2	5867
nCoV-2019_21_RIGHT	3
nCoV-2019_21_RIGHT_alt0	1326
nCoV-2019_22_LEFT	3630
nCoV-2019_22_RIGHT	3860
nCoV-2019_23_LEFT	2712
nCoV-2019_23_RIGHT	1203
nCoV-2019_24_LEFT	2555
nCoV-2019_24_RIGHT	1224
nCoV-2019_25_LEFT	1746
nCoV-2019_25_RIGHT	2301
nCoV-2019_26_LEFT	4702
nCoV-2019_26_RIGHT	2711
nCoV-2019_27_LEFT	8047
nCoV-2019_27_RIGHT	3288
nCoV-2019_28_LEFT	1354
nCoV-2019_28_RIGHT	2726
nCoV-2019_29_LEFT	236
nCoV-2019_29_RIGHT	1801
nCoV-2019_30_LEFT	1663
nCoV-2019_30_RIGHT	4528
nCoV-2019_31_LEFT	3944
nCoV-2019_31_RIGHT	3538
nCoV-2019_32_LEFT	3587
nCoV-2019_32_RIGHT	1826
nCoV-2019_33_LEFT	705
nCoV-2019_33_RIGHT	2058
nCoV-2019_34_LEFT	3937
nCoV-2019_34_RIGHT	3606
nCoV-2019_35_LEFT	3929
nCoV-2019_35_RIGHT	4540
nCoV-2019_36_LEFT	3802
nCoV-2019_36_RIGHT	5022
nCoV-2019_37_LEFT	7095
nCoV-2019_37_RIGHT	1546
nCoV-2019_38_LEFT	4168
nCoV-2019_38_RIGHT	9163
nCoV-2019_39_LEFT	9474
nCoV-2019_39_RIGHT	4028
nCoV-2019_40_LEFT	5270
nCoV-2019_40_RIGHT	2221
nCoV-2019_41_LEFT	4810
nCoV-2019_41_RIGHT	2952
nCoV-2019_42_LEFT	2283
nCoV-2019_42_RIGHT	6248
nCoV-2019_43_LEFT	3277
nCoV-2019_43_RIGHT	1304
nCoV-2019_44_LEFT	17
nCoV-2019_44_LEFT_alt3	7727
nCoV-2019_44_RIGHT	664
nCoV-2019_44_RIGHT_alt0	8646
nCoV-2019_45_LEFT	1164
nCoV-2019_45_LEFT_alt2	409
nCoV-2019_45_RIGHT	23
nCoV-2019_45_RIGHT_alt7	943
nCoV-2019_46_LEFT	0
nCoV-2019_46_LEFT_alt1	806
nCoV-2019_46_RIGHT	0
nCoV-2019_46_RIGHT_alt2	2028
nCoV-2019_47_LEFT	2998
nCoV-2019_47_RIGHT	3861
nCoV-2019_48_LEFT	2245
nCoV-2019_48_RIGHT	2645
nCoV-2019_49_LEFT	5492
nCoV-2019_49_RIGHT	5519
nCoV-2019_50_LEFT	2393
nCoV-2019_50_RIGHT	1717
nCoV-2019_51_LEFT	2880
nCoV-2019_51_RIGHT	3017
nCoV-2019_52_LEFT	3554
nCoV-2019_52_RIGHT	2718
nCoV-2019_53_LEFT	5757
nCoV-2019_53_RIGHT	3106
nCoV-2019_54_LEFT	2947
nCoV-2019_54_RIGHT	2577
nCoV-2019_55_LEFT	2453
nCoV-2019_55_RIGHT	5660
nCoV-2019_56_LEFT	2387
nCoV-2019_56_RIGHT	4915
nCoV-2019_57_LEFT	10504
nCoV-2019_57_RIGHT	6840
nCoV-2019_58_LEFT	2872
nCoV-2019_58_RIGHT	2854
nCoV-2019_59_LEFT	1020
nCoV-2019_59_RIGHT	1303
nCoV-2019_60_LEFT	4249
nCoV-2019_60_RIGHT	4847
nCoV-2019_61_LEFT	4272
nCoV-2019_61_RIGHT	6480
nCoV-2019_62_LEFT	3802
nCoV-2019_62_RIGHT	3944
nCoV-2019_63_LEFT	2696
nCoV-2019_63_RIGHT	2453
nCoV-2019_64_LEFT	780
nCoV-2019_64_RIGHT	843
nCoV-2019_65_LEFT	1060
nCoV-2019_65_RIGHT	3393
nCoV-2019_66_LEFT	2044
nCoV-2019_66_RIGHT	655
nCoV-2019_67_LEFT	1499
nCoV-2019_67_RIGHT	839
nCoV-2019_68_LEFT	5096
nCoV-2019_68_RIGHT	1495
nCoV-2019_69_LEFT	3000
nCoV-2019_69_RIGHT	2953
nCoV-2019_70_LEFT	984
nCoV-2019_70_RIGHT	712
nCoV-2019_71_LEFT	864
nCoV-2019_71_RIGHT	4277
nCoV-2019_72_LEFT	7080
nCoV-2019_72_RIGHT	2247
nCoV-2019_73_LEFT	1262
nCoV-2019_73_RIGHT	855
nCoV-2019_74_LEFT	104
nCoV-2019_74_RIGHT	477
nCoV-2019_75_LEFT	1901
nCoV-2019_75_RIGHT	1370
nCoV-2019_76_LEFT	0
nCoV-2019_76_LEFT_alt3	114
nCoV-2019_76_RIGHT	34
nCoV-2019_76_RIGHT_alt0	225
nCoV-2019_77_LEFT	2926
nCoV-2019_77_RIGHT	6778
nCoV-2019_78_LEFT	1790
nCoV-2019_78_RIGHT	1729
nCoV-2019_79_LEFT	1426
nCoV-2019_79_RIGHT	1785
nCoV-2019_80_LEFT	3718
nCoV-2019_80_RIGHT	2494
nCoV-2019_81_LEFT	2018
nCoV-2019_81_RIGHT	2255
nCoV-2019_82_LEFT	7360
nCoV-2019_82_RIGHT	1952
nCoV-2019_83_LEFT	2964
nCoV-2019_83_RIGHT	18
nCoV-2019_84_LEFT	2870
nCoV-2019_84_RIGHT	4069
nCoV-2019_85_LEFT	3830
nCoV-2019_85_RIGHT	1767
nCoV-2019_86_LEFT	2117
nCoV-2019_86_RIGHT	1820
nCoV-2019_87_LEFT	2067
nCoV-2019_87_RIGHT	2201
nCoV-2019_88_LEFT	2892
nCoV-2019_88_RIGHT	6758
nCoV-2019_89_LEFT	30
nCoV-2019_89_LEFT_alt2	1044
nCoV-2019_89_RIGHT	121
nCoV-2019_89_RIGHT_alt4	1538
nCoV-2019_90_LEFT	3133
nCoV-2019_90_RIGHT	2588
nCoV-2019_91_LEFT	1109
nCoV-2019_91_RIGHT	675
nCoV-2019_92_LEFT	2173
nCoV-2019_92_RIGHT	851
nCoV-2019_93_LEFT	2829
nCoV-2019_93_RIGHT	4277
nCoV-2019_94_LEFT	5272
nCoV-2019_94_RIGHT	3632
nCoV-2019_95_LEFT	1784
nCoV-2019_95_RIGHT	594
nCoV-2019_96_LEFT	1842
nCoV-2019_96_RIGHT	1885
nCoV-2019_97_LEFT	1907
nCoV-2019_97_RIGHT	6074
nCoV-2019_98_LEFT	5277
nCoV-2019_98_RIGHT	1789

Trimmed primers from 39.55% (549744) of reads.
3.09% (42885) of reads were quality trimmed below the minimum length of 39 bp and were not written to file.
59.09% (821323) of reads started outside of primer regions. Since the -e flag was given, these reads were written to file.
0.36% (5040) reads were ignored because they did not fall within an amplicon
16.81% (233696) of reads had their insert size smaller than their read length

Traceback:

Job Parameters:

Job parameter	Parameter value
__input_ext	`"input"`
__workflow_invocation_uuid__	`"73f8bafce47e11efb46f6045bd4853a8"`
amplicons	`{"__current_case__": 0, "filter_by": "yes_compute"}`
chromInfo	`"/tmp/tmp_78p4i9b/galaxy-dev/tool-data/shared/ucsc/chrom/?.len"`
dbkey	`"?"`
inc_primers	`true`
min_len	`"30"`
min_qual	`"20"`
primer	`{"__current_case__": 0, "input_bed": {"values": [{"id": 2, "src": "hda"}]}, "source": "history"}`
primer_pos_wiggle	`"0"`
trimmed_length	`{"__current_case__": 1, "filter": "auto"}`
window_width	`"4"`

Step 13: __FLATTEN__:
- step_state: scheduled
- Jobs
  - Job 1:
    - Job state is ok
    Traceback:
    Job Parameters:
    - Job parameter Parameter value
      
      __workflow_invocation_uuid__ "73f8bafce47e11efb46f6045bd4853a8"
      
      input {"values": [{"id": 8, "src": "hdca"}]}
      
      join_identifier "_"

Step 14: toolshed.g2.bx.psu.edu/repos/iuc/ivar_variants/ivar_variants/1.4.2+galaxy1:

step_state: scheduled

Jobs

Job 1:

Job state is ok

Command Line:

ln -s '/tmp/tmp_78p4i9b/files/6/c/2/dataset_6c2a5524-a718-4364-b463-af2030cf34e3.dat' ref.fa && ln -s '/tmp/tmp_78p4i9b/files/c/9/a/dataset_c9a65a97-187d-47e8-9f56-d3366067acbc.dat' sorted.bam && samtools mpileup -A -d 0 --reference ref.fa -B -Q 0 sorted.bam | ivar variants -p variants -q 20 -t 0.7 && python '/tmp/shed_dir/toolshed.g2.bx.psu.edu/repos/iuc/ivar_variants/194e3ceee923/ivar_variants/ivar_variants_to_vcf.py'  variants.tsv variants.vcf

Exit Code:

```
0
```

Standard Error:

[mpileup] 1 samples in 1 input files
[mpileup] Max depth set to maximum value (2147483647)
[E::faidx_adjust_position] The sequence "NC_045512.2" was not found
[E::faidx_adjust_position] The sequence "NC_045512.2" was not found
[E::faidx_adjust_position] The sequence "NC_045512.2" was not found
[E::faidx_adjust_position] The sequence "NC_045512.2" was not found
[E::faidx_adjust_position] The sequence "NC_045512.2" was not found
[E::faidx_adjust_position] The sequence "NC_045512.2" was not found
[E::faidx_adjust_position] The sequence "NC_045512.2" was not found
[E::faidx_adjust_position] The sequence "NC_045512.2" was not found
[E::faidx_adjust_position] The sequence "NC_045512.2" was not found
[E::faidx_adjust_position] The sequence "NC_045512.2" was not found
[E::faidx_adjust_position] The sequence "NC_045512.2" was not found
[E::faidx_adjust_position] The sequence "NC_045512.2" was not found
[E::faidx_adjust_position] The sequence "NC_045512.2" was not found
[E::faidx_adjust_position] The sequence "NC_045512.2" was not found
[E::faidx_adjust_position] The sequence "NC_045512.2" was not found
[E::faidx_adjust_position] The sequence "NC_045512.2" was not found
[E::faidx_adjust_position] The sequence "NC_045512.2" was not found
[E::faidx_adjust_position] The sequence "NC_045512.2" was not found
[E::faidx_adjust_position] The sequence "NC_045512.2" was not found
[E::faidx_adjust_position] The sequence "NC_045512.2" was not found
[E::faidx_adjust_position] The sequence "NC_045512.2" was not found
[E::faidx_adjust_position] The sequence "NC_045512.2" was not found
[E::faidx_adjust_position] The sequence "NC_045512.2" was not found
[E::faidx_adjust_position] The sequence "NC_045512.2" was not found
[E::faidx_adjust_position] The sequence "NC_045512.2" was not found
[E::faidx_adjust_position] The sequence "NC_045512.2" was not found
[E::faidx_adjust_position] The sequence "NC_045512.2" was not found
[E::faidx_adjust_position] The sequence "NC_045512.2" was not found
[E::faidx_adjust_position] The sequence "NC_045512.2" was not found
[E::faidx_adjust_position] The sequence "NC_045512.2" was not found
[E::faidx_adjust_position] The sequence "NC_045512.2" was not found
[E::faidx_adjust_position] The sequence "NC_045512.2" was not found
[E::faidx_adjust_position] The sequence "NC_045512.2" was not found
[E::faidx_adjust_position] The sequence "NC_045512.2" was not found
[E::faidx_adjust_position] The sequence "NC_045512.2" was not found
[E::faidx_adjust_position] The sequence "NC_045512.2" was not found
[E::faidx_adjust_position] The sequence "NC_045512.2" was not found
[E::faidx_adjust_position] The sequence "NC_045512.2" was not found
[E::faidx_adjust_position] The sequence "NC_045512.2" was not found
[E::faidx_adjust_position] The sequence "NC_045512.2" was not found
[E::faidx_adjust_position] The sequence "NC_045512.2" was not found
[E::faidx_adjust_position] The sequence "NC_045512.2" was not found
[E::faidx_adjust_position] The sequence "NC_045512.2" was not found
[E::faidx_adjust_position] The sequence "NC_045512.2" was not found
[E::faidx_adjust_position] The sequence "NC_045512.2" was not found
[E::faidx_adjust_position] The sequence "NC_045512.2" was not found
[E::faidx_adjust_position] The sequence "NC_045512.2" was not found
[E::faidx_adjust_position] The sequence "NC_045512.2" was not found
[E::faidx_adjust_position] The sequence "NC_045512.2" was not found
[E::faidx_adjust_position] The sequence "NC_045512.2" was not found
[E::faidx_adjust_position] The sequence "NC_045512.2" was not found
[E::faidx_adjust_position] The sequence "NC_045512.2" was not found
[E::faidx_adjust_position] The sequence "NC_045512.2" was not found
[E::faidx_adjust_position] The sequence "NC_045512.2" was not found
[E::faidx_adjust_position] The sequence "NC_045512.2" was not found
[E::faidx_adjust_position] The sequence "NC_045512.2" was not found
[E::faidx_adjust_position] The sequence "NC_045512.2" was not found
[E::faidx_adjust_position] The sequence "NC_045512.2" was not found
[E::faidx_adjust_position] The sequence "NC_045512.2" was not found
[E::faidx_adjust_position] The sequence "NC_045512.2" was not found
[E::faidx_adjust_position] The sequence "NC_045512.2" was not found
[E::faidx_adjust_position] The sequence "NC_045512.2" was not found
[E::faidx_adjust_position] The sequence "NC_045512.2" was not found
[E::faidx_adjust_position] The sequence "NC_045512.2" was not found
[E::faidx_adjust_position] The sequence "NC_045512.2" was not found
[E::faidx_adjust_position] The sequence "NC_045512.2" was not found
[E::faidx_adjust_position] The sequence "NC_045512.2" was not found
[E::faidx_adjust_position] The sequence "NC_045512.2" was not found
[E::faidx_adjust_position] The sequence "NC_045512.2" was not found
[E::faidx_adjust_position] The sequence "NC_045512.2" was not found
[E::faidx_adjust_position] The sequence "NC_045512.2" was not found
[E::faidx_adjust_position] The sequence "NC_045512.2" was not found
[E::faidx_adjust_position] The sequence "NC_045512.2" was not found
[E::faidx_adjust_position] The sequence "NC_045512.2" was not found
[E::faidx_adjust_position] The sequence "NC_045512.2" was not found
[E::faidx_adjust_position] The sequence "NC_045512.2" was not found
[E::faidx_adjust_position] The sequence "NC_045512.2" was not found
[E::faidx_adjust_position] The sequence "NC_045512.2" was not found
[E::faidx_adjust_position] The sequence "NC_045512.2" was not found
[E::faidx_adjust_position] The sequence "NC_045512.2" was not found
[E::faidx_adjust_position] The sequence "NC_045512.2" was not found
[E::faidx_adjust_position] The sequence "NC_045512.2" was not found
[E::faidx_adjust_position] The sequence "NC_045512.2" was not found
[E::faidx_adjust_position] The sequence "NC_045512.2" was not found
[E::faidx_adjust_position] The sequence "NC_045512.2" was not found
[E::faidx_adjust_position] The sequence "NC_045512.2" was not found
[E::faidx_adjust_position] The sequence "NC_045512.2" was not found
[E::faidx_adjust_position] The sequence "NC_045512.2" was not found
[E::faidx_adjust_position] The sequence "NC_045512.2" was not found
[E::faidx_adjust_position] The sequence "NC_045512.2" was not found
[E::faidx_adjust_position] The sequence "NC_045512.2" was not found
[E::faidx_adjust_position] The sequence "NC_045512.2" was not found
[E::faidx_adjust_position] The sequence "NC_045512.2" was not found
[E::faidx_adjust_position] The sequence "NC_045512.2" was not found
[E::faidx_adjust_position] The sequence "NC_045512.2" was not found
[E::faidx_adjust_position] The sequence "NC_045512.2" was not found
[E::faidx_adjust_position] The sequence "NC_045512.2" was not found
[E::faidx_adjust_position] The sequence "NC_045512.2" was not found
[E::faidx_adjust_position] The sequence "NC_045512.2" was not found
[E::faidx_adjust_position] The sequence "NC_045512.2" was not found
[E::faidx_adjust_position] The sequence "NC_045512.2" was not found
[E::faidx_adjust_position] The sequence "NC_045512.2" was not found
[E::faidx_adjust_position] The sequence "NC_045512.2" was not found
[E::faidx_adjust_position] The sequence "NC_045512.2" was not found
[E::faidx_adjust_position] The sequence "NC_045512.2" was not found
[E::faidx_adjust_position] The sequence "NC_045512.2" was not found
[E::faidx_adjust_position] The sequence "NC_045512.2" was not found
[E::faidx_adjust_position] The sequence "NC_045512.2" was not found
[E::faidx_adjust_position] The sequence "NC_045512.2" was not found
[E::faidx_adjust_position] The sequence "NC_045512.2" was not found
[E::faidx_adjust_position] The sequence "NC_045512.2" was not found
[E::faidx_adjust_position] The sequence "NC_045512.2" was not found
[E::faidx_adjust_position] The sequence "NC_045512.2" was not found
[E::faidx_adjust_position] The sequence "NC_045512.2" was not found
[E::faidx_adjust_position] The sequence "NC_045512.2" was not found
[E::faidx_adjust_position] The sequence "NC_045512.2" was not found
[E::faidx_adjust_position] The sequence "NC_045512.2" was not found
[E::faidx_adjust_position] The sequence "NC_045512.2" was not found
[E::faidx_adjust_position] The sequence "NC_045512.2" was not found
[E::faidx_adjust_position] The sequence "NC_045512.2" was not found
[E::faidx_adjust_position] The sequence "NC_045512.2" was not found
[E::faidx_adjust_position] The sequence "NC_045512.2" was not found
[E::faidx_adjust_position] The sequence "NC_045512.2" was not found
[E::faidx_adjust_position] The sequence "NC_045512.2" was not found
[E::faidx_adjust_position] The sequence "NC_045512.2" was not found
[E::faidx_adjust_position] The sequence "NC_045512.2" was not found
[E::faidx_adjust_position] The sequence "NC_045512.2" was not found
[E::faidx_adjust_position] The sequence "NC_045512.2" was not found
[E::faidx_adjust_position] The sequence "NC_045512.2" was not found
[E::faidx_adjust_position] The sequence "NC_045512.2" was not found
[E::faidx_adjust_position] The sequence "NC_045512.2" was not found
[E::faidx_adjust_position] The sequence "NC_045512.2" was not found
[E::faidx_adjust_position] The sequence "NC_045512.2" was not found
[E::faidx_adjust_position] The sequence "NC_045512.2" was not found
[E::faidx_adjust_position] The sequence "NC_045512.2" was not found
[E::faidx_adjust_position] The sequence "NC_045512.2" was not found
[E::faidx_adjust_position] The sequence "NC_045512.2" was not found
[E::faidx_adjust_position] The sequence "NC_045512.2" was not found
[E::faidx_adjust_position] The sequence "NC_045512.2" was not found
[E::faidx_adjust_position] The sequence "NC_045512.2" was not found
[E::faidx_adjust_position] The sequence "NC_045512.2" was not found
[E::faidx_adjust_position] The sequence "NC_045512.2" was not found
[E::faidx_adjust_position] The sequence "NC_045512.2" was not found
[E::faidx_adjust_position] The sequence "NC_045512.2" was not found
[E::faidx_adjust_position] The sequence "NC_045512.2" was not found
[E::faidx_adjust_position] The sequence "NC_045512.2" was not found
[E::faidx_adjust_position] The sequence "NC_045512.2" was not found
[E::faidx_adjust_position] The sequence "NC_045512.2" was not found
[E::faidx_adjust_position] The sequence "NC_045512.2" was not found
[E::faidx_adjust_position] The sequence "NC_045512.2" was not found
[E::faidx_adjust_position] The sequence "NC_045512.2" was not found
[E::faidx_adjust_position] The sequence "NC_045512.2" was not found
[E::faidx_adjust_position] The sequence "NC_045512.2" was not found
[E::faidx_adjust_position] The sequence "NC_045512.2" was not found
[E::faidx_adjust_position] The sequence "NC_045512.2" was not found
[E::faidx_adjust_position] The sequence "NC_045512.2" was not found
[E::faidx_adjust_position] The sequence "NC_045512.2" was not found
[E::faidx_adjust_position] The sequence "NC_045512.2" was not found
[E::faidx_adjust_position] The sequence "NC_045512.2" was not found
[E::faidx_adjust_position] The sequence "NC_045512.2" was not found
[E::faidx_adjust_position] The sequence "NC_045512.2" was not found
[E::faidx_adjust_position] The sequence "NC_045512.2" was not found
[E::faidx_adjust_position] The sequence "NC_045512.2" was not found
[E::faidx_adjust_position] The sequence "NC_045512.2" was not found
[E::faidx_adjust_position] The sequence "NC_045512.2" was not found
[E::faidx_adjust_position] The sequence "NC_045512.2" was not found
[E::faidx_adjust_position] The sequence "NC_045512.2" was not found
[E::faidx_adjust_position] The sequence "NC_045512.2" was not found
[E::faidx_adjust_position] The sequence "NC_045512.2" was not found
[E::faidx_adjust_position] The sequence "NC_045512.2" was not found
[E::faidx_adjust_position] The sequence "NC_045512.2" was not found
[E::faidx_adjust_position] The sequence "NC_045512.2" was not found
[E::faidx_adjust_position] The sequence "NC_045512.2" was not found
[E::faidx_adjust_position] The sequence "NC_045512.2" was not found
[E::faidx_adjust_position] The sequence "NC_045512.2" was not found
[E::faidx_adjust_position] The sequence "NC_045512.2" was not found
[E::faidx_adjust_position] The sequence "NC_045512.2" was not found
[E::faidx_adjust_position] The sequence "NC_045512.2" was not found
[E::faidx_adjust_position] The sequence "NC_045512.2" was not found
[E::faidx_adjust_position] The sequence "NC_045512.2" was not found
[E::faidx_adjust_position] The sequence "NC_045512.2" was not found
[E::faidx_adjust_position] The sequence "NC_045512.2" was not found
[E::faidx_adjust_position] The sequence "NC_045512.2" was not found
[E::faidx_adjust_position] The sequence "NC_045512.2" was not found
[E::faidx_adjust_position] The sequence "NC_045512.2" was not found
[E::faidx_adjust_position] The sequence "NC_045512.2" was not found
[E::faidx_adjust_position] The sequence "NC_045512.2" was not found
[E::faidx_adjust_position] The sequence "NC_045512.2" was not found
[E::faidx_adjust_position] The sequence "NC_045512.2" was not found
[E::faidx_adjust_position] The sequence "NC_045512.2" was not found
[E::faidx_adjust_position] The sequence "NC_045512.2" was not found
[E::faidx_adjust_position] The sequence "NC_045512.2" was not found
[E::faidx_adjust_position] The sequence "NC_045512.2" was not found
[E::faidx_adjust_position] The sequence "NC_045512.2" was not found
[E::faidx_adjust_position] The sequence "NC_045512.2" was not found
[E::faidx_adjust_position] The sequence "NC_045512.2" was not found
[E::faidx_adjust_position] The sequence "NC_045512.2" was not found
[E::faidx_adjust_position] The sequence "NC_045512.2" was not found
[E::faidx_adjust_position] The sequence "NC_045512.2" was not found
[E::faidx_adjust_position] The sequence "NC_045512.2" was not found
[E::faidx_adjust_position] The sequence "NC_045512.2" was not found
[E::faidx_adjust_position] The sequence "NC_045512.2" was not found
[E::faidx_adjust_position] The sequence "NC_045512.2" was not found
[E::faidx_adjust_position] The sequence "NC_045512.2" was not found
[E::faidx_adjust_position] The sequence "NC_045512.2" was not found
[E::faidx_adjust_position] The sequence "NC_045512.2" was not found
[E::faidx_adjust_position] The sequence "NC_045512.2" was not found
[E::faidx_adjust_position] The sequence "NC_045512.2" was not found
[E::faidx_adjust_position] The sequence "NC_045512.2" was not found
[E::faidx_adjust_position] The sequence "NC_045512.2" was not found
[E::faidx_adjust_position] The sequence "NC_045512.2" was not found
[E::faidx_adjust_position] The sequence "NC_045512.2" was not found
[E::faidx_adjust_position] The sequence "NC_045512.2" was not found
[E::faidx_adjust_position] The sequence "NC_045512.2" was not found
[E::faidx_adjust_position] The sequence "NC_045512.2" was not found
[E::faidx_adjust_position] The sequence "NC_045512.2" was not found
[E::faidx_adjust_position] The sequence "NC_045512.2" was not found
[E::faidx_adjust_position] The sequence "NC_045512.2" was not found
[E::faidx_adjust_position] The sequence "NC_045512.2" was not found
[E::faidx_adjust_position] The sequence "NC_045512.2" was not found
[E::faidx_adjust_position] The sequence "NC_045512.2" was not found
[E::faidx_adjust_position] The sequence "NC_045512.2" was not found
[E::faidx_adjust_position] The sequence "NC_045512.2" was not found
[E::faidx_adjust_position] The sequence "NC_045512.2" was not found
[E::faidx_adjust_position] The sequence "NC_045512.2" was not found
[E::faidx_adjust_position] The sequence "NC_045512.2" was not found
[E::faidx_adjust_position] The sequence "NC_045512.2" was not found
[E::faidx_adjust_position] The sequence "NC_045512.2" was not found
[E::faidx_adjust_position] The sequence "NC_045512.2" was not found
[E::faidx_adjust_position] The sequence "NC_045512.2" was not found
[E::faidx_adjust_position] The sequence "NC_045512.2" was not found
[E::faidx_adjust_position] The sequence "NC_045512.2" was not found
[E::faidx_adjust_position] The sequence "NC_045512.2" was not found
[E::faidx_adjust_position] The sequence "NC_045512.2" was not found
[E::faidx_adjust_position] The sequence "NC_045512.2" was not found
[E::faidx_adjust_position] The sequence "NC_045512.2" was not found
[E::faidx_adjust_position] The sequence "NC_045512.2" was not found
[E::faidx_adjust_position] The sequence "NC_045512.2" was not found
[E::faidx_adjust_position] The sequence "NC_045512.2" was not found
[E::faidx_adjust_position] The sequence
..
idx_adjust_position] The sequence "NC_045512.2" was not found
[E::faidx_adjust_position] The sequence "NC_045512.2" was not found
[E::faidx_adjust_position] The sequence "NC_045512.2" was not found
[E::faidx_adjust_position] The sequence "NC_045512.2" was not found
[E::faidx_adjust_position] The sequence "NC_045512.2" was not found
[E::faidx_adjust_position] The sequence "NC_045512.2" was not found
[E::faidx_adjust_position] The sequence "NC_045512.2" was not found
[E::faidx_adjust_position] The sequence "NC_045512.2" was not found
[E::faidx_adjust_position] The sequence "NC_045512.2" was not found
[E::faidx_adjust_position] The sequence "NC_045512.2" was not found
[E::faidx_adjust_position] The sequence "NC_045512.2" was not found
[E::faidx_adjust_position] The sequence "NC_045512.2" was not found
[E::faidx_adjust_position] The sequence "NC_045512.2" was not found
[E::faidx_adjust_position] The sequence "NC_045512.2" was not found
[E::faidx_adjust_position] The sequence "NC_045512.2" was not found
[E::faidx_adjust_position] The sequence "NC_045512.2" was not found
[E::faidx_adjust_position] The sequence "NC_045512.2" was not found
[E::faidx_adjust_position] The sequence "NC_045512.2" was not found
[E::faidx_adjust_position] The sequence "NC_045512.2" was not found
[E::faidx_adjust_position] The sequence "NC_045512.2" was not found
[E::faidx_adjust_position] The sequence "NC_045512.2" was not found
[E::faidx_adjust_position] The sequence "NC_045512.2" was not found
[E::faidx_adjust_position] The sequence "NC_045512.2" was not found
[E::faidx_adjust_position] The sequence "NC_045512.2" was not found
[E::faidx_adjust_position] The sequence "NC_045512.2" was not found
[E::faidx_adjust_position] The sequence "NC_045512.2" was not found
[E::faidx_adjust_position] The sequence "NC_045512.2" was not found
[E::faidx_adjust_position] The sequence "NC_045512.2" was not found
[E::faidx_adjust_position] The sequence "NC_045512.2" was not found
[E::faidx_adjust_position] The sequence "NC_045512.2" was not found
[E::faidx_adjust_position] The sequence "NC_045512.2" was not found
[E::faidx_adjust_position] The sequence "NC_045512.2" was not found
[E::faidx_adjust_position] The sequence "NC_045512.2" was not found
[E::faidx_adjust_position] The sequence "NC_045512.2" was not found
[E::faidx_adjust_position] The sequence "NC_045512.2" was not found
[E::faidx_adjust_position] The sequence "NC_045512.2" was not found
[E::faidx_adjust_position] The sequence "NC_045512.2" was not found
[E::faidx_adjust_position] The sequence "NC_045512.2" was not found
[E::faidx_adjust_position] The sequence "NC_045512.2" was not found
[E::faidx_adjust_position] The sequence "NC_045512.2" was not found
[E::faidx_adjust_position] The sequence "NC_045512.2" was not found
[E::faidx_adjust_position] The sequence "NC_045512.2" was not found
[E::faidx_adjust_position] The sequence "NC_045512.2" was not found
[E::faidx_adjust_position] The sequence "NC_045512.2" was not found
[E::faidx_adjust_position] The sequence "NC_045512.2" was not found
[E::faidx_adjust_position] The sequence "NC_045512.2" was not found
[E::faidx_adjust_position] The sequence "NC_045512.2" was not found
[E::faidx_adjust_position] The sequence "NC_045512.2" was not found
[E::faidx_adjust_position] The sequence "NC_045512.2" was not found
[E::faidx_adjust_position] The sequence "NC_045512.2" was not found
[E::faidx_adjust_position] The sequence "NC_045512.2" was not found
[E::faidx_adjust_position] The sequence "NC_045512.2" was not found
[E::faidx_adjust_position] The sequence "NC_045512.2" was not found
[E::faidx_adjust_position] The sequence "NC_045512.2" was not found
[E::faidx_adjust_position] The sequence "NC_045512.2" was not found
[E::faidx_adjust_position] The sequence "NC_045512.2" was not found
[E::faidx_adjust_position] The sequence "NC_045512.2" was not found
[E::faidx_adjust_position] The sequence "NC_045512.2" was not found
[E::faidx_adjust_position] The sequence "NC_045512.2" was not found
[E::faidx_adjust_position] The sequence "NC_045512.2" was not found
[E::faidx_adjust_position] The sequence "NC_045512.2" was not found
[E::faidx_adjust_position] The sequence "NC_045512.2" was not found
[E::faidx_adjust_position] The sequence "NC_045512.2" was not found
[E::faidx_adjust_position] The sequence "NC_045512.2" was not found
[E::faidx_adjust_position] The sequence "NC_045512.2" was not found
[E::faidx_adjust_position] The sequence "NC_045512.2" was not found
[E::faidx_adjust_position] The sequence "NC_045512.2" was not found
[E::faidx_adjust_position] The sequence "NC_045512.2" was not found
[E::faidx_adjust_position] The sequence "NC_045512.2" was not found
[E::faidx_adjust_position] The sequence "NC_045512.2" was not found
[E::faidx_adjust_position] The sequence "NC_045512.2" was not found
[E::faidx_adjust_position] The sequence "NC_045512.2" was not found
[E::faidx_adjust_position] The sequence "NC_045512.2" was not found
[E::faidx_adjust_position] The sequence "NC_045512.2" was not found
[E::faidx_adjust_position] The sequence "NC_045512.2" was not found
[E::faidx_adjust_position] The sequence "NC_045512.2" was not found
[E::faidx_adjust_position] The sequence "NC_045512.2" was not found
[E::faidx_adjust_position] The sequence "NC_045512.2" was not found
[E::faidx_adjust_position] The sequence "NC_045512.2" was not found
[E::faidx_adjust_position] The sequence "NC_045512.2" was not found
[E::faidx_adjust_position] The sequence "NC_045512.2" was not found
[E::faidx_adjust_position] The sequence "NC_045512.2" was not found
[E::faidx_adjust_position] The sequence "NC_045512.2" was not found
[E::faidx_adjust_position] The sequence "NC_045512.2" was not found
[E::faidx_adjust_position] The sequence "NC_045512.2" was not found
[E::faidx_adjust_position] The sequence "NC_045512.2" was not found
[E::faidx_adjust_position] The sequence "NC_045512.2" was not found
[E::faidx_adjust_position] The sequence "NC_045512.2" was not found
[E::faidx_adjust_position] The sequence "NC_045512.2" was not found
[E::faidx_adjust_position] The sequence "NC_045512.2" was not found
[E::faidx_adjust_position] The sequence "NC_045512.2" was not found
[E::faidx_adjust_position] The sequence "NC_045512.2" was not found
[E::faidx_adjust_position] The sequence "NC_045512.2" was not found
[E::faidx_adjust_position] The sequence "NC_045512.2" was not found
[E::faidx_adjust_position] The sequence "NC_045512.2" was not found
[E::faidx_adjust_position] The sequence "NC_045512.2" was not found
[E::faidx_adjust_position] The sequence "NC_045512.2" was not found
[E::faidx_adjust_position] The sequence "NC_045512.2" was not found
[E::faidx_adjust_position] The sequence "NC_045512.2" was not found
[E::faidx_adjust_position] The sequence "NC_045512.2" was not found
[E::faidx_adjust_position] The sequence "NC_045512.2" was not found
[E::faidx_adjust_position] The sequence "NC_045512.2" was not found
[E::faidx_adjust_position] The sequence "NC_045512.2" was not found
[E::faidx_adjust_position] The sequence "NC_045512.2" was not found
[E::faidx_adjust_position] The sequence "NC_045512.2" was not found
[E::faidx_adjust_position] The sequence "NC_045512.2" was not found
[E::faidx_adjust_position] The sequence "NC_045512.2" was not found
[E::faidx_adjust_position] The sequence "NC_045512.2" was not found
[E::faidx_adjust_position] The sequence "NC_045512.2" was not found
[E::faidx_adjust_position] The sequence "NC_045512.2" was not found
[E::faidx_adjust_position] The sequence "NC_045512.2" was not found
[E::faidx_adjust_position] The sequence "NC_045512.2" was not found
[E::faidx_adjust_position] The sequence "NC_045512.2" was not found
[E::faidx_adjust_position] The sequence "NC_045512.2" was not found
[E::faidx_adjust_position] The sequence "NC_045512.2" was not found
[E::faidx_adjust_position] The sequence "NC_045512.2" was not found
[E::faidx_adjust_position] The sequence "NC_045512.2" was not found
[E::faidx_adjust_position] The sequence "NC_045512.2" was not found
[E::faidx_adjust_position] The sequence "NC_045512.2" was not found
[E::faidx_adjust_position] The sequence "NC_045512.2" was not found
[E::faidx_adjust_position] The sequence "NC_045512.2" was not found
[E::faidx_adjust_position] The sequence "NC_045512.2" was not found
[E::faidx_adjust_position] The sequence "NC_045512.2" was not found
[E::faidx_adjust_position] The sequence "NC_045512.2" was not found
[E::faidx_adjust_position] The sequence "NC_045512.2" was not found
[E::faidx_adjust_position] The sequence "NC_045512.2" was not found
[E::faidx_adjust_position] The sequence "NC_045512.2" was not found
[E::faidx_adjust_position] The sequence "NC_045512.2" was not found
[E::faidx_adjust_position] The sequence "NC_045512.2" was not found
[E::faidx_adjust_position] The sequence "NC_045512.2" was not found
[E::faidx_adjust_position] The sequence "NC_045512.2" was not found
[E::faidx_adjust_position] The sequence "NC_045512.2" was not found
[E::faidx_adjust_position] The sequence "NC_045512.2" was not found
[E::faidx_adjust_position] The sequence "NC_045512.2" was not found
[E::faidx_adjust_position] The sequence "NC_045512.2" was not found
[E::faidx_adjust_position] The sequence "NC_045512.2" was not found
[E::faidx_adjust_position] The sequence "NC_045512.2" was not found
[E::faidx_adjust_position] The sequence "NC_045512.2" was not found
[E::faidx_adjust_position] The sequence "NC_045512.2" was not found
[E::faidx_adjust_position] The sequence "NC_045512.2" was not found
[E::faidx_adjust_position] The sequence "NC_045512.2" was not found
[E::faidx_adjust_position] The sequence "NC_045512.2" was not found
[E::faidx_adjust_position] The sequence "NC_045512.2" was not found
[E::faidx_adjust_position] The sequence "NC_045512.2" was not found
[E::faidx_adjust_position] The sequence "NC_045512.2" was not found
[E::faidx_adjust_position] The sequence "NC_045512.2" was not found
[E::faidx_adjust_position] The sequence "NC_045512.2" was not found
[E::faidx_adjust_position] The sequence "NC_045512.2" was not found
[E::faidx_adjust_position] The sequence "NC_045512.2" was not found
[E::faidx_adjust_position] The sequence "NC_045512.2" was not found
[E::faidx_adjust_position] The sequence "NC_045512.2" was not found
[E::faidx_adjust_position] The sequence "NC_045512.2" was not found
[E::faidx_adjust_position] The sequence "NC_045512.2" was not found
[E::faidx_adjust_position] The sequence "NC_045512.2" was not found
[E::faidx_adjust_position] The sequence "NC_045512.2" was not found
[E::faidx_adjust_position] The sequence "NC_045512.2" was not found
[E::faidx_adjust_position] The sequence "NC_045512.2" was not found
[E::faidx_adjust_position] The sequence "NC_045512.2" was not found
[E::faidx_adjust_position] The sequence "NC_045512.2" was not found
[E::faidx_adjust_position] The sequence "NC_045512.2" was not found
[E::faidx_adjust_position] The sequence "NC_045512.2" was not found
[E::faidx_adjust_position] The sequence "NC_045512.2" was not found
[E::faidx_adjust_position] The sequence "NC_045512.2" was not found
[E::faidx_adjust_position] The sequence "NC_045512.2" was not found
[E::faidx_adjust_position] The sequence "NC_045512.2" was not found
[E::faidx_adjust_position] The sequence "NC_045512.2" was not found
[E::faidx_adjust_position] The sequence "NC_045512.2" was not found
[E::faidx_adjust_position] The sequence "NC_045512.2" was not found
[E::faidx_adjust_position] The sequence "NC_045512.2" was not found
[E::faidx_adjust_position] The sequence "NC_045512.2" was not found
[E::faidx_adjust_position] The sequence "NC_045512.2" was not found
[E::faidx_adjust_position] The sequence "NC_045512.2" was not found
[E::faidx_adjust_position] The sequence "NC_045512.2" was not found
[E::faidx_adjust_position] The sequence "NC_045512.2" was not found
[E::faidx_adjust_position] The sequence "NC_045512.2" was not found
[E::faidx_adjust_position] The sequence "NC_045512.2" was not found
[E::faidx_adjust_position] The sequence "NC_045512.2" was not found
[E::faidx_adjust_position] The sequence "NC_045512.2" was not found
[E::faidx_adjust_position] The sequence "NC_045512.2" was not found
[E::faidx_adjust_position] The sequence "NC_045512.2" was not found
[E::faidx_adjust_position] The sequence "NC_045512.2" was not found
[E::faidx_adjust_position] The sequence "NC_045512.2" was not found
[E::faidx_adjust_position] The sequence "NC_045512.2" was not found
[E::faidx_adjust_position] The sequence "NC_045512.2" was not found
[E::faidx_adjust_position] The sequence "NC_045512.2" was not found
[E::faidx_adjust_position] The sequence "NC_045512.2" was not found
[E::faidx_adjust_position] The sequence "NC_045512.2" was not found
[E::faidx_adjust_position] The sequence "NC_045512.2" was not found
[E::faidx_adjust_position] The sequence "NC_045512.2" was not found
[E::faidx_adjust_position] The sequence "NC_045512.2" was not found
[E::faidx_adjust_position] The sequence "NC_045512.2" was not found
[E::faidx_adjust_position] The sequence "NC_045512.2" was not found
[E::faidx_adjust_position] The sequence "NC_045512.2" was not found
[E::faidx_adjust_position] The sequence "NC_045512.2" was not found
[E::faidx_adjust_position] The sequence "NC_045512.2" was not found
[E::faidx_adjust_position] The sequence "NC_045512.2" was not found
[E::faidx_adjust_position] The sequence "NC_045512.2" was not found
[E::faidx_adjust_position] The sequence "NC_045512.2" was not found
[E::faidx_adjust_position] The sequence "NC_045512.2" was not found
[E::faidx_adjust_position] The sequence "NC_045512.2" was not found
[E::faidx_adjust_position] The sequence "NC_045512.2" was not found
[E::faidx_adjust_position] The sequence "NC_045512.2" was not found
[E::faidx_adjust_position] The sequence "NC_045512.2" was not found
[E::faidx_adjust_position] The sequence "NC_045512.2" was not found
[E::faidx_adjust_position] The sequence "NC_045512.2" was not found
[E::faidx_adjust_position] The sequence "NC_045512.2" was not found
[E::faidx_adjust_position] The sequence "NC_045512.2" was not found
[E::faidx_adjust_position] The sequence "NC_045512.2" was not found
[E::faidx_adjust_position] The sequence "NC_045512.2" was not found
[E::faidx_adjust_position] The sequence "NC_045512.2" was not found
[E::faidx_adjust_position] The sequence "NC_045512.2" was not found
[E::faidx_adjust_position] The sequence "NC_045512.2" was not found
[E::faidx_adjust_position] The sequence "NC_045512.2" was not found
[E::faidx_adjust_position] The sequence "NC_045512.2" was not found
[E::faidx_adjust_position] The sequence "NC_045512.2" was not found
[E::faidx_adjust_position] The sequence "NC_045512.2" was not found
[E::faidx_adjust_position] The sequence "NC_045512.2" was not found
[E::faidx_adjust_position] The sequence "NC_045512.2" was not found
[E::faidx_adjust_position] The sequence "NC_045512.2" was not found
[E::faidx_adjust_position] The sequence "NC_045512.2" was not found
[E::faidx_adjust_position] The sequence "NC_045512.2" was not found
[E::faidx_adjust_position] The sequence "NC_045512.2" was not found
[E::faidx_adjust_position] The sequence "NC_045512.2" was not found
[E::faidx_adjust_position] The sequence "NC_045512.2" was not found
[E::faidx_adjust_position] The sequence "NC_045512.2" was not found
[E::faidx_adjust_position] The sequence "NC_045512.2" was not found
[E::faidx_adjust_position] The sequence "NC_045512.2" was not found
[E::faidx_adjust_position] The sequence "NC_045512.2" was not found
[E::faidx_adjust_position] The sequence "NC_045512.2" was not found
[E::faidx_adjust_position] The sequence "NC_045512.2" was not found
[E::faidx_adjust_position] The sequence "NC_045512.2" was not found
[E::faidx_adjust_position] The sequence "NC_045512.2" was not found
[E::faidx_adjust_position] The sequence "NC_045512.2" was not found
[E::faidx_adjust_position] The sequence "NC_045512.2" was not found
[E::faidx_adjust_position] The sequence "NC_045512.2" was not found
[E::faidx_adjust_position] The sequence "NC_045512.2" was not found
[E::faidx_adjust_position] The sequence "NC_045512.2" was not found
[E::faidx_adjust_position] The sequence "NC_045512.2" was not found
[E::faidx_adjust_position] The sequence "NC_045512.2" was not found
[E::faidx_adjust_position] The sequence "NC_045512.2" was not found
[E::faidx_adjust_position] The sequence "NC_045512.2" was not found

Standard Output:

A GFF file containing the open reading frames (ORFs) has not been provided. Amino acid translation will not be done.
A reference sequence has not been supplied. Amino acid translation will not be done.
sample	DEL	INS	SNP
variants	0	0	29782

Traceback:

Job Parameters:

Job parameter	Parameter value
__input_ext	`"input"`
__workflow_invocation_uuid__	`"73f8bafce47e11efb46f6045bd4853a8"`
chromInfo	`"/tmp/tmp_78p4i9b/galaxy-dev/tool-data/shared/ucsc/chrom/?.len"`
dbkey	`"?"`
min_freq	`"0.7"`
min_qual	`"20"`
output_format	`{"__current_case__": 1, "choice": "tabular_and_vcf", "gtf": null, "pass_only": false}`

Step 15: toolshed.g2.bx.psu.edu/repos/iuc/ivar_consensus/ivar_consensus/1.4.2+galaxy0:

step_state: scheduled

Jobs

Job 1:

Job state is ok

Command Line:

ln -s '/tmp/tmp_78p4i9b/files/c/9/a/dataset_c9a65a97-187d-47e8-9f56-d3366067acbc.dat' sorted.bam && samtools mpileup -A -a -d 0 -Q 0 sorted.bam | ivar consensus -p consensus -q 20 -t 0.7 -c 0.8 -m 50 -n N && sed -i "s|consensus|ERR4970105|" consensus.fa

Exit Code:

```
0
```

Standard Error:

[mpileup] 1 samples in 1 input files
[mpileup] Max depth set to maximum value (2147483647)

Standard Output:

Minimum Quality: 20
Threshold: 0.7
Minimum depth: 50
Minimum Insert Threshold: 0.8
Regions with depth less than minimum depth covered by: N
Reference length: 29903
Positions with 0 depth: 121
Positions with depth below 50: 121

Traceback:

Job Parameters:

Job parameter	Parameter value
__input_ext	`"input"`
__workflow_invocation_uuid__	`"73f8bafce47e11efb46f6045bd4853a8"`
chromInfo	`"/tmp/tmp_78p4i9b/galaxy-dev/tool-data/shared/ucsc/chrom/?.len"`
dbkey	`"?"`
depth_action	`"-n N"`
filter_depth	`"false"`
gap	`"true"`
min_depth	`"50"`
min_freq	`"0.7"`
min_indel_freq	`"0.8"`
min_qual	`"20"`

Step 16: Quality Control Report:

step_state: scheduled

Jobs

Job 1:

Job state is ok

Command Line:

die() { echo "$@" 1>&2 ; exit 1; } &&  mkdir multiqc_WDir &&   mkdir multiqc_WDir/fastp_0 &&    ln -s '/tmp/tmp_78p4i9b/files/1/c/9/dataset_1c9111c4-296c-4b64-81a6-fef12853b450.dat' 'multiqc_WDir/fastp_0/ERR4970105fastp.json' && grep -q "report_title" 'multiqc_WDir/fastp_0/ERR4970105fastp.json' || die "'report_title' or 'report_title' not found in the file" && mkdir multiqc_WDir/samtools_1 &&    mkdir 'multiqc_WDir/samtools_1/stats_0' &&      grep -q 'This file was produced by samtools stats' /tmp/tmp_78p4i9b/files/4/d/d/dataset_4dd1639b-a19e-488b-ad6c-50adac10855f.dat || die "Module 'samtools: 'This file was produced by samtools stats' not found in the file 'ERR4970105'" && ln -s '/tmp/tmp_78p4i9b/files/4/d/d/dataset_4dd1639b-a19e-488b-ad6c-50adac10855f.dat' 'multiqc_WDir/samtools_1/stats_0/ERR4970105'  &&    mkdir multiqc_WDir/qualimap_2 &&  sample="$(grep 'bam file = ' /tmp/tmp_78p4i9b/files/3/f/9/dataset_3f9e48a1-c7b8-4983-8ca9-2cd5d3a07061.dat | sed 's/bam file = //g' | sed 's: ::g')" && dir_name="multiqc_WDir/qualimap_2/${sample}" && mkdir -p ${dir_name} && filepath_1="${dir_name}/genome_results.txt" && ln -sf '/tmp/tmp_78p4i9b/files/3/f/9/dataset_3f9e48a1-c7b8-4983-8ca9-2cd5d3a07061.dat' ${filepath_1} && nested_dir_name="${dir_name}/raw_data_qualimapReport/" && mkdir -p ${nested_dir_name} && filepath_2="${nested_dir_name}/coverage_histogram.txt" && ln -sf '/tmp/tmp_78p4i9b/files/7/2/e/dataset_72eca60d-d9b5-4ace-90f1-913c1f20b708.dat' ${filepath_2} && nested_dir_name="${dir_name}/raw_data_qualimapReport/" && mkdir -p ${nested_dir_name} && filepath_3="${nested_dir_name}/mapped_reads_gc-content_distribution.txt" && ln -sf '/tmp/tmp_78p4i9b/files/3/9/5/dataset_395f34fd-ddb1-4b5f-83ff-52ec6998262f.dat' ${filepath_3} &&   multiqc multiqc_WDir --filename 'report'

Exit Code:

```
0
```

Standard Error:

  /// MultiQC 🔍 | v1.11

|           multiqc | MultiQC Version v1.27 now available!
|           multiqc | Search path : /tmp/tmp_78p4i9b/job_working_directory/000/15/working/multiqc_WDir
|          qualimap | Found 1 BamQC reports
|          samtools | Found 1 stats reports
|             fastp | Found 1 reports
|           multiqc | Compressing plot data
|           multiqc | Report      : report.html
|           multiqc | Data        : report_data
|           multiqc | MultiQC complete

Standard Output:

|         searching | ━━━━━━━━━━━━━━━━━━━━━━━━━━━━━━━━━━━━━━━━ 100% 5/5

Traceback:

Job Parameters:

Job parameter	Parameter value
__input_ext	`"input"`
__workflow_invocation_uuid__	`"73f8bafce47e11efb46f6045bd4853a8"`
chromInfo	`"/tmp/tmp_78p4i9b/galaxy-dev/tool-data/shared/ucsc/chrom/?.len"`
comment	`""`
dbkey	`"?"`
export	`false`
flat	`false`
results	`[{"__index__": 0, "software_cond": {"__current_case__": 7, "input": {"values": [{"id": 4, "src": "hdca"}]}, "software": "fastp"}}, {"__index__": 1, "software_cond": {"__current_case__": 24, "output": [{"__index__": 0, "type": {"__current_case__": 0, "input": {"values": [{"id": 6, "src": "hdca"}]}, "type": "stats"}}], "software": "samtools"}}, {"__index__": 2, "software_cond": {"__current_case__": 20, "input": {"values": [{"id": 11, "src": "hdca"}]}, "software": "qualimap"}}]`
saveLog	`false`
title	`""`

Step 17: Annotated variants:

step_state: scheduled

Jobs

Job 1:

Job state is ok

Command Line:

snpEff -Xmx${GALAXY_MEMORY_MB:-8192}m eff -i vcf -o vcf -upDownStreamLen 0 -stats '/tmp/tmp_78p4i9b/job_working_directory/000/16/outputs/dataset_247a6907-a5a0-45d3-87be-966c355b9122.dat' -noLog  NC_045512.2  '/tmp/tmp_78p4i9b/files/f/3/c/dataset_f3c6f244-e590-4bbe-91b6-2dfd69eced80.dat' > '/tmp/tmp_78p4i9b/job_working_directory/000/16/outputs/dataset_4922aab7-94c0-4e35-ac12-1786c79e8af6.dat'  && mkdir '/tmp/tmp_78p4i9b/job_working_directory/000/16/outputs/dataset_247a6907-a5a0-45d3-87be-966c355b9122_files' && mv '/tmp/tmp_78p4i9b/job_working_directory/000/16/outputs/dataset_247a6907-a5a0-45d3-87be-966c355b9122.dat.genes.txt' '/tmp/tmp_78p4i9b/job_working_directory/000/16/outputs/dataset_247a6907-a5a0-45d3-87be-966c355b9122_files/dataset_247a6907-a5a0-45d3-87be-966c355b9122.dat.genes.txt'

Exit Code:

```
0
```

Traceback:

Job Parameters:

Job parameter	Parameter value
__input_ext	`"vcf"`
__workflow_invocation_uuid__	`"73f8bafce47e11efb46f6045bd4853a8"`
annotations	`None`
chr	`""`
chromInfo	`"/tmp/tmp_78p4i9b/galaxy-dev/tool-data/shared/ucsc/chrom/?.len"`
csvStats	`false`
dbkey	`"?"`
filter	`{"__current_case__": 0, "specificEffects": "no"}`
filterOut	`None`
generate_stats	`true`
genome_version	`"NC_045512.2"`
inputFormat	`"vcf"`
intervals	`None`
noLog	`true`
offset	`"default"`
outputConditional	`{"__current_case__": 0, "outputFormat": "vcf"}`
transcripts	`None`
udLength	`"0"`

Step 18: Consensus genome (masked for depth):

step_state: scheduled

Jobs

Job 1:

Job state is ok

Command Line:

sed --sandbox -r -f '/tmp/tmp_78p4i9b/job_working_directory/000/17/configs/tmp952z2v9u' '/tmp/tmp_78p4i9b/files/6/e/c/dataset_6ec02191-dc14-4a6e-9556-8a71a65b9bca.dat' > '/tmp/tmp_78p4i9b/job_working_directory/000/17/outputs/dataset_39120ab4-a0cc-47c9-928a-ba72d8892ab2.dat'

Exit Code:

```
0
```

Traceback:

Job Parameters:

Job parameter	Parameter value
__input_ext	`"fasta"`
__workflow_invocation_uuid__	`"73f8bafce47e11efb46f6045bd4853a8"`
adv_opts	`{"__current_case__": 0, "adv_opts_selector": "basic"}`
chromInfo	`"/tmp/tmp_78p4i9b/galaxy-dev/tool-data/shared/ucsc/chrom/?.len"`
code	`"/^>/s/Consensus_(.)_threshold_./\\1/"`
dbkey	`"?"`

Step 19: toolshed.g2.bx.psu.edu/repos/bgruening/text_processing/tp_cat/0.1.1:

step_state: scheduled

Jobs

Job 1:

Job state is ok

Command Line:

cat '/tmp/tmp_78p4i9b/files/3/9/1/dataset_39120ab4-a0cc-47c9-928a-ba72d8892ab2.dat' >> '/tmp/tmp_78p4i9b/job_working_directory/000/18/outputs/dataset_51af4c99-8275-4b73-b13e-02ba832e0a36.dat' && exit 0

Exit Code:

```
0
```

Traceback:

Job Parameters:

Job parameter	Parameter value
__input_ext	`"fasta"`
__workflow_invocation_uuid__	`"73f8bafce47e11efb46f6045bd4853a8"`
chromInfo	`"/tmp/tmp_78p4i9b/galaxy-dev/tool-data/shared/ucsc/chrom/?.len"`
dbkey	`"?"`
queries	`[]`

Step 20: toolshed.g2.bx.psu.edu/repos/iuc/pangolin/pangolin/4.3+galaxy1:

step_state: scheduled

Jobs

Job 1:

Job state is ok

Command Line:

ln -s '/tmp/tmp_78p4i9b/files/5/1/a/dataset_51af4c99-8275-4b73-b13e-02ba832e0a36.dat' query.fa && pangolin --threads ${GALAXY_SLOTS:-1} --tempdir "${TMPDIR:-.}" --analysis-mode usher --outfile report.csv --max-ambig 0.5 --min-length 10000  query.fa && csvtk csv2tab report.csv > '/tmp/tmp_78p4i9b/job_working_directory/000/19/outputs/dataset_158bdcb5-5efa-407f-9f33-f2b1218e9f9d.dat'

Exit Code:

```
0
```

Standard Error:

Building DAG of jobs...
Using shell: /bin/bash
Provided cores: 1 (use --cores to define parallelism)
Rules claiming more threads will be scaled down.
Job stats:
job                      count    min threads    max threads
---------------------  -------  -------------  -------------
align_to_reference           1              1              1
all                          1              1              1
cache_sequence_assign        1              1              1
create_seq_hash              1              1              1
get_constellations           1              1              1
merged_info                  1              1              1
scorpio                      1              1              1
sequence_qc                  1              1              1
total                        8              1              1

Select jobs to execute...
Building DAG of jobs...
Using shell: /bin/bash
Provided cores: 1 (use --cores to define parallelism)
Rules claiming more threads will be scaled down.
Select jobs to execute...
Select jobs to execute...
Building DAG of jobs...
Using shell: /bin/bash
Provided cores: 1 (use --cores to define parallelism)
Rules claiming more threads will be scaled down.
Select jobs to execute...
Select jobs to execute...
Building DAG of jobs...
Using shell: /bin/bash
Provided cores: 1 (use --cores to define parallelism)
Rules claiming more threads will be scaled down.
Select jobs to execute...
Select jobs to execute...
Building DAG of jobs...
Using shell: /bin/bash
Provided cores: 1 (use --cores to define parallelism)
Rules claiming more threads will be scaled down.
Select jobs to execute...
Select jobs to execute...
Building DAG of jobs...
Using shell: /bin/bash
Provided cores: 1 (use --cores to define parallelism)
Rules claiming more threads will be scaled down.
Select jobs to execute...
Select jobs to execute...
Building DAG of jobs...
Using shell: /bin/bash
Provided cores: 1 (use --cores to define parallelism)
Rules claiming more threads will be scaled down.
Select jobs to execute...
Select jobs to execute...
Building DAG of jobs...
Using shell: /bin/bash
Provided cores: 1 (use --cores to define parallelism)
Rules claiming more threads will be scaled down.
Select jobs to execute...
Select jobs to execute...
Complete log: .snakemake/log/2025-02-06T113958.478986.snakemake.log
Building DAG of jobs...
Using shell: /bin/bash
Provided cores: 1 (use --cores to define parallelism)
Rules claiming more threads will be scaled down.
Job stats:
job                count    min threads    max threads
---------------  -------  -------------  -------------
all                    1              1              1
usher_cache            1              1              1
usher_inference        1              1              1
usher_to_report        1              1              1
total                  4              1              1

Select jobs to execute...
Building DAG of jobs...
Using shell: /bin/bash
Provided cores: 1 (use --cores to define parallelism)
Rules claiming more threads will be scaled down.
Select jobs to execute...
Select jobs to execute...
Select jobs to execute...
Building DAG of jobs...
Using shell: /bin/bash
Provided cores: 1 (use --cores to define parallelism)
Rules claiming more threads will be scaled down.
Select jobs to execute...
Select jobs to execute...
Complete log: .snakemake/log/2025-02-06T114009.081672.snakemake.log

Standard Output:

�[32m****
Query sequences collapsed from �[0m1�[32m to �[0m1�[32m unique sequences.�[0m
�[32m****
�[0m1�[32m sequences assigned via designations.�[0m
�[32m****
Running sequence QC�[0m
�[32mTotal passing QC: �[0m1
Using UShER as inference engine.
�[32m****
Pangolin running in usher mode.
****�[0m
Converting minimum length of 10000.0 to maximum ambiguity of 0.666.
�[32mMaximum ambiguity allowed is 0.5.
****�[0m
�[32mQuery file:	�[0m/tmp/tmp_78p4i9b/job_working_directory/000/19/working/query.fa
�[32m****
Data files found:�[0m
usher_pb:	/usr/local/lib/python3.8/site-packages/pangolin_data/data/lineageTree.pb
�[32m****�[0m
�[32m****
Output file written to: �[0m/tmp/tmp_78p4i9b/job_working_directory/000/19/working/report.csv

Traceback:

Job Parameters:

Job parameter	Parameter value
__input_ext	`"input"`
__workflow_invocation_uuid__	`"73f8bafce47e11efb46f6045bd4853a8"`
alignment	`false`
chromInfo	`"/tmp/tmp_78p4i9b/galaxy-dev/tool-data/shared/ucsc/chrom/?.len"`
constellations	`{"__current_case__": 0, "source": "default"}`
db	`{"__current_case__": 0, "source": "download"}`
dbkey	`"?"`
engine	`{"__current_case__": 0, "analysis_mode": "usher", "pangolin_data": {"__current_case__": 0, "source": "default"}}`
expanded_lineage	`false`
include_header	`true`
max_ambig	`"0.5"`
min_length	`"10000"`
usher	`"false"`

Step 3: Primer BED:
- step_state: scheduled

Step 21: toolshed.g2.bx.psu.edu/repos/iuc/nextclade/nextclade/2.7.0+galaxy0:

step_state: scheduled

Jobs

Job 1:

Job state is ok

Command Line:

nextclade dataset get -n 'sars-cov-2' -o db &&  ln -s '/tmp/tmp_78p4i9b/files/5/1/a/dataset_51af4c99-8275-4b73-b13e-02ba832e0a36.dat' query.fa &&  nextclade run --input-dataset db/ --output-tsv '/tmp/tmp_78p4i9b/job_working_directory/000/20/outputs/dataset_22e09bb3-0bf0-4ecb-a6b6-31aff9fa3653.dat' query.fa

Exit Code:

```
0
```

Traceback:

Job Parameters:

Job parameter	Parameter value
__input_ext	`"input"`
__workflow_invocation_uuid__	`"73f8bafce47e11efb46f6045bd4853a8"`
adv	`{"__current_case__": 1, "advanced_options": "no"}`
chromInfo	`"/tmp/tmp_78p4i9b/galaxy-dev/tool-data/shared/ucsc/chrom/?.len"`
db	`{"__current_case__": 1, "source": "download"}`
dbkey	`"?"`
include_header	`true`
organism	`"sars-cov-2"`
outputs	`["report_tsv"]`

Step 4: Read fraction to call variant:
- step_state: scheduled
Step 5: Minimum quality score to call base:
- step_state: scheduled

Step 6: fastp: Trimmed Illumina Reads:

step_state: scheduled

Jobs

Job 1:

Job state is ok

Command Line:

ln -s '/tmp/tmp_78p4i9b/files/c/0/a/dataset_c0a63c76-93a3-4bd1-99c7-0ef336e111ff.dat' 'ERR4970105.fastq.gz' && ln -s '/tmp/tmp_78p4i9b/files/d/1/3/dataset_d13233df-48fd-4a55-b87b-c550de2e79b9.dat' 'ERR4970105_R2.fastq.gz' &&    fastp  --thread ${GALAXY_SLOTS:-1} --report_title 'fastp report for ERR4970105.fastq.gz'   -i 'ERR4970105.fastq.gz' -o first.fastq.gz  -I 'ERR4970105_R2.fastq.gz' -O second.fastq.gz       --detect_adapter_for_pe                                          &&  mv first.fastq.gz '/tmp/tmp_78p4i9b/job_working_directory/000/5/outputs/dataset_820cd2cd-4df3-4fad-b27d-ebe82c590d84.dat' && mv second.fastq.gz '/tmp/tmp_78p4i9b/job_working_directory/000/5/outputs/dataset_f6fe3469-b30b-457f-a80e-4c1a833c5906.dat'

Exit Code:

```
0
```

Standard Error:

Detecting adapter sequence for read1...
CTCTCCTAGCACCATCATCATACACAGTTCTTGCTGTCATAAGGATTAGTAACACTACAG

Detecting adapter sequence for read2...
CTCTCCTAGCACCATCATCATACACAGTTCTTGCTGTCATAAGGATTAGTAACACTACAG

Read1 before filtering:
total reads: 707690
total bases: 97405232
Q20 bases: 93166566(95.6484%)
Q30 bases: 89404089(91.7857%)

Read2 before filtering:
total reads: 707690
total bases: 97415128
Q20 bases: 93483015(95.9635%)
Q30 bases: 89513507(91.8887%)

Read1 after filtering:
total reads: 696698
total bases: 95828657
Q20 bases: 91755464(95.7495%)
Q30 bases: 88071968(91.9057%)

Read2 after filtering:
total reads: 696698
total bases: 95840876
Q20 bases: 92079323(96.0752%)
Q30 bases: 88192318(92.0195%)

Filtering result:
reads passed filter: 1393396
reads failed due to low quality: 5474
reads failed due to too many N: 8
reads failed due to too short: 16502
reads with adapter trimmed: 12822
bases trimmed due to adapters: 646899

Duplication rate: 21.3582%

Insert size peak (evaluated by paired-end reads): 180

JSON report: fastp.json
HTML report: fastp.html

fastp --thread 1 --report_title fastp report for ERR4970105.fastq.gz -i ERR4970105.fastq.gz -o first.fastq.gz -I ERR4970105_R2.fastq.gz -O second.fastq.gz --detect_adapter_for_pe 
fastp v0.23.2, time used: 21 seconds

Traceback:

Job Parameters:

Job parameter	Parameter value
__input_ext	`"fastqsanger.gz"`
__workflow_invocation_uuid__	`"73f8bafce47e11efb46f6045bd4853a8"`
chromInfo	`"/tmp/tmp_78p4i9b/galaxy-dev/tool-data/shared/ucsc/chrom/?.len"`
dbkey	`"?"`
filter_options	`{"length_filtering_options": {"disable_length_filtering": false, "length_limit": null, "length_required": null}, "low_complexity_filter": {"complexity_threshold": null, "enable_low_complexity_filter": false}, "quality_filtering_options": {"disable_quality_filtering": false, "n_base_limit": null, "qualified_quality_phred": null, "unqualified_percent_limit": null}}`
output_options	`{"report_html": true, "report_json": true}`
overrepresented_sequence_analysis	`{"overrepresentation_analysis": false, "overrepresentation_sampling": null}`
read_mod_options	`{"base_correction_options": {"correction": false}, "cutting_by_quality_options": {"cut_by_quality3": false, "cut_by_quality5": false, "cut_mean_quality": null, "cut_window_size": null}, "polyg_tail_trimming": {"__current_case__": 1, "poly_g_min_len": null, "trimming_select": ""}, "polyx_tail_trimming": {"__current_case__": 1, "polyx_trimming_select": ""}, "umi_processing": {"umi": false, "umi_len": null, "umi_loc": "", "umi_prefix": ""}}`
single_paired	`{"__current_case__": 2, "adapter_trimming_options": {"adapter_sequence1": "", "adapter_sequence2": "", "disable_adapter_trimming": false}, "global_trimming_options": {"trim_front1": null, "trim_front2": null, "trim_tail1": null, "trim_tail2": null}, "paired_input": {"values": [{"id": 1, "src": "dce"}]}, "single_paired_selector": "paired_collection"}`

Step 7: Rename reference to NC_045512.2:

step_state: scheduled

Jobs

Job 1:

Job state is ok

Command Line:

sed --sandbox -r -f '/tmp/tmp_78p4i9b/job_working_directory/000/6/configs/tmpk6pi0ycx' '/tmp/tmp_78p4i9b/files/6/c/2/dataset_6c2a5524-a718-4364-b463-af2030cf34e3.dat' > '/tmp/tmp_78p4i9b/job_working_directory/000/6/outputs/dataset_ade00bbc-8cf9-4296-b578-6e91db9ff404.dat'

Exit Code:

```
0
```

Traceback:

Job Parameters:

Job parameter	Parameter value
__input_ext	`"fasta"`
__workflow_invocation_uuid__	`"73f8bafce47e11efb46f6045bd4853a8"`
adv_opts	`{"__current_case__": 0, "adv_opts_selector": "basic"}`
chromInfo	`"/tmp/tmp_78p4i9b/galaxy-dev/tool-data/shared/ucsc/chrom/?.len"`
code	`"/^>/s/^>MN908947.3/>NC_045512.2/"`
dbkey	`"?"`

Step 8: toolshed.g2.bx.psu.edu/repos/devteam/bwa/bwa_mem/0.7.17.2:

step_state: scheduled

Jobs

Job 1:

Job state is ok

Command Line:

set -o | grep -q pipefail && set -o pipefail;  ln -s '/tmp/tmp_78p4i9b/files/a/d/e/dataset_ade00bbc-8cf9-4296-b578-6e91db9ff404.dat' 'localref.fa' && bwa index 'localref.fa' &&    bwa mem  -t "${GALAXY_SLOTS:-1}" -v 1                 'localref.fa' '/tmp/tmp_78p4i9b/files/8/2/0/dataset_820cd2cd-4df3-4fad-b27d-ebe82c590d84.dat' '/tmp/tmp_78p4i9b/files/f/6/f/dataset_f6fe3469-b30b-457f-a80e-4c1a833c5906.dat'  | samtools sort -@${GALAXY_SLOTS:-2} -T "${TMPDIR:-.}" -O bam -o '/tmp/tmp_78p4i9b/job_working_directory/000/7/outputs/dataset_4b254559-eefd-4ad5-8d22-4742f6f2d603.dat'

Exit Code:

```
0
```

Standard Error:

[bwa_index] Pack FASTA... 0.00 sec
[bwa_index] Construct BWT for the packed sequence...
[bwa_index] 0.00 seconds elapse.
[bwa_index] Update BWT... 0.00 sec
[bwa_index] Pack forward-only FASTA... 0.00 sec
[bwa_index] Construct SA from BWT and Occ... 0.00 sec
[main] Version: 0.7.17-r1188
[main] CMD: bwa index localref.fa
[main] Real time: 0.013 sec; CPU: 0.008 sec
[M::mem_pestat] skip orientation FF as there are not enough pairs
[M::mem_pestat] analyzing insert size distribution for orientation FR...
[M::mem_pestat] (25, 50, 75) percentile: (130, 183, 250)
[M::mem_pestat] low and high boundaries for computing mean and std.dev: (1, 490)
[M::mem_pestat] mean and std.dev: (192.95, 81.20)
[M::mem_pestat] low and high boundaries for proper pairs: (1, 610)
[M::mem_pestat] skip orientation RF as there are not enough pairs
[M::mem_pestat] skip orientation RR as there are not enough pairs
[M::mem_pestat] skip orientation FF as there are not enough pairs
[M::mem_pestat] analyzing insert size distribution for orientation FR...
[M::mem_pestat] (25, 50, 75) percentile: (139, 196, 270)
[M::mem_pestat] low and high boundaries for computing mean and std.dev: (1, 532)
[M::mem_pestat] mean and std.dev: (204.90, 83.45)
[M::mem_pestat] low and high boundaries for proper pairs: (1, 663)
[M::mem_pestat] analyzing insert size distribution for orientation RF...
[M::mem_pestat] (25, 50, 75) percentile: (290, 300, 443)
[M::mem_pestat] low and high boundaries for computing mean and std.dev: (1, 749)
[M::mem_pestat] mean and std.dev: (360.62, 102.45)
[M::mem_pestat] low and high boundaries for proper pairs: (1, 902)
[M::mem_pestat] skip orientation RR as there are not enough pairs
[M::mem_pestat] skip orientation RF
[M::mem_pestat] skip orientation FF as there are not enough pairs
[M::mem_pestat] analyzing insert size distribution for orientation FR...
[M::mem_pestat] (25, 50, 75) percentile: (136, 186, 265)
[M::mem_pestat] low and high boundaries for computing mean and std.dev: (1, 523)
[M::mem_pestat] mean and std.dev: (199.40, 83.35)
[M::mem_pestat] low and high boundaries for proper pairs: (1, 652)
[M::mem_pestat] analyzing insert size distribution for orientation RF...
[M::mem_pestat] (25, 50, 75) percentile: (813, 882, 897)
[M::mem_pestat] low and high boundaries for computing mean and std.dev: (645, 1065)
[M::mem_pestat] mean and std.dev: (882.10, 28.87)
[M::mem_pestat] low and high boundaries for proper pairs: (561, 1149)
[M::mem_pestat] skip orientation RR as there are not enough pairs
[M::mem_pestat] skip orientation RF
[M::mem_pestat] skip orientation FF as there are not enough pairs
[M::mem_pestat] analyzing insert size distribution for orientation FR...
[M::mem_pestat] (25, 50, 75) percentile: (143, 209, 286)
[M::mem_pestat] low and high boundaries for computing mean and std.dev: (1, 572)
[M::mem_pestat] mean and std.dev: (214.20, 87.11)
[M::mem_pestat] low and high boundaries for proper pairs: (1, 715)
[M::mem_pestat] analyzing insert size distribution for orientation RF...
[M::mem_pestat] (25, 50, 75) percentile: (255, 270, 376)
[M::mem_pestat] low and high boundaries for computing mean and std.dev: (13, 618)
[M::mem_pestat] mean and std.dev: (282.23, 41.67)
[M::mem_pestat] low and high boundaries for proper pairs: (1, 739)
[M::mem_pestat] skip orientation RR as there are not enough pairs
[M::mem_pestat] skip orientation RF
[M::mem_pestat] skip orientation FF as there are not enough pairs
[M::mem_pestat] analyzing insert size distribution for orientation FR...
[M::mem_pestat] (25, 50, 75) percentile: (150, 209, 287)
[M::mem_pestat] low and high boundaries for computing mean and std.dev: (1, 561)
[M::mem_pestat] mean and std.dev: (216.92, 86.29)
[M::mem_pestat] low and high boundaries for proper pairs: (1, 698)
[M::mem_pestat] skip orientation RF as there are not enough pairs
[M::mem_pestat] skip orientation RR as there are not enough pairs
[M::mem_pestat] analyzing insert size distribution for orientation FF...
[M::mem_pestat] (25, 50, 75) percentile: (115, 176, 216)
[M::mem_pestat] low and high boundaries for computing mean and std.dev: (1, 418)
[M::mem_pestat] mean and std.dev: (158.75, 57.01)
[M::mem_pestat] low and high boundaries for proper pairs: (1, 519)
[M::mem_pestat] analyzing insert size distribution for orientation FR...
[M::mem_pestat] (25, 50, 75) percentile: (137, 195, 271)
[M::mem_pestat] low and high boundaries for computing mean and std.dev: (1, 539)
[M::mem_pestat] mean and std.dev: (203.52, 83.62)
[M::mem_pestat] low and high boundaries for proper pairs: (1, 673)
[M::mem_pestat] analyzing insert size distribution for orientation RF...
[M::mem_pestat] (25, 50, 75) percentile: (266, 302, 4639)
[M::mem_pestat] low and high boundaries for computing mean and std.dev: (1, 13385)
[M::mem_pestat] mean and std.dev: (2099.47, 2124.22)
[M::mem_pestat] low and high boundaries for proper pairs: (1, 17758)
[M::mem_pestat] analyzing insert size distribution for orientation RR...
[M::mem_pestat] (25, 50, 75) percentile: (136, 150, 200)
[M::mem_pestat] low and high boundaries for computing mean and std.dev: (8, 328)
[M::mem_pestat] mean and std.dev: (159.05, 47.82)
[M::mem_pestat] low and high boundaries for proper pairs: (1, 392)
[M::mem_pestat] skip orientation FF
[M::mem_pestat] skip orientation RF
[M::mem_pestat] skip orientation RR
[M::mem_pestat] skip orientation FF as there are not enough pairs
[M::mem_pestat] analyzing insert size distribution for orientation FR...
[M::mem_pestat] (25, 50, 75) percentile: (145, 204, 274)
[M::mem_pestat] low and high boundaries for computing mean and std.dev: (1, 532)
[M::mem_pestat] mean and std.dev: (209.72, 85.57)
[M::mem_pestat] low and high boundaries for proper pairs: (1, 661)
[M::mem_pestat] analyzing insert size distribution for orientation RF...
[M::mem_pestat] (25, 50, 75) percentile: (428, 567, 992)
[M::mem_pestat] low and high boundaries for computing mean and std.dev: (1, 2120)
[M::mem_pestat] mean and std.dev: (576.70, 310.31)
[M::mem_pestat] low and high boundaries for proper pairs: (1, 2684)
[M::mem_pestat] skip orientation RR as there are not enough pairs
[M::mem_pestat] skip orientation RF
[M::mem_pestat] skip orientation FF as there are not enough pairs
[M::mem_pestat] analyzing insert size distribution for orientation FR...
[M::mem_pestat] (25, 50, 75) percentile: (141, 204, 283)
[M::mem_pestat] low and high boundaries for computing mean and std.dev: (1, 567)
[M::mem_pestat] mean and std.dev: (211.20, 85.86)
[M::mem_pestat] low and high boundaries for proper pairs: (1, 709)
[M::mem_pestat] analyzing insert size distribution for orientation RF...
[M::mem_pestat] (25, 50, 75) percentile: (300, 391, 4477)
[M::mem_pestat] low and high boundaries for computing mean and std.dev: (1, 12831)
[M::mem_pestat] mean and std.dev: (1720.00, 1974.77)
[M::mem_pestat] low and high boundaries for proper pairs: (1, 17008)
[M::mem_pestat] skip orientation RR as there are not enough pairs
[M::mem_pestat] skip orientation RF
[M::mem_pestat] skip orientation FF as there are not enough pairs
[M::mem_pestat] analyzing insert size distribution for orientation FR...
[M::mem_pestat] (25, 50, 75) percentile: (136, 184, 263)
[M::mem_pestat] low and high boundaries for computing mean and std.dev: (1, 517)
[M::mem_pestat] mean and std.dev: (198.45, 84.26)
[M::mem_pestat] low and high boundaries for proper pairs: (1, 644)
[M::mem_pestat] skip orientation RF as there are not enough pairs
[M::mem_pestat] skip orientation RR as there are not enough pairs
[M::mem_pestat] skip orientation FF as there are not enough pairs
[M::mem_pestat] analyzing insert size distribution for orientation FR...
[M::mem_pestat] (25, 50, 75) percentile: (142, 205, 272)
[M::mem_pestat] low and high boundaries for computing mean and std.dev: (1, 532)
[M::mem_pestat] mean and std.dev: (207.61, 82.10)
[M::mem_pestat] low and high boundaries for proper pairs: (1, 662)
[M::mem_pestat] skip orientation RF as there are not enough pairs
[M::mem_pestat] skip orientation RR as there are not enough pairs
[M::mem_pestat] skip orientation FF as there are not enough pairs
[M::mem_pestat] analyzing insert size distribution for orientation FR...
[M::mem_pestat] (25, 50, 75) percentile: (139, 203, 279)
[M::mem_pestat] low and high boundaries for computing mean and std.dev: (1, 559)
[M::mem_pestat] mean and std.dev: (209.05, 86.27)
[M::mem_pestat] low and high boundaries for proper pairs: (1, 699)
[M::mem_pestat] skip orientation RF as there are not enough pairs
[M::mem_pestat] skip orientation RR as there are not enough pairs
[M::mem_pestat] skip orientation FF as there are not enough pairs
[M::mem_pestat] analyzing insert size distribution for orientation FR...
[M::mem_pestat] (25, 50, 75) percentile: (130, 189, 270)
[M::mem_pestat] low and high boundaries for computing mean and std.dev: (1, 550)
[M::mem_pestat] mean and std.dev: (201.34, 88.48)
[M::mem_pestat] low and high boundaries for proper pairs: (1, 690)
[M::mem_pestat] analyzing insert size distribution for orientation RF...
[M::mem_pestat] (25, 50, 75) percentile: (934, 1043, 1585)
[M::mem_pestat] low and high boundaries for computing mean and std.dev: (1, 2887)
[M::mem_pestat] mean and std.dev: (1098.42, 421.00)
[M::mem_pestat] low and high boundaries for proper pairs: (1, 3538)
[M::mem_pestat] skip orientation RR as there are not enough pairs
[M::mem_pestat] skip orientation RF
[M::mem_pestat] skip orientation FF as there are not enough pairs
[M::mem_pestat] analyzing insert size distribution for orientation FR...
[M::mem_pestat] (25, 50, 75) percentile: (136, 200, 274)
[M::mem_pestat] low and high boundaries for computing mean and std.dev: (1, 550)
[M::mem_pestat] mean and std.dev: (206.67, 86.89)
[M::mem_pestat] low and high boundaries for proper pairs: (1, 688)
[M::mem_pestat] analyzing insert size distribution for orientation RF...
[M::mem_pestat] (25, 50, 75) percentile: (222, 297, 385)
[M::mem_pestat] low and high boundaries for computing mean and std.dev: (1, 711)
[M::mem_pestat] mean and std.dev: (278.50, 84.25)
[M::mem_pestat] low and high boundaries for proper pairs: (1, 874)
[M::mem_pestat] skip orientation RR as there are not enough pairs
[M::mem_pestat] skip orientation RF
[M::mem_pestat] skip orientation FF as there are not enough pairs
[M::mem_pestat] analyzing insert size distribution for orientation FR...
[M::mem_pestat] (25, 50, 75) percentile: (136, 189, 262)
[M::mem_pestat] low and high boundaries for computing mean and std.dev: (1, 514)
[M::mem_pestat] mean and std.dev: (199.95, 84.39)
[M::mem_pestat] low and high boundaries for proper pairs: (1, 640)
[M::mem_pestat] analyzing insert size distribution for orientation RF...
[M::mem_pestat] (25, 50, 75) percentile: (372, 407, 3499)
[M::mem_pestat] low and high boundaries for computing mean and std.dev: (1, 9753)
[M::mem_pestat] mean and std.dev: (2040.64, 2446.78)
[M::mem_pestat] low and high boundaries for proper pairs: (1, 12880)
[M::mem_pestat] skip orientation RR as there are not enough pairs
[M::mem_pestat] skip orientation RF
[M::mem_pestat] skip orientation FF as there are not enough pairs
[M::mem_pestat] analyzing insert size distribution for orientation FR...
[M::mem_pestat] (25, 50, 75) percentile: (146, 208, 279)
[M::mem_pestat] low and high boundaries for computing mean and std.dev: (1, 545)
[M::mem_pestat] mean and std.dev: (213.16, 83.22)
[M::mem_pestat] low and high boundaries for proper pairs: (1, 678)
[M::mem_pestat] skip orientation RF as there are not enough pairs
[M::mem_pestat] skip orientation RR as there are not enough pairs
[M::mem_pestat] skip orientation FF as there are not enough pairs
[M::mem_pestat] analyzing insert size distribution for orientation FR...
[M::mem_pestat] (25, 50, 75) percentile: (136, 187, 261)
[M::mem_pestat] low and high boundaries for computing mean and std.dev: (1, 511)
[M::mem_pestat] mean and std.dev: (199.31, 84.30)
[M::mem_pestat] low and high boundaries for proper pairs: (1, 636)
[M::mem_pestat] analyzing insert size distribution for orientation RF...
[M::mem_pestat] (25, 50, 75) percentile: (376, 790, 4533)
[M::mem_pestat] low and high boundaries for computing mean and std.dev: (1, 12847)
[M::mem_pestat] mean and std.dev: (2119.62, 2619.33)
[M::mem_pestat] low and high boundaries for proper pairs: (1, 17004)
[M::mem_pestat] skip orientation RR as there are not enough pairs
[M::mem_pestat] skip orientation RF
[M::mem_pestat] skip orientation FF as there are not enough pairs
[M::mem_pestat] analyzing insert size distribution for orientation FR...
[M::mem_pestat] (25, 50, 75) percentile: (140, 199, 267)
[M::mem_pestat] low and high boundaries for computing mean and std.dev: (1, 521)
[M::mem_pestat] mean and std.dev: (204.55, 82.72)
[M::mem_pestat] low and high boundaries for proper pairs: (1, 648)
[M::mem_pestat] skip orientation RF as there are not enough pairs
[M::mem_pestat] skip orientation RR as there are not enough pairs
[M::mem_pestat] skip orientation FF as there are not enough pairs
[M::mem_pestat] analyzing insert size distribution for orientation FR...
[M::mem_pestat] (25, 50, 75) percentile: (130, 189, 267)
[M::mem_pestat] low and high boundaries for computing mean and std.dev: (1, 541)
[M::mem_pestat] mean and std.dev: (200.01, 87.54)
[M::mem_pestat] low and high boundaries for proper pairs: (1, 678)
[M::mem_pestat] analyzing insert size distribution for orientation RF...
[M::mem_pestat] (25, 50, 75) percentile: (387, 508, 4514)
[M::mem_pestat] low and high boundaries for computing mean and std.dev: (1, 12768)
[M::mem_pestat] mean and std.dev: (2167.80, 2908.67)
[M::mem_pestat] low and high boundaries for proper pairs: (1, 16895)
[M::mem_pestat] skip orientation RR as there are not enough pairs
[M::mem_pestat] skip orientation RF
[M::mem_pestat] skip orientation FF as there are not enough pairs
[M::mem_pestat] analyzing insert size distribution for orientation FR...
[M::mem_pestat] (25, 50, 75) percentile: (131, 185, 259)
[M::mem_pestat] low and high boundaries for computing mean and std.dev: (1, 515)
[M::mem_pestat] mean and std.dev: (196.72, 84.31)
[M::mem_pestat] low and high boundaries for proper pairs: (1, 643)
[M::mem_pestat] analyzing insert size distribution for orientation RF...
[M::mem_pestat] (25, 50, 75) percentile: (333, 502, 1062)
[M::mem_pestat] low and high boundaries for computing mean and std.dev: (1, 2520)
[M::mem_pestat] mean and std.dev: (647.26, 361.81)
[M::mem_pestat] low and high boundaries for proper pairs: (1, 3249)
[M::mem_pestat] skip orientation RR as there are not enough pairs
[M::mem_pestat] skip orientation RF
[M::mem_pestat] analyzing insert size distribution for orientation FF...
[M::mem_pestat] (25, 50, 75) percentile: (120, 181, 239)
[M::mem_pestat] low and high boundaries for computing mean and std.dev: (1, 477)
[M::mem_pestat] mean and std.dev: (178.59, 80.72)
[M::mem_pestat] low and high boundaries for proper pairs: (1, 596)
[M::mem_pestat] analyzing insert size distribution for orientation FR...
[M::mem_pestat] (25, 50, 75) percentile: (151, 210, 285)
[M::mem_pestat] low and high boundaries for computing mean and std.dev: (1, 553)
[M::mem_pestat] mean and std.dev: (213.74, 81.61)
[M::mem_pestat] low and high boundaries for proper pairs: (1, 687)
[M::mem_pestat] analyzing insert size distribution for orientation RF...
[M::mem_pestat] (25, 50, 75) percentile: (258, 337, 437)
[M::mem_pestat] low and high boundaries for computing mean and std.dev: (1, 795)
[M::mem_pestat] mean and std.dev: (336.62, 78.55)
[M::mem_pestat] low and high boundaries for proper pairs: (1, 974)
[M::mem_pestat] analyzing insert size distribution for orientation RR...
[M::mem_pestat] (25, 50, 75) percentile: (117, 152, 226)
[M::mem_pestat] low and high boundaries for computing mean and std.dev: (1, 444)
[M::mem_pestat] mean and std.dev: (164.20, 75.05)
[M::mem_pestat] low and high boundaries for proper pairs: (1, 553)
[M::mem_pestat] skip orientation FF
[M::mem_pestat] skip orientation RF
[M::mem_pestat] skip orientation RR
[main] Version: 0.7.17-r1188
[main] CMD: bwa mem -t 1 -v 1 localref.fa /tmp/tmp_78p4i9b/files/8/2/0/dataset_820cd2cd-4df3-4fad-b27d-ebe82c590d84.dat /tmp/tmp_78p4i9b/files/f/6/f/dataset_f6fe3469-b30b-457f-a80e-4c1a833c5906.dat
[main] Real time: 38.785 sec; CPU: 35.277 sec

Traceback:

Job Parameters:

Job parameter	Parameter value
__input_ext	`"fasta"`
__workflow_invocation_uuid__	`"73f8bafce47e11efb46f6045bd4853a8"`
analysis_type	`{"__current_case__": 0, "analysis_type_selector": "illumina"}`
chromInfo	`"/tmp/tmp_78p4i9b/galaxy-dev/tool-data/shared/ucsc/chrom/?.len"`
dbkey	`"?"`
fastq_input	`{"__current_case__": 2, "fastq_input1": {"values": [{"id": 4, "src": "dce"}]}, "fastq_input_selector": "paired_collection", "iset_stats": ""}`
output_sort	`"coordinate"`
reference_source	`{"__current_case__": 1, "index_a": "auto", "ref_file": {"values": [{"id": 9, "src": "hda"}]}, "reference_source_selector": "history"}`
rg	`{"__current_case__": 3, "rg_selector": "do_not_set"}`

Step 9: toolshed.g2.bx.psu.edu/repos/devteam/samtools_stats/samtools_stats/2.0.4:

step_state: scheduled

Jobs

Job 1:

Job state is ok

Command Line:

addthreads=${GALAXY_SLOTS:-1} && (( addthreads-- )) &&   ln -s '/tmp/tmp_78p4i9b/files/4/b/2/dataset_4b254559-eefd-4ad5-8d22-4742f6f2d603.dat' infile && ln -s '/tmp/tmp_78p4i9b/files/_metadata_files/8/9/5/metadata_895c38c6-41de-464e-a52c-ea4ce23c3b61.dat' infile.bai &&       samtools stats       -@ $addthreads infile   > '/tmp/tmp_78p4i9b/job_working_directory/000/8/outputs/dataset_4dd1639b-a19e-488b-ad6c-50adac10855f.dat'

Exit Code:

```
0
```

Traceback:

Job Parameters:

Job parameter	Parameter value
__input_ext	`"input"`
__workflow_invocation_uuid__	`"73f8bafce47e11efb46f6045bd4853a8"`
addref_cond	`{"__current_case__": 0, "addref_select": "no"}`
chromInfo	`"/tmp/tmp_78p4i9b/galaxy-dev/tool-data/shared/ucsc/chrom/?.len"`
cond_region	`{"__current_case__": 0, "select_region": "no"}`
cov_threshold	`None`
coverage_cond	`{"__current_case__": 0, "coverage_select": "no"}`
dbkey	`"?"`
filter_by_flags	`{"__current_case__": 1, "filter_flags": "nofilter"}`
gc_depth	`None`
insert_size	`None`
most_inserts	`None`
read_group	`None`
read_length	`None`
remove_dups	`false`
remove_overlaps	`false`
sparse	`false`
split_output_cond	`{"__current_case__": 0, "split_output_selector": "no"}`
trim_quality	`None`

Step 10: toolshed.g2.bx.psu.edu/repos/iuc/samtools_view/samtools_view/1.15.1+galaxy0:

step_state: scheduled

Jobs

Job 1:

Job state is ok

Command Line:

addthreads=${GALAXY_SLOTS:-1} && (( addthreads-- )) &&   addmemory=${GALAXY_MEMORY_MB_PER_SLOT:-768} && ((addmemory=addmemory*75/100)) &&        ln -s '/tmp/tmp_78p4i9b/files/4/b/2/dataset_4b254559-eefd-4ad5-8d22-4742f6f2d603.dat' infile && ln -s '/tmp/tmp_78p4i9b/files/_metadata_files/8/9/5/metadata_895c38c6-41de-464e-a52c-ea4ce23c3b61.dat' infile.bai &&               samtools view -@ $addthreads -b  -q 20 -f 3 -F 0 -G 0    -o outfile      infile

Exit Code:

```
0
```

Traceback:

Job Parameters:

Job parameter	Parameter value
__input_ext	`"input"`
__workflow_invocation_uuid__	`"73f8bafce47e11efb46f6045bd4853a8"`
addref_cond	`{"__current_case__": 0, "addref_select": "no"}`
chromInfo	`"/tmp/tmp_78p4i9b/galaxy-dev/tool-data/shared/ucsc/chrom/?.len"`
dbkey	`"?"`
mode	{"__current_case__": 1, "filter_config": {"cigarcons": null, "cond_region": {"__current_case__": 0, "select_region": "no"}, "cond_rg": {"__current_case__": 0, "select_rg": "no"}, "exclusive_filter": null, "exclusive_filter_all": null, "inclusive_filter": ["1", "2"], "library": "", "qname_file": null, "quality": "20", "tag": null}, "output_options": {"__current_case__": 0, "adv_output": {"collapsecigar": false, "readtags": []}, "complementary_output": false, "output_format": {"__current_case__": 2, "oformat": "bam"}, "reads_report_type": "retained"}, "outtype": "selected_reads", "subsample_config": {"subsampling_mode": {"__current_case__": 0, "factor": "1.0", "seed": null, "select_subsample": "fraction"}}}

Other invocation details
- history_id
  - 1e87855d2268af3f
- history_state
  - ok
- invocation_id
  - 1e87855d2268af3f
- invocation_state
  - scheduled
- workflow_id
  - 1e87855d2268af3f

✅ taxonomic-rank-abundance-summary-table.ga_0

Workflow invocation details

Invocation Messages

Steps

Step 1: OTU tables:
- step_state: scheduled
Step 2: Taxonomic rank:
- step_state: scheduled

Step 3: toolshed.g2.bx.psu.edu/repos/iuc/map_param_value/map_param_value/0.2.0:

step_state: scheduled

Jobs

Job 1:

Job state is ok

Command Line:

```
cd ../; python _evaluate_expression_.py
```

Exit Code:

```
0
```

Traceback:

Job Parameters:

Job parameter	Parameter value
__input_ext	`"input"`
__workflow_invocation_uuid__	`"55bc847ee47e11efb46f000d3a62b9cd"`
chromInfo	`"/tmp/tmp8i8gwsl1/galaxy-dev/tool-data/shared/ucsc/chrom/?.len"`
dbkey	`"?"`
input_param_type	{"__current_case__": 0, "input_param": "family", "mappings": [{"__index__": 0, "from": "superkingdom", "to": "NR > 2 { split($3, taxa, \";\"); merged = \"\"; levels = 1; for (i = 1; i <= levels; i++) { if (i <= length(taxa) && taxa[i] ~ /__/) { split(taxa[i], parts, \"__\"); if (parts[2] != \"\") { value = parts[2]; } else { value = \"unassigned\"; } } else { value = \"unassigned\"; } merged = merged (merged ? \";\" : \"\") value; } print merged \"\\t\" $2; }"}, {"__index__": 1, "from": "kingdom", "to": "NR > 2 { split($3, taxa, \";\"); merged = \"\"; levels = 2; for (i = 1; i <= levels; i++) { if (i <= length(taxa) && taxa[i] ~ /__/) { split(taxa[i], parts, \"__\"); if (parts[2] != \"\") { value = parts[2]; } else { value = \"unassigned\"; } } else { value = \"unassigned\"; } merged = merged (merged ? \";\" : \"\") value; } print merged \"\\t\" $2; }"}, {"__index__": 2, "from": "phylum", "to": "NR > 2 { split($3, taxa, \";\"); merged = \"\"; levels = 3; for (i = 1; i <= levels; i++) { if (i <= length(taxa) && taxa[i] ~ /__/) { split(taxa[i], parts, \"__\"); if (parts[2] != \"\") { value = parts[2]; } else { value = \"unassigned\"; } } else { value = \"unassigned\"; } merged = merged (merged ? \";\" : \"\") value; } print merged \"\\t\" $2; }"}, {"__index__": 3, "from": "class", "to": "NR > 2 { split($3, taxa, \";\"); merged = \"\"; levels = 4; for (i = 1; i <= levels; i++) { if (i <= length(taxa) && taxa[i] ~ /__/) { split(taxa[i], parts, \"__\"); if (parts[2] != \"\") { value = parts[2]; } else { value = \"unassigned\"; } } else { value = \"unassigned\"; } merged = merged (merged ? \";\" : \"\") value; } print merged \"\\t\" $2; }"}, {"__index__": 4, "from": "order", "to": "NR > 2 { split($3, taxa, \";\"); merged = \"\"; levels = 5; for (i = 1; i <= levels; i++) { if (i <= length(taxa) && taxa[i] ~ /__/) { split(taxa[i], parts, \"__\"); if (parts[2] != \"\") { value = parts[2]; } else { value = \"unassigned\"; } } else { value = \"unassigned\"; } merged = merged (merged ? \";\" : \"\") value; } print merged \"\\t\" $2; }"}, {"__index__": 5, "from": "family", "to": "NR > 2 { split($3, taxa, \";\"); merged = \"\"; levels = 6; for (i = 1; i <= levels; i++) { if (i <= length(taxa) && taxa[i] ~ /__/) { split(taxa[i], parts, \"__\"); if (parts[2] != \"\") { value = parts[2]; } else { value = \"unassigned\"; } } else { value = \"unassigned\"; } merged = merged (merged ? \";\" : \"\") value; } print merged \"\\t\" $2; }"}, {"__index__": 6, "from": "genus", "to": "NR > 2 { split($3, taxa, \";\"); merged = \"\"; levels = 7; for (i = 1; i <= levels; i++) { if (i <= length(taxa) && taxa[i] ~ /__/) { split(taxa[i], parts, \"__\"); if (parts[2] != \"\") { value = parts[2]; } else { value = \"unassigned\"; } } else { value = \"unassigned\"; } merged = merged (merged ? \";\" : \"\") value; } print merged \"\\t\" $2; }"}, {"__index__": 7, "from": "species", "to": "NR > 2 { split($3, taxa, \";\"); merged = \"\"; levels = 8; for (i = 1; i <= levels; i++) { if (i <= length(taxa) && taxa[i] ~ /__/) { split(taxa[i], parts, \"__\"); if (parts[2] != \"\") { value = parts[2]; } else { value = \"unassigned\"; } } else { value = \"unassigned\"; } merged = merged (merged ? \";\" : \"\") value; } print merged \"\\t\" $2; }"}], "type": "text"}
output_param_type	`"text"`
unmapped	`{"__current_case__": 1, "on_unmapped": "fail"}`

Step 4: toolshed.g2.bx.psu.edu/repos/iuc/map_param_value/map_param_value/0.2.0:

step_state: scheduled

Jobs

Job 1:

Job state is ok

Command Line:

```
cd ../; python _evaluate_expression_.py
```

Exit Code:

```
0
```

Traceback:

Job Parameters:

Job parameter	Parameter value
__input_ext	`"input"`
__workflow_invocation_uuid__	`"55bc847ee47e11efb46f000d3a62b9cd"`
chromInfo	`"/tmp/tmp8i8gwsl1/galaxy-dev/tool-data/shared/ucsc/chrom/?.len"`
dbkey	`"?"`
input_param_type	{"__current_case__": 0, "input_param": "family", "mappings": [{"__index__": 0, "from": "superkingdom", "to": "BEGIN { FS = OFS = \"\\t\" } NR == 1 { printf \"superkingdom\"; for (i = 2; i <= NF; i++) { split($i, name_parts, \"_\"); printf \"\\t%s\", name_parts[1] } printf \"\\n\" } NR > 1 { split($1, taxa_parts, \";\"); for (i = 1; i <= 1; i++) { if (i < 1) { printf \"%s\\t\", taxa_parts[i] } else { printf \"%s\", taxa_parts[i] } } for (i = 2; i <= NF; i++) { if (i < NF) { printf \"\\t%s\", $i } else { printf \"\\t%s\\n\", $i } } }"}, {"__index__": 1, "from": "kingdom", "to": "BEGIN { FS = OFS = \"\\t\" } NR == 1 { printf \"superkingdom\\tkingdom\"; for (i = 2; i <= NF; i++) { split($i, name_parts, \"_\"); printf \"\\t%s\", name_parts[1] } printf \"\\n\" } NR > 1 { split($1, taxa_parts, \";\"); for (i = 1; i <= 2; i++) { if (i < 2) { printf \"%s\\t\", taxa_parts[i] } else { printf \"%s\", taxa_parts[i] } } for (i = 2; i <= NF; i++) { if (i < NF) { printf \"\\t%s\", $i } else { printf \"\\t%s\\n\", $i } } }"}, {"__index__": 2, "from": "phylum", "to": "BEGIN { FS = OFS = \"\\t\" } NR == 1 { printf \"superkingdom\\tkingdom\\tphylum\"; for (i = 2; i <= NF; i++) { split($i, name_parts, \"_\"); printf \"\\t%s\", name_parts[1] } printf \"\\n\" } NR > 1 { split($1, taxa_parts, \";\"); for (i = 1; i <= 3; i++) { if (i < 3) { printf \"%s\\t\", taxa_parts[i] } else { printf \"%s\", taxa_parts[i] } } for (i = 2; i <= NF; i++) { if (i < NF) { printf \"\\t%s\", $i } else { printf \"\\t%s\\n\", $i } } }"}, {"__index__": 3, "from": "class", "to": "BEGIN { FS = OFS = \"\\t\" } NR == 1 { printf \"superkingdom\\tkingdom\\tphylum\\tclass\"; for (i = 2; i <= NF; i++) { split($i, name_parts, \"_\"); printf \"\\t%s\", name_parts[1] } printf \"\\n\" } NR > 1 { split($1, taxa_parts, \";\"); for (i = 1; i <= 4; i++) { if (i < 4) { printf \"%s\\t\", taxa_parts[i] } else { printf \"%s\", taxa_parts[i] } } for (i = 2; i <= NF; i++) { if (i < NF) { printf \"\\t%s\", $i } else { printf \"\\t%s\\n\", $i } } }"}, {"__index__": 4, "from": "order", "to": "BEGIN { FS = OFS = \"\\t\" } NR == 1 { printf \"superkingdom\\tkingdom\\tphylum\\tclass\\torder\"; for (i = 2; i <= NF; i++) { split($i, name_parts, \"_\"); printf \"\\t%s\", name_parts[1] } printf \"\\n\" } NR > 1 { split($1, taxa_parts, \";\"); for (i = 1; i <= 5; i++) { if (i < 5) { printf \"%s\\t\", taxa_parts[i] } else { printf \"%s\", taxa_parts[i] } } for (i = 2; i <= NF; i++) { if (i < NF) { printf \"\\t%s\", $i } else { printf \"\\t%s\\n\", $i } } }"}, {"__index__": 5, "from": "family", "to": "BEGIN { FS = OFS = \"\\t\" } NR == 1 { printf \"superkingdom\\tkingdom\\tphylum\\tclass\\torder\\tfamily\"; for (i = 2; i <= NF; i++) { split($i, name_parts, \"_\"); printf \"\\t%s\", name_parts[1] } printf \"\\n\" } NR > 1 { split($1, taxa_parts, \";\"); for (i = 1; i <= 6; i++) { if (i < 6) { printf \"%s\\t\", taxa_parts[i] } else { printf \"%s\", taxa_parts[i] } } for (i = 2; i <= NF; i++) { if (i < NF) { printf \"\\t%s\", $i } else { printf \"\\t%s\\n\", $i } } }"}, {"__index__": 6, "from": "genus", "to": "BEGIN { FS = OFS = \"\\t\" } NR == 1 { printf \"superkingdom\\tkingdom\\tphylum\\tclass\\torder\\tfamily\\tgenus\"; for (i = 2; i <= NF; i++) { split($i, name_parts, \"_\"); printf \"\\t%s\", name_parts[1] } printf \"\\n\" } NR > 1 { split($1, taxa_parts, \";\"); for (i = 1; i <= 7; i++) { if (i < 7) { printf \"%s\\t\", taxa_parts[i] } else { printf \"%s\", taxa_parts[i] } } for (i = 2; i <= NF; i++) { if (i < NF) { printf \"\\t%s\", $i } else { printf \"\\t%s\\n\", $i } } }"}, {"__index__": 7, "from": "species", "to": "BEGIN { FS = OFS = \"\\t\" } NR == 1 { printf \"superkingdom\\tkingdom\\tphylum\\tclass\\torder\\tfamily\\tgenus\\tspecies\"; for (i = 2; i <= NF; i++) { split($i, name_parts, \"_\"); printf \"\\t%s\", name_parts[1] } printf \"\\n\" } NR > 1 { split($1, taxa_parts, \";\"); for (i = 1; i <= 8; i++) { if (i < 8) { printf \"%s\\t\", taxa_parts[i] } else { printf \"%s\", taxa_parts[i] } } for (i = 2; i <= NF; i++) { if (i < NF) { printf \"\\t%s\", $i } else { printf \"\\t%s\\n\", $i } } }"}], "type": "text"}
output_param_type	`"text"`
unmapped	`{"__current_case__": 1, "on_unmapped": "fail"}`

Step 5: toolshed.g2.bx.psu.edu/repos/bgruening/text_processing/tp_awk_tool/9.3+galaxy1:

step_state: scheduled

Jobs

Job 1:

Job state is ok

Command Line:

env -i $(which awk) --sandbox -v FS='	' -v OFS='	' --re-interval -f '/tmp/tmp8i8gwsl1/job_working_directory/000/7/configs/tmpcwj2o0h7' '/tmp/tmp8i8gwsl1/files/9/1/9/dataset_9195cd87-f1d5-4bd8-8093-128add0bc034.dat' > '/tmp/tmp8i8gwsl1/job_working_directory/000/7/outputs/dataset_f4ba6759-42c2-4e80-a66f-7679ba461590.dat'

Exit Code:

```
0
```

Traceback:

Job Parameters:

Job parameter	Parameter value
__input_ext	`"input"`
__workflow_invocation_uuid__	`"55bc847ee47e11efb46f000d3a62b9cd"`
chromInfo	`"/tmp/tmp8i8gwsl1/galaxy-dev/tool-data/shared/ucsc/chrom/?.len"`
code	"NR > 2 { split($3, taxa, \";\"); merged = \"\"; levels = 6; for (i = 1; i <= levels; i++) { if (i <= length(taxa) && taxa[i] ~ /__/) { split(taxa[i], parts, \"__\"); if (parts[2] != \"\") { value = parts[2]; } else { value = \"unassigned\"; } } else { value = \"unassigned\"; } merged = merged (merged ? \";\" : \"\") value; } print merged \"\\t\" $2; }"
dbkey	`"?"`

Job 2:

Job state is ok

Command Line:

env -i $(which awk) --sandbox -v FS='	' -v OFS='	' --re-interval -f '/tmp/tmp8i8gwsl1/job_working_directory/000/8/configs/tmp6z6gw837' '/tmp/tmp8i8gwsl1/files/6/f/5/dataset_6f5aae46-8129-4340-88a2-288e29d49edc.dat' > '/tmp/tmp8i8gwsl1/job_working_directory/000/8/outputs/dataset_ddde9332-84e1-4867-9258-431deb03bbfb.dat'

Exit Code:

```
0
```

Traceback:

Job Parameters:

Job parameter	Parameter value
__input_ext	`"input"`
__workflow_invocation_uuid__	`"55bc847ee47e11efb46f000d3a62b9cd"`
chromInfo	`"/tmp/tmp8i8gwsl1/galaxy-dev/tool-data/shared/ucsc/chrom/?.len"`
code	"NR > 2 { split($3, taxa, \";\"); merged = \"\"; levels = 6; for (i = 1; i <= levels; i++) { if (i <= length(taxa) && taxa[i] ~ /__/) { split(taxa[i], parts, \"__\"); if (parts[2] != \"\") { value = parts[2]; } else { value = \"unassigned\"; } } else { value = \"unassigned\"; } merged = merged (merged ? \";\" : \"\") value; } print merged \"\\t\" $2; }"
dbkey	`"?"`

Job 3:

Job state is ok

Command Line:

env -i $(which awk) --sandbox -v FS='	' -v OFS='	' --re-interval -f '/tmp/tmp8i8gwsl1/job_working_directory/000/9/configs/tmplsfkryil' '/tmp/tmp8i8gwsl1/files/0/e/6/dataset_0e61acb4-7267-41b6-95cb-7cc1801f86cf.dat' > '/tmp/tmp8i8gwsl1/job_working_directory/000/9/outputs/dataset_7061c8bd-ae78-4cc4-8962-effadb39f0bd.dat'

Exit Code:

```
0
```

Traceback:

Job Parameters:

Job parameter	Parameter value
__input_ext	`"input"`
__workflow_invocation_uuid__	`"55bc847ee47e11efb46f000d3a62b9cd"`
chromInfo	`"/tmp/tmp8i8gwsl1/galaxy-dev/tool-data/shared/ucsc/chrom/?.len"`
code	"NR > 2 { split($3, taxa, \";\"); merged = \"\"; levels = 6; for (i = 1; i <= levels; i++) { if (i <= length(taxa) && taxa[i] ~ /__/) { split(taxa[i], parts, \"__\"); if (parts[2] != \"\") { value = parts[2]; } else { value = \"unassigned\"; } } else { value = \"unassigned\"; } merged = merged (merged ? \";\" : \"\") value; } print merged \"\\t\" $2; }"
dbkey	`"?"`

Job 4:

Job state is ok

Command Line:

env -i $(which awk) --sandbox -v FS='	' -v OFS='	' --re-interval -f '/tmp/tmp8i8gwsl1/job_working_directory/000/10/configs/tmp_31rc046' '/tmp/tmp8i8gwsl1/files/d/7/d/dataset_d7d24917-12c3-49a1-b742-8ecb5e88c32f.dat' > '/tmp/tmp8i8gwsl1/job_working_directory/000/10/outputs/dataset_e11e0176-5a69-4caa-b8a2-0f4f5a69ef7b.dat'

Exit Code:

```
0
```

Traceback:

Job Parameters:

Job parameter	Parameter value
__input_ext	`"input"`
__workflow_invocation_uuid__	`"55bc847ee47e11efb46f000d3a62b9cd"`
chromInfo	`"/tmp/tmp8i8gwsl1/galaxy-dev/tool-data/shared/ucsc/chrom/?.len"`
code	"NR > 2 { split($3, taxa, \";\"); merged = \"\"; levels = 6; for (i = 1; i <= levels; i++) { if (i <= length(taxa) && taxa[i] ~ /__/) { split(taxa[i], parts, \"__\"); if (parts[2] != \"\") { value = parts[2]; } else { value = \"unassigned\"; } } else { value = \"unassigned\"; } merged = merged (merged ? \";\" : \"\") value; } print merged \"\\t\" $2; }"
dbkey	`"?"`

Step 6: Grouping1:

step_state: scheduled

Jobs

Job 1:

Job state is ok

Command Line:

python '/tmp/tmp8i8gwsl1/galaxy-dev/tools/stats/grouping.py' '/tmp/tmp8i8gwsl1/job_working_directory/000/11/outputs/dataset_9afff74d-2f26-4150-88eb-587f6ee7cc0b.dat' '/tmp/tmp8i8gwsl1/files/f/4/b/dataset_f4ba6759-42c2-4e80-a66f-7679ba461590.dat' '1' '0' 'None' 'sum,2,no,'

Exit Code:

```
0
```

Standard Output:

```
--Group by c1: sum[c2] 
```

Traceback:

Job Parameters:

Job parameter	Parameter value
__input_ext	`"tabular"`
__workflow_invocation_uuid__	`"55bc847ee47e11efb46f000d3a62b9cd"`
chromInfo	`"/tmp/tmp8i8gwsl1/galaxy-dev/tool-data/shared/ucsc/chrom/?.len"`
dbkey	`"?"`
groupcol	`"1"`
ignorecase	`false`
ignorelines	`None`
operations	`[{"__index__": 0, "opcol": "2", "opdefault": null, "opround": "no", "optype": "sum"}]`

Job 2:

Job state is ok

Command Line:

python '/tmp/tmp8i8gwsl1/galaxy-dev/tools/stats/grouping.py' '/tmp/tmp8i8gwsl1/job_working_directory/000/12/outputs/dataset_6f6d6afd-8bea-4a76-9163-f6df9146d59f.dat' '/tmp/tmp8i8gwsl1/files/d/d/d/dataset_ddde9332-84e1-4867-9258-431deb03bbfb.dat' '1' '0' 'None' 'sum,2,no,'

Exit Code:

```
0
```

Standard Output:

```
--Group by c1: sum[c2] 
```

Traceback:

Job Parameters:

Job parameter	Parameter value
__input_ext	`"tabular"`
__workflow_invocation_uuid__	`"55bc847ee47e11efb46f000d3a62b9cd"`
chromInfo	`"/tmp/tmp8i8gwsl1/galaxy-dev/tool-data/shared/ucsc/chrom/?.len"`
dbkey	`"?"`
groupcol	`"1"`
ignorecase	`false`
ignorelines	`None`
operations	`[{"__index__": 0, "opcol": "2", "opdefault": null, "opround": "no", "optype": "sum"}]`

Job 3:

Job state is ok

Command Line:

python '/tmp/tmp8i8gwsl1/galaxy-dev/tools/stats/grouping.py' '/tmp/tmp8i8gwsl1/job_working_directory/000/13/outputs/dataset_c595ebd7-00d6-46fe-967d-6adff29caabf.dat' '/tmp/tmp8i8gwsl1/files/7/0/6/dataset_7061c8bd-ae78-4cc4-8962-effadb39f0bd.dat' '1' '0' 'None' 'sum,2,no,'

Exit Code:

```
0
```

Standard Output:

```
--Group by c1: sum[c2] 
```

Traceback:

Job Parameters:

Job parameter	Parameter value
__input_ext	`"tabular"`
__workflow_invocation_uuid__	`"55bc847ee47e11efb46f000d3a62b9cd"`
chromInfo	`"/tmp/tmp8i8gwsl1/galaxy-dev/tool-data/shared/ucsc/chrom/?.len"`
dbkey	`"?"`
groupcol	`"1"`
ignorecase	`false`
ignorelines	`None`
operations	`[{"__index__": 0, "opcol": "2", "opdefault": null, "opround": "no", "optype": "sum"}]`

Job 4:

Job state is ok

Command Line:

python '/tmp/tmp8i8gwsl1/galaxy-dev/tools/stats/grouping.py' '/tmp/tmp8i8gwsl1/job_working_directory/000/14/outputs/dataset_9d68e1a3-1770-43eb-921c-00c541982217.dat' '/tmp/tmp8i8gwsl1/files/e/1/1/dataset_e11e0176-5a69-4caa-b8a2-0f4f5a69ef7b.dat' '1' '0' 'None' 'sum,2,no,'

Exit Code:

```
0
```

Standard Output:

```
--Group by c1: sum[c2] 
```

Traceback:

Job Parameters:

Job parameter	Parameter value
__input_ext	`"tabular"`
__workflow_invocation_uuid__	`"55bc847ee47e11efb46f000d3a62b9cd"`
chromInfo	`"/tmp/tmp8i8gwsl1/galaxy-dev/tool-data/shared/ucsc/chrom/?.len"`
dbkey	`"?"`
groupcol	`"1"`
ignorecase	`false`
ignorelines	`None`
operations	`[{"__index__": 0, "opcol": "2", "opdefault": null, "opround": "no", "optype": "sum"}]`

Step 7: toolshed.g2.bx.psu.edu/repos/iuc/filter_tabular/filter_tabular/3.3.1:

step_state: scheduled

Jobs

Job 1:

Job state is ok

Command Line:

python '/tmp/shed_dir/toolshed.g2.bx.psu.edu/repos/iuc/filter_tabular/90f657745fea/filter_tabular/filter_tabular.py' -i '/tmp/tmp8i8gwsl1/files/9/a/f/dataset_9afff74d-2f26-4150-88eb-587f6ee7cc0b.dat' --comment_char '#' -j '/tmp/tmp8i8gwsl1/job_working_directory/000/15/configs/tmpniwhya6e' -o '/tmp/tmp8i8gwsl1/job_working_directory/000/15/outputs/dataset_7b07f0e8-bc24-418d-afcc-14674d368db1.dat'

Exit Code:

```
0
```

Traceback:

Job Parameters:

Job parameter	Parameter value
__input_ext	`"tabular"`
__workflow_invocation_uuid__	`"55bc847ee47e11efb46f000d3a62b9cd"`
chromInfo	`"/tmp/tmp8i8gwsl1/galaxy-dev/tool-data/shared/ucsc/chrom/?.len"`
comment_char	`true`
dbkey	`"?"`
linefilters	`[{"__index__": 0, "filter": {"__current_case__": 4, "filter_type": "prepend_dataset_name"}}]`

Job 2:

Job state is ok

Command Line:

python '/tmp/shed_dir/toolshed.g2.bx.psu.edu/repos/iuc/filter_tabular/90f657745fea/filter_tabular/filter_tabular.py' -i '/tmp/tmp8i8gwsl1/files/6/f/6/dataset_6f6d6afd-8bea-4a76-9163-f6df9146d59f.dat' --comment_char '#' -j '/tmp/tmp8i8gwsl1/job_working_directory/000/16/configs/tmpw89_f6l0' -o '/tmp/tmp8i8gwsl1/job_working_directory/000/16/outputs/dataset_0bd01c78-b941-47a4-b62c-25143fc7dcab.dat'

Exit Code:

```
0
```

Traceback:

Job Parameters:

Job parameter	Parameter value
__input_ext	`"tabular"`
__workflow_invocation_uuid__	`"55bc847ee47e11efb46f000d3a62b9cd"`
chromInfo	`"/tmp/tmp8i8gwsl1/galaxy-dev/tool-data/shared/ucsc/chrom/?.len"`
comment_char	`true`
dbkey	`"?"`
linefilters	`[{"__index__": 0, "filter": {"__current_case__": 4, "filter_type": "prepend_dataset_name"}}]`

Job 3:

Job state is ok

Command Line:

python '/tmp/shed_dir/toolshed.g2.bx.psu.edu/repos/iuc/filter_tabular/90f657745fea/filter_tabular/filter_tabular.py' -i '/tmp/tmp8i8gwsl1/files/c/5/9/dataset_c595ebd7-00d6-46fe-967d-6adff29caabf.dat' --comment_char '#' -j '/tmp/tmp8i8gwsl1/job_working_directory/000/17/configs/tmprammxtls' -o '/tmp/tmp8i8gwsl1/job_working_directory/000/17/outputs/dataset_bae8496d-8ad3-4380-aadb-e6756e3bf62e.dat'

Exit Code:

```
0
```

Traceback:

Job Parameters:

Job parameter	Parameter value
__input_ext	`"tabular"`
__workflow_invocation_uuid__	`"55bc847ee47e11efb46f000d3a62b9cd"`
chromInfo	`"/tmp/tmp8i8gwsl1/galaxy-dev/tool-data/shared/ucsc/chrom/?.len"`
comment_char	`true`
dbkey	`"?"`
linefilters	`[{"__index__": 0, "filter": {"__current_case__": 4, "filter_type": "prepend_dataset_name"}}]`

Job 4:

Job state is ok

Command Line:

python '/tmp/shed_dir/toolshed.g2.bx.psu.edu/repos/iuc/filter_tabular/90f657745fea/filter_tabular/filter_tabular.py' -i '/tmp/tmp8i8gwsl1/files/9/d/6/dataset_9d68e1a3-1770-43eb-921c-00c541982217.dat' --comment_char '#' -j '/tmp/tmp8i8gwsl1/job_working_directory/000/18/configs/tmp_1_2rt14' -o '/tmp/tmp8i8gwsl1/job_working_directory/000/18/outputs/dataset_4d608593-93ae-43bb-aa0c-94159f9a2878.dat'

Exit Code:

```
0
```

Traceback:

Job Parameters:

Job parameter	Parameter value
__input_ext	`"tabular"`
__workflow_invocation_uuid__	`"55bc847ee47e11efb46f000d3a62b9cd"`
chromInfo	`"/tmp/tmp8i8gwsl1/galaxy-dev/tool-data/shared/ucsc/chrom/?.len"`
comment_char	`true`
dbkey	`"?"`
linefilters	`[{"__index__": 0, "filter": {"__current_case__": 4, "filter_type": "prepend_dataset_name"}}]`

Step 8: toolshed.g2.bx.psu.edu/repos/bgruening/text_processing/tp_awk_tool/9.3+galaxy1:

step_state: scheduled

Jobs

Job 1:

Job state is ok

Command Line:

env -i $(which awk) --sandbox -v FS='	' -v OFS='	' --re-interval -f '/tmp/tmp8i8gwsl1/job_working_directory/000/19/configs/tmp8up2aqis' '/tmp/tmp8i8gwsl1/files/7/b/0/dataset_7b07f0e8-bc24-418d-afcc-14674d368db1.dat' > '/tmp/tmp8i8gwsl1/job_working_directory/000/19/outputs/dataset_f72e2ef5-6646-4178-a47c-f7b50f2a4979.dat'

Exit Code:

```
0
```

Traceback:

Job Parameters:

Job parameter	Parameter value
__input_ext	`"input"`
__workflow_invocation_uuid__	`"55bc847ee47e11efb46f000d3a62b9cd"`
chromInfo	`"/tmp/tmp8i8gwsl1/galaxy-dev/tool-data/shared/ucsc/chrom/?.len"`
code	`"BEGIN {\n FS = OFS = \"\\t\"\n}\nNR == 1 {\n print \"taxa\", $1\n}\nNR > 0 {\n print $2, $3\n}\n"`
dbkey	`"?"`

Job 2:

Job state is ok

Command Line:

env -i $(which awk) --sandbox -v FS='	' -v OFS='	' --re-interval -f '/tmp/tmp8i8gwsl1/job_working_directory/000/20/configs/tmplw8oe47l' '/tmp/tmp8i8gwsl1/files/0/b/d/dataset_0bd01c78-b941-47a4-b62c-25143fc7dcab.dat' > '/tmp/tmp8i8gwsl1/job_working_directory/000/20/outputs/dataset_e9786b01-7d2e-44a6-a68d-14fea7fb6cc0.dat'

Exit Code:

```
0
```

Traceback:

Job Parameters:

Job parameter	Parameter value
__input_ext	`"input"`
__workflow_invocation_uuid__	`"55bc847ee47e11efb46f000d3a62b9cd"`
chromInfo	`"/tmp/tmp8i8gwsl1/galaxy-dev/tool-data/shared/ucsc/chrom/?.len"`
code	`"BEGIN {\n FS = OFS = \"\\t\"\n}\nNR == 1 {\n print \"taxa\", $1\n}\nNR > 0 {\n print $2, $3\n}\n"`
dbkey	`"?"`

Job 3:

Job state is ok

Command Line:

env -i $(which awk) --sandbox -v FS='	' -v OFS='	' --re-interval -f '/tmp/tmp8i8gwsl1/job_working_directory/000/21/configs/tmpwnhsc2c5' '/tmp/tmp8i8gwsl1/files/b/a/e/dataset_bae8496d-8ad3-4380-aadb-e6756e3bf62e.dat' > '/tmp/tmp8i8gwsl1/job_working_directory/000/21/outputs/dataset_bfd41cb7-253d-49d6-b7e5-c967e0b02483.dat'

Exit Code:

```
0
```

Traceback:

Job Parameters:

Job parameter	Parameter value
__input_ext	`"input"`
__workflow_invocation_uuid__	`"55bc847ee47e11efb46f000d3a62b9cd"`
chromInfo	`"/tmp/tmp8i8gwsl1/galaxy-dev/tool-data/shared/ucsc/chrom/?.len"`
code	`"BEGIN {\n FS = OFS = \"\\t\"\n}\nNR == 1 {\n print \"taxa\", $1\n}\nNR > 0 {\n print $2, $3\n}\n"`
dbkey	`"?"`

Job 4:

Job state is ok

Command Line:

env -i $(which awk) --sandbox -v FS='	' -v OFS='	' --re-interval -f '/tmp/tmp8i8gwsl1/job_working_directory/000/22/configs/tmpnr9rxak5' '/tmp/tmp8i8gwsl1/files/4/d/6/dataset_4d608593-93ae-43bb-aa0c-94159f9a2878.dat' > '/tmp/tmp8i8gwsl1/job_working_directory/000/22/outputs/dataset_034c29b5-b990-414a-a632-c67bc034a653.dat'

Exit Code:

```
0
```

Traceback:

Job Parameters:

Job parameter	Parameter value
__input_ext	`"input"`
__workflow_invocation_uuid__	`"55bc847ee47e11efb46f000d3a62b9cd"`
chromInfo	`"/tmp/tmp8i8gwsl1/galaxy-dev/tool-data/shared/ucsc/chrom/?.len"`
code	`"BEGIN {\n FS = OFS = \"\\t\"\n}\nNR == 1 {\n print \"taxa\", $1\n}\nNR > 0 {\n print $2, $3\n}\n"`
dbkey	`"?"`

Step 9: toolshed.g2.bx.psu.edu/repos/iuc/collection_column_join/collection_column_join/0.0.3:

step_state: scheduled

Jobs

Job 1:

Job state is ok

Command Line:

sh '/tmp/tmp8i8gwsl1/job_working_directory/000/23/configs/tmp3xpp2hti'

Exit Code:

```
0
```

Traceback:

Job Parameters:

Job parameter	Parameter value
__input_ext	`"tabular"`
__workflow_invocation_uuid__	`"55bc847ee47e11efb46f000d3a62b9cd"`
chromInfo	`"/tmp/tmp8i8gwsl1/galaxy-dev/tool-data/shared/ucsc/chrom/?.len"`
dbkey	`"?"`
fill_char	`"0"`
has_header	`"1"`
identifier_column	`"1"`
include_outputs	`None`
old_col_in_header	`false`

Step 10: toolshed.g2.bx.psu.edu/repos/bgruening/text_processing/tp_awk_tool/9.3+galaxy1:

step_state: scheduled

Jobs

Job 1:

Job state is ok

Command Line:

env -i $(which awk) --sandbox -v FS='	' -v OFS='	' --re-interval -f '/tmp/tmp8i8gwsl1/job_working_directory/000/24/configs/tmpgw43j8_l' '/tmp/tmp8i8gwsl1/files/5/c/c/dataset_5cc6c5d6-e3d8-4ce2-8a2a-8c5e78d9e2fd.dat' > '/tmp/tmp8i8gwsl1/job_working_directory/000/24/outputs/dataset_1db85932-413e-43df-80fe-ca235f94efda.dat'

Exit Code:

```
0
```

Traceback:

Job Parameters:

Job parameter	Parameter value
__input_ext	`"input"`
__workflow_invocation_uuid__	`"55bc847ee47e11efb46f000d3a62b9cd"`
chromInfo	`"/tmp/tmp8i8gwsl1/galaxy-dev/tool-data/shared/ucsc/chrom/?.len"`
code	`"BEGIN { FS = OFS = \"\\t\" } NR == 1 { printf \"superkingdom\\tkingdom\\tphylum\\tclass\\torder\\tfamily\"; for (i = 2; i <= NF; i++) { split($i, name_parts, \"_\"); printf \"\\t%s\", name_parts[1] } printf \"\\n\" } NR > 1 { split($1, taxa_parts, \";\"); for (i = 1; i <= 6; i++) { if (i < 6) { printf \"%s\\t\", taxa_parts[i] } else { printf \"%s\", taxa_parts[i] } } for (i = 2; i <= NF; i++) { if (i < NF) { printf \"\\t%s\", $i } else { printf \"\\t%s\\n\", $i } } }"`
dbkey	`"?"`

Other invocation details
- history_id
  - 2e9bfb49212fdbcb
- history_state
  - ok
- invocation_id
  - 2e9bfb49212fdbcb
- invocation_state
  - scheduled
- workflow_id
  - 2e9bfb49212fdbcb

RZ9082 · 2025-02-06T12:58:31Z

Oh! Forgot to add this one! Thank you :)

Lucille Delisle added 5 commits February 6, 2025 12:04

renerate a dockstore for a directory with ga and tests

8ee7639

remove a tests.yml that is not used and referencing files that do not…

3b79905

… exists

rename test file so it is recognized by the dockstore_init

dc36ba5

fix release in ga file

da49a6c

fix Changelog to match the version that have been released

19d39ba

Provide feedback

Saved searches

Use saved searches to filter your results more quickly

Use all tests#664

Use all tests#664
lldelisle wants to merge 5 commits intogalaxyproject:mainfrom
lldelisle:use_all_tests

lldelisle commented Feb 6, 2025

Uh oh!

github-actions bot commented Feb 6, 2025

Workflow invocation details

Uh oh!

github-actions bot commented Feb 6, 2025

Workflow invocation details

Workflow invocation details

Workflow invocation details

Uh oh!

RZ9082 commented Feb 6, 2025

Uh oh!

Reviewers

Assignees

Labels

Projects

Milestone

Development

Uh oh!

2 participants

Conversation

lldelisle commented Feb 6, 2025

Uh oh!

github-actions bot commented Feb 6, 2025

Test Results (powered by Planemo)

Test Summary

Workflow invocation details

Uh oh!

github-actions bot commented Feb 6, 2025

Test Results (powered by Planemo)

Test Summary

Workflow invocation details

Workflow invocation details

Workflow invocation details

Uh oh!

RZ9082 commented Feb 6, 2025

Uh oh!

Reviewers

Assignees

Labels

Projects

Milestone

Development

Uh oh!

2 participants