Qiita plugin to process PacBio reads; it currently provides 2 commands for Qiita:

• Woltka v0.1.7, with cov and id filter: which generates feature and functional profiles agains WoLr2 using a coverage and identify filter; the expected output are BIOM artifacts.
• PacBio processing: which goes from step 1 to 7 in the image below. The expected output is a main folder with folders per-sample and folders for each of the different outputs, as follows:
  • MAG folder: all Metagenome-Assembled Genome (MAG) generated for that sample
  • LCG folder: all Long-Circular Genome (LCG) generated for that sample that are over 512kb in size - approximate 515,000 bases (half a million)
  • small_LCG folder: all Long-Circular Genome (LCG) generated for that sample that are under 512kb in size
  • [sample-name].fna.gz: the no LCG reads used for MAG generation
  • [sample-name].checkm.txt.gz: MAG quality information from CheckM v1.2.3
• Remove SynDNA plasmid, insert, & GCF_000184185 reads (minimap2): removes technical reads and calculates SynDNA content.
• Adapter removal via lima/pbmarkdup v2.13: removes adapters via lima/pbmarkdup from per-sample-FASTQ artifacts. We currently have 2 adapter_sets:
  • 'AAGCAGTGGTATCAACGCAGAGTACT'
  • 'twist_adapters_231010.fasta.gz', downloaded from PacBio
• Feature Table from LCG/MAG: (only available for admins via CLI: feature-table-job-submission.py) creates a new Analysis with the merged LCG/MAG of 1 or multiple artifacts generated by the PacBio processing command - includes feature table, phylogeny and taxonomy

[DEPRECATED commands]

• Woltka v0.1.7, minimap2: replaced by "Woltka v0.1.7, with cov and id filter"
• PacBio adapter removal via lima/pbmarkdup: replaced by "Adapter removal via lima/pbmarkdup v2.13"