vibrio-tnseq - Tn-seq pipeline for Vibrio sp.
We foster the openness, integrity, and reproducibility of scientific research.
Scripts and tools used to analyse Vibrio anguillarum Tn-seq project. The data were generated using Illumina MiSeq platform.
Essential genes of Vibrio anguillarum and other Vibrio spp. guide the development of new drugs and vaccines. Bekaert M, Goffin N, McMillan S and Desbois A. Front. Microbiol. 12:755801
This repository hosts both the scripts and tools used by this study and the raw results generated at the time. Feel free to adapt the scripts and tools, but remember to cite their authors!
To look at our scripts and raw results, browse through this repository. If you want to reproduce our results, you will need to clone this repository, build the docker, and the run all the scripts. If you want to use our data for our own research, fork this repository and cite the authors.
All required files and tools run in a self-contained docker image.
git clone https://github.com/pseudogene/vibrio-tnseq.git
cd vibrio-tnseqdocker build --rm=true -t vibrio-tnseq .
# test
docker run -i -t --rm -t vibrio-tnseq /usr/local/bin/run_pipeline.pl -v --gff /databases/vibrio.gff --cgview 1 --png 1 --infolder /dataTo import the raw read files and export the results of your analyse you need to link a folder to the docker. It this example your data will be store in /home/myaccount (current filesystem) which will be seem as been /data from within the docker by using -v <USERFOLDER>:/data.
docker run -i -t --rm -v <absolute_path>:/data -t vibrio-tnseq /bin/bashMake sure your raw read file are in <absolute_path>. To run manually a new analysis:
gunzip -c <input.fastq.gz> > <input.fastq>
cutadapt -g TCGTCGGCAGCGTCAGATGTGTATAAGAGACAGGTTCAGAGTTCTACAGTCCGACGATCACAC \
-a TAACAGGTTGGATGATAAGTCCCCGGTCTCTGTCTCTTATACACATCTCCGAGCCCACGAGAC -O 3 \
-m 10 -M 18 -e 0.15 --times 2 --trimmed-only \
-o <output.fastq> \
<input.fastq>
bowtie2 --no-1mm-upfront --end-to-end --very-fast -x /databases/vibrio -U <output.fastq> -S <output.sam>
sam_to_map.pl --sam <output.sam> --cgview 1 --png 1 -v > output.logBy default de database available is for Vibrio anguillarum NB10. If you used another species or strain you will have to update the database
cd /databases/
# get the genome sequence (FASTA format)
wget -cO - ftp://ftp.ncbi.nlm.nih.gov/genomes/all/GCF/000/786/425/GCF_000786425.1_Vibrio_anguillarum_NB10_serovar_O1/GCF_000786425.1_Vibrio_anguillarum_NB10_serovar_O1_genomic.fna.gz > Vibrio_anguillarum_NB10.fa.gz
# get the genome sequence (GFF format)
wget -cO - ftp://ftp.ncbi.nlm.nih.gov/genomes/all/GCF/000/786/425/GCF_000786425.1_Vibrio_anguillarum_NB10_serovar_O1/GCF_000786425.1_Vibrio_anguillarum_NB10_serovar_O1_genomic.gff.gz > Vibrio_anguillarum_NB10.gff.gz
# pre-process the genome sequence for Bowtie2
gunzip /databases/*.gz
bowtie2-build -q -f Vibrio_anguillarum_NB10.fa Vibrio_anguillarum_NB10
#Your "database" : /database/Vibrio_anguillarum_NB10
#Your "gff": /database/Vibrio_anguillarum_NB10.gffcd /data/
run_pipeline.pl -v --gff /database/Vibrio_anguillarum_NB10.gff --database /database/Vibrio_anguillarum_NB10 --cgview 1 --png 1 --infolder readsMake sure your compressed raw read files are in <absolute_path>/reads. To run a new pipeline:
run_pipeline.pl --infolder readsYou will need to download the dataset from the EBI ENA repository, project PRJEB39186:
docker run -i -t --rm -v <absolute_path>:/data -t vibrio-tnseq /bin/bash
mkdir -p reads
cd reads
wget ftp://ftp.sra.ebi.ac.uk/vol1/fastq/[...].fastq.gz
[...]
cd ..
run_pipeline.pl -v --cgview 1 --png 1 --infolder reads
exitIf you have any problems with or questions about the scripts, please contact us through a GitHub issue. Any issue related to the scientific results themselves must be done directly with the authors.
You are invited to contribute new features, fixes, or updates, large or small; we are always thrilled to receive pull requests, and do our best to process them as fast as we can.
The content of this project itself including the raw data and work are licensed under the Creative Commons Attribution-ShareAlike 4.0 International License, and the source code presented is licensed under the GPLv3 license.