Authors:
- C implementation: Mengyao Zhao
- C++ wrapper: Wan-Ping Lee
- Python wrapper: Yongan Zhao
- Java wrapper: Daniel Cameron
- R package: Nan Xiao
Contact:
- Mengyao Zhao zhaomengyao@gmail.com
- Wan-Ping Lee wanping.lee@gmail.com
- Yongan Zhao zhaoyanswill@gmail.com
- Daniel Cameron cameron.d@wehi.edu.au
- Nan Xiao me@nanx.me
Last revision: 2025-Jan-14
SSW is a fast implementation of the Smith-Waterman algorithm, which uses the Single-Instruction Multiple-Data (SIMD) instructions to parallelize the algorithm at the instruction level. SSW library provides an API that can be flexibly used by programs written in C, C++ and other languages. We also provide a software that can do protein and genome alignment directly. Current version of our implementation is ~50 times faster than an ordinary Smith-Waterman. It can return the Smith-Waterman score, alignment location and traceback path (cigar) of the optimal alignment accurately; and return the sub-optimal alignment score and location heuristically.
The Debian package of this library can be achieved here: https://tracker.debian.org/pkg/libssw
Note: When SSW open a gap, the gap open penalty alone is applied.
The API files include ssw.h and ssw.c, which can be directly used by any C or C++ program. For the C++ users who are more comfortable to use a C++ style interface, an additional C++ wrapper is provided with the file ssw_cpp.cpp and ssw_cpp.h.
To use the C style API, please:
- Download
ssw.handssw.c, and put them in the same folder of your own program files. - Write
#include "ssw.h"into your file that will call the API functions. - The API files are ready to be compiled together with your own C/C++ files.
The API function descriptions are in the file ssw.h. One simple example of the API usage is example.c. The Smith-Waterman penalties need to be integers. Small penalty numbers such as: match: 2, mismatch: -1, gap open (the total penalty when one gap is opened): -3, gap extension: -1 are recommended, which will lead to shorter running time.
To use the C++ style API, please:
- Download
ssw.h,ssw.c,ssw_cpp.cppandssw_cpp.h, put them in the same folder of your own program files. - Write
#include "ssw_cpp.h"into your file that will call the API functions. - The API files are ready to be compiled together with your own C/C++ files.
The API function descriptions are in the file ssw_cpp.h. A simple example of using the C++ API is example.cpp.
Test data set:
- Target sequence: reference genome of E. coli strain 536 (4,938,920 nucleotides) from NCBI
- Query sequences: 1000 reads of Ion Torrent sequenced E. coli strain DH10B (C23-140, 318 PGM Run, 11/2011), read length: ~25-540 bp, most reads are ~200 bp
CPU time:
- AMD CPU: default penalties: ~880 seconds; -m1 -x3 -o5 -e2: ~460 seconds
- Intel CPU: default penalties: ~960 seconds; -m1 -x3 -o5 -e2: ~500 seconds
Memory usage: ~40MB
- Download the software from https://github.com/mengyao/Complete-Striped-Smith-Waterman-Library.
cd srcmake- The executable file will be
ssw_test.
Usage: ssw_test [options] ... <target.fasta> <query.fasta>(or <query.fastq>)
Options:
-m N N is a positive integer for weight match in genome sequence alignment. [default: 2]
-x N N is a positive integer. -N will be used as weight mismatch in genome sequence alignment. [default: 2]
-o N N is a positive integer. -N will be used as the weight for the gap opening. [default: 3]
-e N N is a positive integer. -N will be used as the weight for the gap extension. [default: 1]
-p Do protein sequence alignment. Without this option, the ssw_test will do genome sequence alignment.
-a FILE FILE is either the Blosum or Pam weight matrix. [default: Blosum50]
-c Return the alignment path.
-f N N is a positive integer. Only output the alignments with the Smith-Waterman score >= N.
-r The best alignment will be picked between the original read alignment and the reverse complement read alignment.
-s Output in SAM format. [default: no header]
-h If -s is used, include header in SAM output.
The input files can be in FASTA or FASTQ format. Both target and query files can contain multiple sequences. Each sequence in the query file will be aligned with all sequences in the target file. If your target file has N sequences and your query file has M sequences, the results will have M*N alignments.
The software can output SAM format or BLAST like format results.
- SAM format output:
Example:
@HD VN:1.4 SO:queryname
@SQ SN:chr1 LN:1001
6:163296599:F:198;None;None/1 0 chr1 453 5 3M2D3M1D4M2D6M1D5M1D5M2I7M * 0 0 CCAGCCCAAAATCTGTTTTAATGGTGGATTTGTGT * AS:i:37 NM:i:11 ZS:i:28
3:153409880:F:224;None;3,153410143,G,A/1 0 chr1 523 4 2M1D32M1D3M1D6M1D8M * 0 0 GAAGAGTTAATTTAAGTCACTTCAAACAGATTACGTATCTTTTTTTTCCCT * AS:i:42 NM:i:16 ZS:i:41
Y:26750420:R:-132;None;None/1 0 chr1 120 4 2M1I4M3D3M1I7M2I9M2D6M1I8M * 0 0 AACAACAGAAGTTAATTAGCTTCAAAAATACTTTATATTTGCAA * AS:i:32 NM:i:16 ZS:i:29
13:91170622:R:-276;None;None/1 0 chr1 302 4 8M1D8M1D3M2D6M1D4M2I2M1D2M3D5M1I4M * 0 0 CATTTATTGTTGTTTTTAAAGATTAAATGATTAAATGTTTCAAAA * AS:i:32 NM:i:18 ZS:i:30
15:37079528:R:-240;None;None/1 0 chr1 4 5 4M2D4M1D9M1I3M4I16M1I3M1D4M2D5M * 0 0 ACAGTGATGCCAAGCCAGTGGGTTTTAGCTTGTGGAGTTCCATAGGAGCGATGC * AS:i:30 NM:i:22 ZS:i:23
9:92308501:R:-176;None;None/1 0 chr1 142 4 4M3I5M4D10M2D4M1I2M2I6M5D1M1D6M2D3M * 0 0 AATAACCATAAAAATGGGCAAAGCAGCCTTCAGGGCTGCTGTTTCTA * AS:i:26 NM:i:25 ZS:i:26
...
What is the output?
Please check the document "The SAM Format Specification" at: http://samtools.github.io/hts-specs/SAMv1.pdf for the full description.
The additional optional field "ZS" indicates the suboptimal alignment score. For example, the 1st record in the upper example means the optimal alignment score of the given sequence is 37; the suboptimal alignment score is 28; the mismatch and INDEL base count within the aligned fragment of the read is 11.
- An example of the BLAST like output:
target_name: chr1
query_name: 6:163296599:F:198;None;None/1
optimal_alignment_score: 37 sub-optimal_alignment_score: 28 strand: + target_begin: 453 target_end: 492 query_begin: 17 query_end: 51
Target: 453 CCAATGCCACAAAACATCTGTCTCTAACTGGTG--TGTGTGT 492
||| ||| |||| |||||| | ||| ||||| |*|||||
Query: 17 CCA--GCC-CAAA--ATCTGT-TTTAA-TGGTGGATTTGTGT 51
target_name: chr1
query_name: 3:153409880:F:224;None;3,153410143,G,A/1
optimal_alignment_score: 42 sub-optimal_alignment_score: 41 strand: + target_begin: 523 target_end: 577 query_begin: 3 query_end: 53
Target: 523 GAGAGAGAAAATTTCACTCCCTCCATAAATCTCACAGTATTCTTTTCTTTTTCCT 577
|| ||||**|||||*|*||*||*||*|*|**|*|| ||| |||||| ||||*|||
Query: 3 GA-AGAGTTAATTTAAGTCACTTCAAACAGATTAC-GTA-TCTTTT-TTTTCCCT 53
...
ssw_lib.py is a Python wrapper that fully supports APIs of the C library. To use this Python library, C programming knowledge is not required.
To use the Python wrapper, please:
- Compile the
srcfolder by either using themakefileor by compiling a dynamic shared library withgcc:
gcc -Wall -O3 -pipe -fPIC -shared -rdynamic -o libssw.so ssw.c ssw.h
-
Put
libssw.soandssw_lib.pyin the same directory of your own program files or directories in sys.paths. -
The
LD_LIBRARY_PATHenvironment variable may need to be modified to include the directory of the dynamic librarylibssw.soby one of the two following mathods:export LD_LIBRARY_PATH=$LD_LIBRARY_PATH:path_of_libssw.so- For a definitive inclusion edit
/etc/ld.so.confand add the path of thelibssw.so. Then, update the cache by/sbin/ldconfig.
-
In a Python script or in a interactive interpreter, import the CSsw class by:
from ssw_lib import CSsworimport ssw_liband then callssw_lib.CSsw. -
Call APIs with input parameters and parse the results (Please see
pyssw.pyas an example).
usage: pyssw.py [-h] [-l SLIBPATH] [-m NMATCH] [-x NMISMATCH] [-o NOPEN]
[-e NEXT] [-p] [-a SMATRIX] [-c] [-f NTHR] [-r] [-s] [-header]
[target] [query]
positional arguments:
target targe file
query query file
optional arguments:
-h, --help show this help message and exit
-l SLIBPATH, --sLibPath SLIBPATH
path of libssw.so
-m NMATCH, --nMatch NMATCH
a positive integer as the score for a match in genome
sequence alignment. [default: 2]
-x NMISMATCH, --nMismatch NMISMATCH
a positive integer as the score for a mismatch in
genome sequence alignment. [default: 2]
-o NOPEN, --nOpen NOPEN
a positive integer as the penalty for the gap opening
in genome sequence alignment. [default: 3]
-e NEXT, --nExt NEXT a positive integer as the penalty for the gap
extension in genome sequence alignment. [default: 1]
-p, --bProtien Do protein sequence alignment. Without this option,
the ssw_test will do genome sequence alignment.
[default: False]
-a SMATRIX, --sMatrix SMATRIX
a file for either Blosum or Pam weight matrix.
[default: Blosum50]
-c, --bPath Return the alignment path. [default: False]
-f NTHR, --nThr NTHR a positive integer. Only output the alignments with
the Smith-Waterman score >= N.
-r, --bBest The best alignment will be picked between the original
read alignment and the reverse complement read
alignment. [default: False]
-s, --bSam Output in SAM format. [default: no header]
-header, --bHeader If -s is used, include header in SAM output.
The software can output SAM format or BLAST like format results.
The speed and memory are about the same as the C library.
The Java wrapper is a thin JNI (Java Native Interface) wrapper around the native C implementation.
Only the C, C++, and C shared libraries are generated from the default make goal, and as such, the Java interface must be built explicitly.
- Ensure
javacandjarare inPATH. - Ensure
JAVA_HOMEis set to an installed JRE or JDK, or the JNI include directory is included in the C system library search path. make javafrom the src directory.libsswjni.soandssw.jarshould be built.
The Java wrapper consist of the following components:
-
libsswjni.so: native C library exposing the JNI entry points -
ssw.jaris a Java library containing the Java interface to the native C library. This small wrapper library is composed of:ssw.AlignerJava class: a thread-safe static class that exposes twoalign()methods. The first exposes the SSW C library directly. No error checking is performed on arguments passed to this method and misuse is highly likely to crash the JVM. The secondalign()method is a more user-friendly entry point that exposes a simpler API and performs some basic error checking.ssw.AlignmentJava class: this class stores alignment results. Each each field has a direct correspondence and identical meaning to the C s_align struct.ssw.ExampleJava class: Java version of the example_c sample code. Runjava -jar ssw.jarto execute the sample.
To use the library, either reference the ssw.jar or including the Aligner and Alignment classes directly. As for any JNI library, the native library must be loaded (using System.loadLibrary("sswjni") or similar) before invokation of native methods. For the JVM to find the library, ensure that either the library is included in the LD_LIBRARY_PATH environment variable, or -Djava.library.path=<directory containing libsswjni.so> is set on the Java command line.
Please check all the R package information here: https://github.com/nanxstats/ssw-r
Please cite this paper, if you need: https://doi.org/10.1371/journal.pone.0082138