WIP flu: add trees to internal segments, add old sequences to ha/na builds

data/nextstrain/collection.json

@@ -24,16 +24,12 @@
   },
   "dataset_order": [
     "nextstrain/sars-cov-2/wuhan-hu-1/orfs",
-    "nextstrain/sars-cov-2/wuhan-hu-1/proteins",
-    "nextstrain/sars-cov-2/BA.2",
-    "nextstrain/sars-cov-2/XBB",
-    "nextstrain/sars-cov-2/BA.2.86",
-    "nextstrain/flu/h1n1pdm/ha/CY121680",
     "nextstrain/flu/h1n1pdm/ha/MW626062",
     "nextstrain/flu/h1n1pdm/na/MW626056",
-    "nextstrain/flu/h3n2/ha/CY163680",
     "nextstrain/flu/h3n2/ha/EPI1857216",
     "nextstrain/flu/h3n2/na/EPI1857215",
+    "nextstrain/flu/b/ha/KX058884",
+    "nextstrain/flu/b/na/CY073894",
     "nextstrain/flu/vic/ha/KX058884",
     "nextstrain/flu/vic/na/CY073894",
     "nextstrain/flu/yam/ha/JN993010",
@@ -45,33 +41,61 @@
     "nextstrain/mpox/lineage-b.1",
     "nextstrain/orthoebolavirus/ebov",
     "nextstrain/orthoebolavirus/sudv",
+    "nextstrain/measles/genome/WHO-2012",
+    "nextstrain/measles/N450/WHO-2012",
+    "nextstrain/dengue/all",
+    "nextstrain/yellow-fever/prM-E",
+    "nextstrain/hmpv/all-clades/NC_039199",
+    "nextstrain/herpes/vzv/NC_001348",
+    "nextstrain/rubella/E1",
+    "nextstrain/mumps/sh",
+    "nextstrain/mumps/genome",
+    "nextstrain/sars-cov-2/wuhan-hu-1/proteins",
+    "nextstrain/sars-cov-2/BA.2",
+    "nextstrain/sars-cov-2/XBB",
+    "nextstrain/sars-cov-2/BA.2.86",
+    "nextstrain/rubella/genome",
+    "nextstrain/flu/h3n2/pb2",
     "nextstrain/flu/h3n2/pb1",
+    "nextstrain/flu/h3n2/pa",
+    "nextstrain/flu/h3n2/ha/CY163680",
     "nextstrain/flu/h3n2/np",
-    "nextstrain/flu/h1n1pdm/pa",
+    "nextstrain/flu/h3n2/mp",
     "nextstrain/flu/h3n2/ns",
+    "nextstrain/flu/h1n1pdm/pb2",
+    "nextstrain/flu/h1n1pdm/pb1",
+    "nextstrain/flu/h1n1pdm/pa",
+    "nextstrain/flu/h1n1pdm/ha/CY121680",
     "nextstrain/flu/h1n1pdm/mp",
     "nextstrain/flu/h1n1pdm/np",
     "nextstrain/flu/h1n1pdm/ns",
-    "nextstrain/flu/h3n2/mp",
-    "nextstrain/flu/h3n2/pa",
-    "nextstrain/flu/h1n1pdm/pb2",
-    "nextstrain/flu/h1n1pdm/pb1",
-    "nextstrain/flu/h3n2/pb2",
-    "nextstrain/measles/genome/WHO-2012",
-    "nextstrain/measles/N450/WHO-2012",
-    "nextstrain/dengue/all",
-    "nextstrain/yellow-fever/prM-E",
-    "nextstrain/hmpv/all-clades/NC_039199",
-    "nextstrain/flu/vic/pa",
     "nextstrain/flu/vic/pb1",
+    "nextstrain/flu/vic/pb2",
+    "nextstrain/flu/vic/pa",
     "nextstrain/flu/vic/np",
     "nextstrain/flu/vic/mp",
-    "nextstrain/flu/vic/pb2",
     "nextstrain/flu/vic/ns",
-    "nextstrain/rubella/E1",
-    "nextstrain/herpes/vzv/NC_001348",
-    "nextstrain/mumps/sh",
-    "nextstrain/mumps/genome",
-    "nextstrain/rubella/genome"
+    "nextstrain/flu/b/pb1",
+    "nextstrain/flu/b/pb2",
+    "nextstrain/flu/b/pa",
+    "nextstrain/flu/b/np",
+    "nextstrain/flu/b/mp",
+    "nextstrain/flu/b/ns",
+    "nextstrain/flu/h1n1/pb2",
+    "nextstrain/flu/h1n1/pb1",
+    "nextstrain/flu/h1n1/pa",
+    "nextstrain/flu/h1n1/ha",
+    "nextstrain/flu/h1n1/np",
+    "nextstrain/flu/h1n1/na",
+    "nextstrain/flu/h1n1/mp",
+    "nextstrain/flu/h1n1/ns",
+    "nextstrain/flu/h2n2/pb2",
+    "nextstrain/flu/h2n2/pb1",
+    "nextstrain/flu/h2n2/pa",
+    "nextstrain/flu/h2n2/np",
+    "nextstrain/flu/h2n2/ha",
+    "nextstrain/flu/h2n2/na",
+    "nextstrain/flu/h2n2/mp",
+    "nextstrain/flu/h2n2/ns"
   ]
 }

data/nextstrain/flu/b/ha/KX058884/CHANGELOG.md

@@ -0,0 +1,3 @@
+## Unreleased
+
+Initial release

data/nextstrain/flu/b/ha/KX058884/README.md

@@ -0,0 +1,36 @@
+# Influenza B HA based on reference "B/Brisbane/60/2008"
+
+| Key                  | Value                |
+| -------------------- | -------------------- |
+| authors                | [Richard Neher](https://neherlab.org), [Nextstrain](https://nextstrain.org)                         |
+| name                 | Influenza B HA                      |
+| reference            | B/Brisbane/60/2008                      |
+| dataset path         | flu/b/ha/KX058884                     |
+| reference accession  | KX058884   |
+| clade definitions  |  [github.com/influenza-clade-nomenclature/seasonal_B-Vic_HA/](https://github.com/influenza-clade-nomenclature/seasonal_B-Vic_HA/)  |
+
+This dataset encompasses all Influenza B viruses in humans and is based on the B/Brisbane/60/2008 reference sequence.
+
+## Scope of this dataset
+The reference sequence for this dataset precedes the deletions at positions 162ff in the HA1 protein of the virus and thus follows the canonical numbering of amino acids in the protein.
+
+## Features
+This dataset supports
+
+ * Assignment of sequences to Victoria and Yamagata lineages
+ * Assignment of legacy clade definitions for both lineages
+ * Assignment to clades and subclades based on the nomenclature defined in [github.com/influenza-clade-nomenclature/seasonal_B-Vic_HA/](https://github.com/influenza-clade-nomenclature/seasonal_B-Vic_HA/)
+ * Identification of glycosilation motifs
+ * Sequence QC
+ * Phylogenetic placement
+
+## Clades of seasonal influenza viruses
+
+In addition to these clades, "subclades" are defined to break down diversity at higher resolution and allow following the spread of different viral groups.
+These follow a Pango-like nomenclature consisting of a letter followed by numbers separated by periods as in `A.3.2`.
+The leading letter is an alias of a previous name.
+Details of the nomenclature system can be found at [github.com/influenza-clade-nomenclature/seasonal_B-Vic_HA/](https://github.com/influenza-clade-nomenclature/seasonal_B-Vic_HA/).
+
+## What is Nextclade dataset
+
+Read more about Nextclade datasets in Nextclade documentation: https://docs.nextstrain.org/projects/nextclade/en/stable/user/datasets.html

data/nextstrain/flu/b/ha/KX058884/genome_annotation.gff3

@@ -0,0 +1,5 @@
+##gff-version 3
+##sequence-region KX058884.1 1 1885
+KX058884.1	feature	gene	34	78	.	+	.	gene_name="SigPep"
+KX058884.1	feature	gene	79	1119	.	+	.	gene_name="HA1"
+KX058884.1	feature	gene	1120	1791	.	+	.	gene_name="HA2"

data/nextstrain/flu/b/ha/KX058884/pathogen.json

@@ -0,0 +1,122 @@
+{
+  "$schema": "https://raw.githubusercontent.com/nextstrain/nextclade/refs/heads/release/packages/nextclade-schemas/input-pathogen-json.schema.json",
+  "schemaVersion": "3.0.0",
+  "alignmentParams": {
+    "excessBandwidth": 9,
+    "terminalBandwidth": 100,
+    "allowedMismatches": 4,
+    "gapAlignmentSide": "right",
+    "minSeedCover": 0.1
+  },
+  "compatibility": {
+    "cli": "3.0.0-alpha.0",
+    "web": "3.0.0-alpha.0"
+  },
+  "defaultCds": "HA1",
+  "files": {
+    "changelog": "CHANGELOG.md",
+    "examples": "sequences.fasta",
+    "genomeAnnotation": "genome_annotation.gff3",
+    "pathogenJson": "pathogen.json",
+    "readme": "README.md",
+    "reference": "reference.fasta",
+    "treeJson": "tree.json"
+  },
+  "qc": {
+    "privateMutations": {
+      "enabled": true,
+      "typical": 5,
+      "cutoff": 15,
+      "weightLabeledSubstitutions": 2,
+      "weightReversionSubstitutions": 1,
+      "weightUnlabeledSubstitutions": 1
+    },
+    "missingData": {
+      "enabled": false,
+      "missingDataThreshold": 100,
+      "scoreBias": 10
+    },
+    "snpClusters": {
+      "enabled": false,
+      "windowSize": 100,
+      "clusterCutOff": 5,
+      "scoreWeight": 50
+    },
+    "mixedSites": {
+      "enabled": true,
+      "mixedSitesThreshold": 4
+    },
+    "frameShifts": {
+      "enabled": true
+    },
+    "stopCodons": {
+      "enabled": true,
+      "ignoredStopCodons": []
+    }
+  },
+  "cdsOrderPreference": [
+    "HA1",
+    "HA2"
+  ],
+  "maintenance": {
+    "website": [
+      "https://nextstrain.org",
+      "https://clades.nextstrain.org"
+    ],
+    "documentation": [
+      "https://github.com/nextstrain/seasonal-flu"
+    ],
+    "source code": [
+      "https://github.com/nextstrain/seasonal_flu"
+    ],
+    "issues": [
+      "https://github.com/nextstrain/seasonal_flu/issues"
+    ],
+    "organizations": [
+      "Nextstrain"
+    ],
+    "authors": [
+      "Nextstrain team <https://nextstrain.org>"
+    ]
+  },
+  "nucMutLabelMap": {},
+  "nucMutLabelMapReverse": {},
+  "shortcuts": [
+    "flu_b_ha",
+    "nextstrain/flu/b",
+    "nextstrain/flu/b/ha",
+    "nextstrain/flu/b/ha/brisbane-60-2008"
+  ],
+  "aaMotifs": [
+    {
+      "name": "glycosylation",
+      "nameShort": "Glyc.",
+      "nameFriendly": "Glycosylation",
+      "description": "N-linked glycosylation motifs (N-X-S/T with X any amino acid other than P)",
+      "includeCdses": [
+        {
+          "cds": "HA1",
+          "ranges": []
+        },
+        {
+          "cds": "HA2",
+          "ranges": [
+            {
+              "begin": 0,
+              "end": 186
+            }
+          ]
+        }
+      ],
+      "motifs": [
+        "N[^P][ST]"
+      ]
+    }
+  ],
+  "attributes": {
+    "name": "Influenza B (all) HA",
+    "segment": "ha",
+    "reference accession": "KX058884",
+    "reference name": "B/Brisbane/60/2008-egg"
+  }
+}

data/nextstrain/flu/b/ha/KX058884/reference.fasta

@@ -0,0 +1,28 @@
+>KX058884.1 Influenza B virus (B/Brisbane/60/2008) segment 4 hemagglutinin (HA) gene, complete cds
+AGCAGAAGCAGAGCATTTTCTAATATCCACAAAATGAAGGCAATAATTGTACTACTCATGGTAGTAACAT
+CCAATGCAGATCGAATCTGCACTGGGATAACATCGTCAAACTCACCACATGTCGTCAAAACTGCTACTCA
+AGGGGAGGTCAATGTGACTGGTGTAATACCACTGACAACAACACCCACCAAATCTCATTTTGCAAATCTC
+AAAGGAACAGAAACCAGGGGGAAACTATGCCCAAAATGCCTCAACTGCACAGATCTGGACGTAGCCTTGG
+GCAGACCAAAATGCACGGGGAAAATACCCTCGGCAAGAGTTTCAATACTCCATGAAGTCAGACCTGTTAC
+ATCTGGGTGCTTTCCTATAATGCACGACAGAACAAAAATTAGACAGCTGCCTAACCTTCTCCGAGGATAC
+GAACATATCAGGTTATCAACCCATAACGTTATCAATGCAGAAAATGCACCAGGAGGACCCTACAAAATTG
+GAACCTCAGGGTCTTGCCCTAACATTACCAATGGAAACGGATTTTTCGCAACAATGGCTTGGGCCGTCCC
+AAAAAACGACAAAAACAAAACAGCAACAAATCCATTAACAATAGAAGTACCATACATTTGTACAGAAGGA
+GAAGACCAAATTACCGTTTGGGGGTTCCACTCTGACAACGAGGCCCAAATGGCAAAGCTCTATGGGGACT
+CAAAGCCCCAGAAGTTCACCTCATCTGCCAACGGAGTGACCACACATTACGTTTCACAGATTGGTGGCTT
+CCCAAATCAAACAGAAGACGGAGGACTACCACAAAGTGGTAGAATTGTTGTTGATTACATGGTGCAAAAA
+TCTGGGAAAACAGGAACAATTACCTATCAAAGGGGTATTTTATTGCCTCAAAAGGTGTGGTGCGCAAGTG
+GCAGGAGCAAGGTAATAAAAGGATCCTTGCCTTTAATTGGAGAAGCAGATTGCCTCCACGAAAAATACGG
+TGGATTAAACAAAAGCAAGCCTTACTACACAGGGGAACATGCAAAGGCCATAGGAAATTGCCCAATATGG
+GTGAAAACACCCTTGAAGCTGGCCAATGGAACCAAATATAGACCTCCTGCAAAACTATTAAAGGAAAGGG
+GTTTCTTCGGAGCTATTGCTGGTTTCTTAGAAGGAGGATGGGAAGGAATGATTGCAGGTTGGCACGGATA
+CACATCCCATGGGGCACATGGAGTAGCGGTGGCAGCAGACCTTAAGAGCACTCAAGAGGCCATAAACAAG
+ATAACAAAAAATCTCAACTCTTTGAGTGAGCTGGAAGTAAAGAATCTTCAAAGACTAAGCGGTGCCATGG
+ATGAACTCCACAACGAAATACTAGAACTAGATGAGAAAGTGGATGATCTCAGAGCTGATACAATAAGCTC
+ACAAATAGAACTCGCAGTCCTGCTTTCCAATGAAGGAATAATAAACAGTGAAGATGAACATCTCTTGGCG
+CTTGAAAGAAAGCTGAAGAAAATGCTGGGCCCCTCTGCTGTAGAGATAGGGAATGGATGCTTTGAAACCA
+AACACAAGTGCAACCAGACCTGTCTCGACAGAATAGCTGCTGGTACCTTTGATGCAGGAGAATTTTCTCT
+CCCCACCTTTGATTCACTGAATATTACTGCTGCATCTTTAAATGACGATGGATTGGATAATCATACTATA
+CTGCTTTACTACTCAACTGCTGCCTCCAGTTTGGCTGTAACACTGATGATAGCTATCTTTGTTGTTTATA
+TGGTCTCCAGAGACAATGTTTCTTGCTCCATCTGTCTATAAGGGAAGTTAAGCCCTGTATTTTCCTTTAT
+TGTAGTGCTTGTTTACTTGTTGTCATTACAAAGAAACGTTATTGAAAAATGCTCTTGTTACTACT