Skip to content

tianrui-qi/SIP-DB2

Folders and files

NameName
Last commit message
Last commit date

Latest commit

 

History

108 Commits
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 

Repository files navigation

Please refer to the presentation for a complete overview of this project. The following documentation is for development use only.

Environment

The code is tested with Python=3.10, PyTorch=2.2, and CUDA=11.8. We recommend you to use Miniconda or Anaconda to make sure that all dependencies are in place. To create an conda environment:

# clone the repository
git clone git@github.com:tianrui-qi/SIP-DB2.git
cd SIP-DB2
# create the conda environment
conda env create -f environment-cpu.yml     # cpu env
conda env create -f environment-gpu.yml     # gpu env
conda activate SIP-DB2
# uninstall triton to solve env problem
pip uninstall triton

Data Structure

/mnt/efs_v2/dbgap_tcga/users/tianrui.qi/SIP-DB2/data/
├── snps.h5
├── label.csv
├── profile.csv         # samples profile of stanford and tcgaskcm dataset
├── fastq/              # unaligned reads
│   ├── SRR8924580/         # sample id
│   │   ├── *R1.fastq.gz        # read 1
│   │   └── *R2.fastq.gz        # read 2
│   └── ...
├── ref/                # reference for alignment
│   ├── ref.fa              # reference genome
│   └── ...                 # corresponding index
├── bwa-mem2-2.2.1_x64-linux
├── sam/                # aligned reads by bwa-mem2
│   ├── SRR8924580.sam
│   └── ...
├── bam/                # sorted aligned reads by Samtools
│   ├── SRR8924580.bam      # sorted bam file
│   ├── SRR8924580.bam.bai  # corresponding index
│   └── ...
├── embd/
│   ├── SRR8924580/
│   │   ├── 1/                  # chr 1 embedding
│   │   │   ├── 000/
│   │   │   │   ├── 000.npy
│   │   │   │   └── ...
│   │   │   ├── ...
│   │   │   └── feature.npy         # chr 1 embedding after feature selection
│   │   ├── ...
│   │   ├── X/                  # chr X embedding
│   │   └── sequence.h5         # sequence of sample
│   ├── ...
│   ├── TCGA-3N-A9WB-06A/
│   └── ...

SNPs

SNPs define genomic variant at a single base position in the DNA sequence, from Chr 1 to 22 and X. There are 7 SNPs:

  • /mnt/s3/rgc-ag-data/app_data/yoga/Prod/gwas/817718/Meta.BCConly.COLORADO_Freeze_One__MAYO-CLINIC_Freeze_Two__SINAI_Freeze_Two__UCLA_Freeze_One__UKB_Freeze_450__UPENN-PMBB_Freeze_Two.EUR.Meta_Combined.tsv.gz
  • /mnt/s3/rgc-ag-data/app_data/fuma/Prod/gwas/91144/snps.txt
  • /mnt/s3/rgc-ag-data/app_data/fuma/Prod/gwas/91144/all_snps.txt.gz
  • /mnt/s3/rgc-ag-data/app_data/fuma/Prod/gwas/91144/all_rare_snps.txt.gz
  • /mnt/s3/rgc-ag-data/app_data/fuma/Prod/gwas/116940/snps.txt
  • /mnt/s3/rgc-ag-data/app_data/fuma/Prod/gwas/116940/all_snps.txt.gz
  • /mnt/s3/rgc-ag-data/app_data/fuma/Prod/gwas/116940/all_rare_snps.txt.gz

We format columns name of 7 SNPs, keep column Chr, Pos, and Pval, concat them together, drop duplicate while keep the one with smallest p-vale, and save to data/snps.h5.

import pandas as pd
# read the snps
snps0 = pd.read_csv(
    "/mnt/s3/rgc-ag-data/app_data/yoga/Prod/gwas/817718/Meta.BCConly.COLORADO_Freeze_One__MAYO-CLINIC_Freeze_Two__SINAI_Freeze_Two__UCLA_Freeze_One__UKB_Freeze_450__UPENN-PMBB_Freeze_Two.EUR.Meta_Combined.tsv.gz", 
    usecols=["Chr", "Pos", "Pval"], sep="\t",
)
snps1 = pd.read_csv(
    "/mnt/s3/rgc-ag-data/app_data/fuma/Prod/gwas/91144/snps.txt", 
    usecols=["Chr", "Pos", "P"], sep="\t"
)
snps2 = pd.read_csv(
    "/mnt/s3/rgc-ag-data/app_data/fuma/Prod/gwas/91144/all_snps.txt.gz",
    usecols=["#Chr", "Pos", "P"], sep="\t"
)
snps3 = pd.read_csv(
    "/mnt/s3/rgc-ag-data/app_data/fuma/Prod/gwas/91144/all_rare_snps.txt.gz", 
    usecols=["#Chr", "Pos", "P"], sep="\t"
)
snps4 = pd.read_csv(
    "/mnt/s3/rgc-ag-data/app_data/fuma/Prod/gwas/116940/snps.txt", 
    usecols=["Chr", "Pos", "P"], sep="\t"
)
snps5 = pd.read_csv(
    "/mnt/s3/rgc-ag-data/app_data/fuma/Prod/gwas/116940/all_snps.txt.gz",
    usecols=["#Chr", "Pos", "P"], sep="\t"
)
snps6 = pd.read_csv(
    "/mnt/s3/rgc-ag-data/app_data/fuma/Prod/gwas/116940/all_rare_snps.txt.gz", 
    usecols=["#Chr", "Pos", "P"], sep="\t"
)
# format columns
snps1.rename(columns={"P": "Pval"}, inplace=True)
snps2.rename(columns={"#Chr": "Chr", "P": "Pval"}, inplace=True)
snps3.rename(columns={"#Chr": "Chr", "P": "Pval"}, inplace=True)
snps4.rename(columns={"P": "Pval"}, inplace=True)
snps5.rename(columns={"#Chr": "Chr", "P": "Pval"}, inplace=True)
snps6.rename(columns={"#Chr": "Chr", "P": "Pval"}, inplace=True)
# concat
snps = pd.concat(
    [snps0, snps1, snps2, snps3, snps4, snps5, snps6], ignore_index=True
)
# sort by Chr, Pos, and Pval
snps = snps.sort_values(by=["Chr", "Pos", "Pval"]).reset_index(drop=True)
# drop duplicates and keep the one with the smallest pval
snps = snps.drop_duplicates(subset=["Chr", "Pos"], keep="first")
# save
# split snps_df by chromosome, use chromsome as key and save each part in hdf5
for c in [str(i) for i in range(1, 23)] + ["X"]:
    snps_c = snps_df[snps_df["Chr"] == int(c if c != "X" else "23")]
    snps_c.drop(columns=["Chr"]).to_hdf(
        "data/snps.h5", key=f"/chr{c}", mode="a", format="f", index=False
    )

We can reduce the number of variant by setting a p-value threshold. To load the SNPs,

import pandas as pd
chromosome = "1"
snps = pd.read_hdf("data/snps.h5", key=f"/chr{chromosome}")
print(snps.head().to_markdown())
Chr Pos Pval
0 1 10,894 0.4351
1 1 10,915 0.1753
2 1 10,930 0.7586
3 1 10,989 0.0002593
4 1 11,171 0.1034

Table below shows the number of variant (bp) in total and in each chromosome with different p-value threshold (<) of variants. For example, (Chr 1, 1e-1) is 1,780,564 means there are 1,780,564 variants in chromosome 1 with p-value less than 1e-1.

Total Chr 1 Chr 2 Chr 3 Chr 4 Chr 5 Chr 6 Chr 7 Chr 8 Chr 9 Chr 10 Chr 11
None 102,005,793 8,036,737 8,420,567 6,910,271 6,660,538 6,227,603 5,974,465 5,671,878 5,371,679 4,328,197 4,771,438 4,967,986
1e+00 102,004,384 8,036,624 8,420,460 6,910,178 6,660,453 6,227,521 5,974,367 5,671,807 5,371,599 4,328,148 4,771,371 4,967,903
1e-01 22,526,232 1,780,564 1,842,034 1,525,348 1,463,394 1,369,596 1,352,671 1,241,372 1,190,281 958,209 1,055,550 1,110,927
1e-02 3,015,759 240,594 247,397 203,549 192,705 180,543 208,849 162,457 154,899 126,389 138,882 150,371
1e-03 474,261 37,485 39,188 28,721 26,360 26,907 54,400 23,818 22,224 20,078 19,893 23,188
1e-04 122,713 8,739 10,841 5,754 4,456 5,730 30,131 5,188 4,262 5,538 3,833 5,178
1e-05 61,958 3,433 4,968 1,849 1,246 2,369 23,903 2,198 1,558 2,742 1,343 2,416
1e-06 44,522 2,076 3,189 952 737 1,482 20,856 1,492 895 1,895 721 1,733
Chr 12 Chr 13 Chr 14 Chr 15 Chr 16 Chr 17 Chr 18 Chr 19 Chr 20 Chr 21 Chr 22 Chr X
None 4,737,294 3,380,686 3,127,090 2,900,385 3,320,540 3,024,415 2,669,604 2,523,250 2,229,241 1,257,735 1,419,036 4,075,158
1e+00 4,737,230 3,380,632 3,127,049 2,900,341 3,320,476 3,024,375 2,669,581 2,523,220 2,229,203 1,257,715 1,419,019 4,075,112
1e-01 1,043,093 747,757 681,930 643,814 737,973 667,146 578,764 556,385 503,376 279,032 313,435 883,581
1e-02 135,799 95,282 90,206 86,005 100,432 91,538 73,734 73,028 73,277 36,473 41,223 112,127
1e-03 20,648 13,619 13,210 12,439 16,633 15,152 9,936 10,015 15,279 4,882 6,355 13,831
1e-04 4,975 2,335 2,287 2,206 4,927 2,528 1,468 1,790 6,106 719 1,520 2,202
1e-05 2,583 779 586 744 2,882 801 348 506 3,358 209 621 516
1e-06 1,833 448 97 287 1,916 310 218 222 2,529 94 372 168

Profile

The profile store in data/profile.csv, contain profile for both Stanford and TCGA SKCM dataset. Stanford profile refers to /mnt/s3/rgc-tag-onc-jh1-resources/2019_natBiotech_anneChang_bccWXS/SraRunTable_PRJNA533341_2018_bccWXS.txt; TCGA SKCM profile refers to /mnt/efs_v2/dbgap_tcga/users/jing.he1/mol_pheno/TCGA_SKCM/gdc_sample_sheet.2024-02-05.tsv.

To use the profile,

import pandas as pd
profile = pd.read_csv("data/profile.csv")
## Stanford
profile_stanford = profile[profile["dataset"]=="stanford"]
print(profile_stanford.head().to_markdown())
## TCGA SKCM
profile_tcgaskcm = profile[profile["dataset"]=="tcgaskcm"]
print(profile_tcgaskcm.head().to_markdown())
dataset patient sample type easy hard train valid test
0 stanford su001 SRR8924591 normal skin 1 0 1 0 0
1 stanford su001 SRR8924590 BCC tumor 1 0 1 0 0
2 stanford su001 SRR8924593 BCC tumor 1 0 1 0 0
3 stanford su002 SRR8924592 normal skin 1 0 1 0 0
4 stanford su002 SRR8924594 BCC tumor 1 0 1 0 0
23 tcgaskcm TCGA-3N-A9WB TCGA-3N-A9WB-06A Metastatic 0 1 0 1 0
24 tcgaskcm TCGA-3N-A9WB TCGA-3N-A9WB-10A Blood Derived Normal 0 1 0 1 0
25 tcgaskcm TCGA-3N-A9WC TCGA-3N-A9WC-06A Metastatic 0 1 0 0 1
26 tcgaskcm TCGA-3N-A9WC TCGA-3N-A9WC-10A Blood Derived Normal 0 1 0 0 1
27 tcgaskcm TCGA-3N-A9WD TCGA-3N-A9WD-06A Metastatic 0 1 0 1 0
bam_path embd_fold
0 /mnt/efs_v2/dbgap_tcga/users/tianrui.qi/SIP-DB2/data/bam/SRR8924591.bam /mnt/efs_v2/dbgap_tcga/users/tianrui.qi/SIP-DB2/data/embd/SRR8924591
1 /mnt/efs_v2/dbgap_tcga/users/tianrui.qi/SIP-DB2/data/bam/SRR8924590.bam /mnt/efs_v2/dbgap_tcga/users/tianrui.qi/SIP-DB2/data/embd/SRR8924590
2 /mnt/efs_v2/dbgap_tcga/users/tianrui.qi/SIP-DB2/data/bam/SRR8924593.bam /mnt/efs_v2/dbgap_tcga/users/tianrui.qi/SIP-DB2/data/embd/SRR8924593
3 /mnt/efs_v2/dbgap_tcga/users/tianrui.qi/SIP-DB2/data/bam/SRR8924592.bam /mnt/efs_v2/dbgap_tcga/users/tianrui.qi/SIP-DB2/data/embd/SRR8924592
4 /mnt/efs_v2/dbgap_tcga/users/tianrui.qi/SIP-DB2/data/bam/SRR8924594.bam /mnt/efs_v2/dbgap_tcga/users/tianrui.qi/SIP-DB2/data/embd/SRR8924594
23 /mnt/efs_v2/dbgap_tcga/users/jing.he1/mol_pheno/TCGA_SKCM/4602683e-928f-4865-8d51-9285428c2abd/e149f83f-8eb2-4070-8d42-04025272f6aa_wxs_gdc_realn.bam /mnt/efs_v2/dbgap_tcga/users/tianrui.qi/SIP-DB2/data/embd/TCGA-3N-A9WB-06A
24 /mnt/efs_v2/dbgap_tcga/users/jing.he1/mol_pheno/TCGA_SKCM/5f9701a2-d948-4fa5-8d64-f43072d7540a/8d2f084c-bec2-4e3a-a8ea-8656ce95ddeb_wxs_gdc_realn.bam /mnt/efs_v2/dbgap_tcga/users/tianrui.qi/SIP-DB2/data/embd/TCGA-3N-A9WB-10A
25 /mnt/efs_v2/dbgap_tcga/users/jing.he1/mol_pheno/TCGA_SKCM/f44a75cd-4144-4a66-bf1d-0b4c01a414af/e7e53fde-c59f-4933-a15b-38f81644d331_wxs_gdc_realn.bam /mnt/efs_v2/dbgap_tcga/users/tianrui.qi/SIP-DB2/data/embd/TCGA-3N-A9WC-06A
26 /mnt/efs_v2/dbgap_tcga/users/jing.he1/mol_pheno/TCGA_SKCM/b684e03d-7977-44d6-963b-1c5e6146b8a9/a8305c9e-76a9-4e40-8451-6882718cbd76_wxs_gdc_realn.bam /mnt/efs_v2/dbgap_tcga/users/tianrui.qi/SIP-DB2/data/embd/TCGA-3N-A9WC-10A
27 /mnt/efs_v2/dbgap_tcga/users/jing.he1/mol_pheno/TCGA_SKCM/1903af20-51f4-492c-bb91-591593e63b7f/67015753-00f8-4ccf-9899-a64ccf879a1d_wxs_gdc_realn.bam /mnt/efs_v2/dbgap_tcga/users/tianrui.qi/SIP-DB2/data/embd/TCGA-3N-A9WD-06A
Treatment Th2 Cells T Cells CD8
0 pre anti-PD-1 nan nan
1 post anti-PD-1 nan nan
2 pre anti-PD-1 nan nan
3 post anti-PD-1 nan nan
4 pre anti-PD-1 nan nan
23 nan 1123.27 0.0401951
24 nan 1123.27 0.0401951
25 nan -424.94 0.306577
26 nan -424.94 0.306577
27 nan -373.574 0.131067

All Stanford samples are group to easy and train set. For TCGA SKCM samples,

figure-1

figure-2

import pandas as pd

th2_bound = 439.13  # label["Th2 Cells"].mean()
cd8_bound = 0.1

# read profile
profile = pd.read_csv("data/profile.csv")
profile = profile[profile["dataset"]=="tcgaskcm"]
profile = profile[profile["embd_fold"].notnull()]
# read label
label   = pd.read_csv("data/label.csv")
# remove sample in profile that not in label
# remove patient in label that not in profile
profile = profile[profile["patient"].isin(label["patient"])]
label = label[label["patient"].isin(profile["patient"])]
# remove patient that only have one sample in profile
for i in label["patient"].to_list():
    if len(profile[profile["patient"] == i]) < 2:
        label = label[label["patient"] != i]
        profile = profile[profile["patient"] != i]

# init split where index match label
split = pd.read_csv(
    "data/label.csv", usecols=["patient", "Th2 Cells", "T Cells CD8"]
)
split[["easy", "hard", "train", "valid", "test"]] = 0
# split easy, hard
split[["easy", "hard"]] = 0
split.loc[label[
    ((label["Th2 Cells"] > th2_bound) & (label["T Cells CD8"] > cd8_bound)) | 
    ((label["Th2 Cells"] < th2_bound) & (label["T Cells CD8"] < cd8_bound))
].index, "easy"] = 1
split.loc[label[
    ((label["Th2 Cells"] > th2_bound) & (label["T Cells CD8"] < cd8_bound)) | 
    ((label["Th2 Cells"] < th2_bound) & (label["T Cells CD8"] > cd8_bound))
].index, "hard"] = 1
# split easy into train, valid, test
easy = label.loc[split[split["easy"] == 1].index]
easy = easy.sort_values(by=["Th2 Cells", "T Cells CD8"])
for i in range(len(easy)):
    mod = 15
    if   i % mod < mod-2: split.loc[easy.index[i], "train"] = 1  # 200
    elif i % mod < mod-1: split.loc[easy.index[i], "valid"] = 1  # 15
    elif i % mod < mod-0: split.loc[easy.index[i], "test"]  = 1  # 15
# split hard into train, valid, test
hard = label.loc[split[split["hard"] == 1].index]
hard = hard.sort_values(by=["Th2 Cells", "T Cells CD8"])
for i in range(len(hard)):
    mod = 10
    if   i % mod <   2: split.loc[hard.index[i], "train"] = 1   # 48
    elif i % mod <   6: split.loc[hard.index[i], "valid"] = 1   # 92
    elif i % mod < mod: split.loc[hard.index[i], "test"]  = 1   # 92

# save
profile = pd.read_csv("data/profile.csv")
profile = profile[profile["dataset"]=="tcgaskcm"]
profile = profile.merge(split, on="patient", how="left")
# note that there are patient in profile that not in label/split
profile[["easy", "hard", "train", "valid", "test"]] = profile[
    ["easy", "hard", "train", "valid", "test"]
].fillna(0).astype(int)
profile.to_csv("data/profile-tcgaskcm.csv", index=False)

To filter samples in profile, i.e., train,

import pandas as pd
profile = pd.read_csv("data/profile.csv")
profile = profile[profile["train"]==1]

FASTQ

Raw FASTQ, unaligned reads, store in data/fastq/, contain 23 samples, copy from /mnt/s3/rgc-tag-onc-jh1-resources/2019_natBiotech_anneChang_bccWXS/fastq/. For each sample, we have two reads, i.e., *R1.fastq.gz and *R2.fastq.gz.

To mount the S3 bucket rgc-tag-onc-jh1-resources (like HDD/SSD in desktop) of raw data, follow the How to guide. First, type id in cmd and copy the uid. Then, run cmd

# usage
sudo s3fs [S3 BUCKET NAME] [MOUNT PATH] -o allow_other,use_sse=1,endpoint=us-east-1,uid=[YOUR UID],gid=1121400513,iam_role=auto

# e.g.
sudo s3fs rgc-tag-onc-jh1-resources /mnt/s3/rgc-tag-onc-jh1-resources -o allow_other,use_sse=1,endpoint=us-east-1,uid=777332657,gid=1121400513,iam_role=auto

Type df -h to check if the filesystem is mounted where -h means human readable.

FASTQ to SAM

Use bwa-mem2 to align the FASTQ in SAM, stands for Sequence Alignment Map. To install it,

# intall bwa-mem2
curl -L https://github.com/bwa-mem2/bwa-mem2/releases/download/v2.2.1/bwa-mem2-2.2.1_x64-linux.tar.bz2 | tar jxf -
# index the reference genome
bwa-mem2-2.2.1_x64-linux/bwa-mem2 index ref/ref.fa

where the reference genome data/ref/ref.fa copy from /mnt/efs_v2/tag_onc/users/hossein.khiabanian/ref/genome.fa

Then, we run alignment and store result of each sample in data/sam/*.sam:

# e.g., sample `SRR8924580`, powershell
$id = "SRR8924580";
bwa-mem2-2.2.1_x64-linux/bwa-mem2 mem -t 40 data/ref/ref.fa data/fastq/$id/*R1.fastq.gz data/fastq/$id/*R2.fastq.gz > data/sam/$id.sam;
# e.g., sample `SRR8924580` to `SRR8924602`, powershell
foreach ($i in 580..602) { 
    $id = "SRR8924$i"; 
    bwa-mem2-2.2.1_x64-linux/bwa-mem2 mem -t 40 data/ref/ref.fa data/fastq/$id/*R1.fastq.gz data/fastq/$id/*R2.fastq.gz > data/sam/$id.sam; 
}

where -t for number of threads.

SAM to BAM

We convert SAM, Sequence Alignment Map, into BAM, Binary Alignment Map, using Samtools. To install it,

# download source file
wget https://github.com/samtools/samtools/releases/download/1.19.2/samtools-1.19.2.tar.bz2
tar -xjf samtools-1.19.2.tar.bz2
cd samtools-1.19.2
# build and install
./configure     # using default prefix /usr/local/bin/samtools
make
make install    # may need sudo for this
# check installation
samtools
which samtools  # should print /usr/local/bin/samtools
# remove source file
cd ..
rm -rf samtools-1.19.2
rm samtools-1.19.2.tar.bz2

Then, convert SAM into BAM file,

# e.g., sample `SRR8924580`, powershell
$id = "SRR8924580";
## convert SAM to BAM
samtools view -@ 40 -S -b data/sam/$id.sam > data/bam/$id.bam;  
## sort BAM  
samtools sort -@ 40 data/bam/$id.bam -o data/bam/$id.bam;
## index sorted BAM file   
samtools index -@ 40 data/bam/$id.bam;
# e.g., sample `SRR8924580` to `SRR8924602`, powershell
foreach ($i in 580..602) { 
    $id = "SRR8924$i"; 
    samtools view -@ 40 -S -b data/sam/$id.sam > data/bam/$id.bam;
    samtools sort -@ 40 data/bam/$id.bam -o data/bam/$id.bam;
    samtools index -@ 40 data/bam/$id.bam;
}

where -@ for number of threads. We can then use pysam to read BAM and extract the reads.

BAM and SNPs to Sequence

Go through reads in -c CHROMOSOME of -B BAM_LOAD_PATH. For each read, filter the read that is not paired, not properly paired, and not mapped; cut bases with quality less than quality_thresh=16 at beginning and end of reads and short reads with length less than length_thresh=96. Note that this value is set according to Stanford data; change the length threshold accordingly for new dataset. Then, calculate num of variants cover by each read with different p-value threshold. Save result as a HDF5 -H HDF_SAVE_PATH with columns sequence, pos, 1e+00, 1e-01, 1e-02, 1e-03, 1e-04, 1e-05, and 1e-06. Seperate result by batch with key /chr{chromosome}_batch{batch_index} to save memory and avoid overflow error.

This function itself is not optimized for parallel computing but design for sample and chromosome level parallel, i.e., start mutiple process and run this function at the sample time. Refer to src/bam2seq.py for the implementation.

  • -B BAM_LOAD_PATH: Path to load the BAM file of a sample.
  • -H HDF_SAVE_PATH: Path to save the HDF5 file. Must assign differ path for sample and chromosome.
  • -c CHROMOSOME: Which chromosome current process want to process. Parameter design for parallel.
  • -S SNPS_LOAD_PATH: Path to load the SNPs file contain genetic variation.
  • -q QUALITY_THRESH: Cut low quality bases at beginning and end of reads. Default: 16.
  • -l LENGTH_THRESH: Skip reads with length less than this value. Default: 96.
  • -b BATCH_SIZE: Frequence of create new key and save batch size of reads to this key. Default: 1e6.
  • -v VERBAL: Control which level of tqdm bar will be print. If set as True/False, all the tqdm bar will be enabled/disabled. If set as int, print tqdm bar with position samller than or equal to verbal. For example, if verbal set to 1, print tqdm bar with position 0 and 1, i.e., level 0 and 1 for loop.

The averge read length of TCGA-SKCM data is 75bp, so we set the length threshold to 64.

import pandas as pd
import os
import src
chromosome = "1"
## Stanford
profile = pd.read_csv("data/profile.csv")
profile = profile[profile["dataset"]=="stanford"]
for i in range(len(profile)):
    embd_fold = profile.iloc[i, "embd_fold"]
    src.bam2seq(
        bam_load_path=profile.iloc[i, "bam_path"], 
        hdf_save_path=os.path.join(embd_fold, chromosome, "sequence.h5"),
        chromosome=chromosome,
        snps_load_path="data/snps.h5", 
    )
## TCGA SKCM
profile = pd.read_csv("data/profile.csv")
profile = profile[profile["dataset"]=="tcgaskcm"]
for i in range(len(profile)):
    embd_fold = profile.iloc[i, "embd_fold"]
    src.bam2seq(
        bam_load_path=profile.iloc[i, "bam_path"], 
        hdf_save_path=os.path.join(embd_fold, chromosome, "sequence.h5"), 
        chromosome=chromosome,
        snps_load_path="data/snps.h5", 
        length_thresh=64
    )

To use the HDF5,

## Stanford
import pandas as pd
sample, chromosome= "SRR8924580", "1"
pval_thresh = 1e-3
# read hdf of given sample and chromosome
hdf = []
batch_index = 0
while True:
    try:
        hdf.append(pd.read_hdf(
            f"data/embd/{sample}/{chromosome}/sequence.h5", 
            key=f"/chr{chromosome}_batch{batch_index}", mode="r"
        ))
        batch_index += 1
    except KeyError: 
        break
hdf = pd.concat(hdf, ignore_index=True)
# filter reads that cover at least one variants with p-value<pval_thresh
hdf = hdf[hdf[f"{pval_thresh:.0e}"]>=1]
print(hdf.head().to_markdown())
sequence pos 1e+00 1e-01 1e-02 1e-03 1e-04 1e-05 1e-06
9610 TCTTGTAGCCCAGGCTGGAGTGCAATGGCACAATCTCAGCTCACTACAACCTCCACCTCCCGGGTTCAAGCAATTCTCCTGCCTCGGCCTCCCGAGTAGCTGGAATTATAGGGATGTGCCACAAC 511,442 1 1 1 1 0 0 0
9611 AGGCTGGAGTGCAATGGCACAATCTCAGCTCACTACAACCTCCACCTCCCGGGTTCAAGCAATTCTCCTGCCTCGGCCTCCCGAGTAGCTGGAATTATAGGGATGTGCCACAACGCCTAGCTAAC 511,453 1 1 1 1 0 0 0
9612 CTGGAGTGCAATGGCACAATCTCAGCTCACTACAACCTCCACCTCCCGGGTTCAAGCAATTCTCCTGCCTCGGCCTCCCGAGTAGCTGGAATTATAGGGATGTGCCACAACGCCTAGCTAACTGT 511,456 1 1 1 1 0 0 0
9613 AAGCAATTCTCCTGCCTCGGCCTCCCGAGTAGCTGGAATTATAGGGATGTGCCACAACGCCTAGCTAACTGTTGTTATTTTTAGTAGAAACGGGGTTTCACCATGTTGGTCAGGCTAGTCTCAAA 511,509 1 1 1 1 0 0 0
26450 TGACTTCGGATGGTCCACCCACTTCTGCATCCCAAAGTGCTGGGATTACAAGTGTGACCCACCGCGCCTGGCGATTTTGCTCATTTTAGATACTAGAACTTTTTAATTTAAATTTTTTTTTT 780,503 3 2 2 1 0 0 0
## TCGA SKCM
import pandas as pd
sample, chromosome= "TCGA-3N-A9WB-06A", "1"
pval_thresh = 1e-3
# read hdf of given sample and chromosome
hdf = []
batch_index = 0
while True:
    try:
        hdf.append(pd.read_hdf(
            f"data/embd/{sample}/{chromosome}/sequence.h5", 
            key=f"/chr{chromosome}_batch{batch_index}", mode="r"
        ))
        batch_index += 1
    except KeyError: 
        break
# filter reads that cover at least one variants with p-value<pval_thresh
hdf = hdf[hdf[f"{pval_thresh:.0e}"]>=1]
print(hdf.head().to_markdown())
sequence pos 1e+00 1e-01 1e-02 1e-03 1e-04 1e-05 1e-06
34572 TTTTGCTCATTTTAGATACTAGAACTTTTTAATTTAAATTTTTTTTTTCCTGAGATGGAGTCTTACTTTGTCTC 780,577 3 1 1 1 0 0 0
34710 TCCCTGAGTAAATAAATAAGAAAGAGACAGAATTCCAACAGCGGCCGTGTGGCTGCAGAGCCTCTCTCCCTCCCTG 801,319 5 3 1 1 0 0 0
34733 TATTTTATCCATAATAGAATGAAGGTGCATAAACCACATAGTAATTAATCTTTGGACAAAAGCAAACAATAAATGG 805,181 4 2 1 1 0 0 0
35314 AGGATGGAGTCATCTGTAGCTAAAGGGAACCACCATTAGTCAGTCCTTGTGATGAAGGTGCAAGATGTTCCTGCTT 834,426 2 2 1 1 1 0 0
35373 CTCTTGCCACTTTCAGGCCCTTGCCTTGCATGGGCTGCGGTGGTTCTGCCAGTGTGGATTCGAACCGATAGGTTTC 844,645 2 2 2 1 1 0 0

Tables below show reads number in total and in each chromosome, without and with filter that reads must cover at least one variants, with different p-value threshold (<) of variants. For example, in first table, (Chr 1, 1e-1) is 10,626,531 means there are 10,626,531 reads in chromosome 1 such that the read cover at least one variant with p-value < 1e-1.

For sample SRR8924580 from Stanford.

Total Chr 1 Chr 2 Chr 3 Chr 4 Chr 5 Chr 6 Chr 7 Chr 8 Chr 9 Chr 10 Chr 11
None 145,716,728 13,713,075 11,222,726 8,635,490 6,631,021 7,126,372 7,773,282 7,804,439 5,498,483 5,466,443 6,174,646 7,798,636
1e+00 141,462,340 13,327,416 10,937,845 8,485,090 6,485,712 6,963,664 7,636,863 7,583,219 5,385,794 5,224,620 6,016,571 7,712,008
1e-01 111,288,319 10,626,531 8,598,356 6,661,035 5,006,012 5,418,664 6,078,183 5,942,269 4,235,084 4,207,156 4,728,402 6,288,232
1e-02 31,809,805 3,091,738 2,373,061 1,861,618 1,344,291 1,462,835 1,913,564 1,672,430 1,186,677 1,222,783 1,310,405 1,915,577
1e-03 5,391,700 515,351 371,256 297,595 201,744 239,302 532,877 265,070 183,706 197,956 200,156 322,727
1e-04 1,230,187 102,191 79,407 51,477 30,778 49,697 287,101 47,596 28,748 41,058 33,052 69,556
1e-05 577,332 35,661 29,429 11,738 8,208 21,083 224,414 15,449 8,533 16,822 12,032 28,472
1e-06 402,742 20,936 17,430 4,494 4,391 12,962 192,367 10,612 4,173 12,075 4,784 19,395
Chr 12 Chr 13 Chr 14 Chr 15 Chr 16 Chr 17 Chr 18 Chr 19 Chr 20 Chr 21 Chr 22 Chr X
None 7,521,751 3,176,056 4,799,089 5,053,137 5,751,214 6,832,248 2,753,185 7,128,590 3,316,788 1,810,358 3,002,541 6,727,158
1e+00 7,436,252 3,123,886 4,660,616 4,691,076 5,434,240 6,630,081 2,698,635 7,038,979 3,229,005 1,527,910 2,856,505 6,376,353
1e-01 5,902,280 2,411,212 3,645,370 3,722,156 4,471,460 5,364,656 2,084,957 5,946,437 2,580,103 1,236,198 2,312,476 3,821,090
1e-02 1,666,976 618,001 1,010,206 1,046,854 1,441,562 1,625,202 546,306 1,910,581 783,530 379,020 694,948 731,640
1e-03 283,964 97,919 156,289 163,863 273,320 266,289 83,527 311,003 157,582 57,240 114,492 98,472
1e-04 65,208 14,405 21,531 27,780 74,195 47,701 12,200 52,449 50,225 7,008 21,477 15,347
1e-05 36,371 4,787 4,560 7,606 42,422 13,501 3,058 14,701 26,459 1,329 7,689 3,008
1e-06 26,004 2,397 791 2,961 26,437 5,730 2,257 7,373 19,608 372 4,146 1,047

For sample TCGA-3N-A9WB-06A from TCGA SKCM.

Total Chr 1 Chr 2 Chr 3 Chr 4 Chr 5 Chr 6 Chr 7 Chr 8 Chr 9 Chr 10 Chr 11
None 64,118,420 9,962,454 4,318,194 3,270,047 2,517,318 3,929,492 2,484,661 4,922,700 2,339,633 2,476,365 2,501,117 2,999,917
1e+00 58,978,201 8,862,676 3,982,109 3,123,691 2,303,522 3,694,116 2,310,953 4,557,498 2,134,921 2,236,758 2,335,137 2,890,757
1e-01 41,871,073 6,382,479 2,778,208 2,180,880 1,544,905 2,549,947 1,652,059 3,209,631 1,487,143 1,613,628 1,642,699 2,138,764
1e-02 9,897,286 1,554,603 632,848 485,133 340,083 560,730 447,728 754,522 344,137 373,211 375,127 529,260
1e-03 1,553,399 239,050 94,821 69,565 47,422 84,791 127,284 107,517 52,320 55,922 54,880 82,333
1e-04 322,870 43,704 17,942 11,429 6,548 15,631 70,890 15,357 8,006 8,606 9,204 15,795
1e-05 143,450 14,749 6,003 2,428 1,731 6,276 57,277 3,585 2,170 2,260 3,218 6,263
1e-06 97,370 8,715 3,435 870 925 3,563 49,213 1,750 855 1,311 1,016 4,457
Chr 12 Chr 13 Chr 14 Chr 15 Chr 16 Chr 17 Chr 18 Chr 19 Chr 20 Chr 21 Chr 22 Chr X
None 2,825,651 1,192,038 1,825,824 2,082,091 2,333,919 3,642,910 987,690 2,738,176 1,504,831 662,246 1,102,665 1,498,481
1e+00 2,728,806 1,097,854 1,732,657 1,828,563 2,027,774 3,315,187 916,636 2,672,420 1,416,581 550,634 1,019,965 1,238,986
1e-01 1,948,299 729,010 1,226,101 1,292,860 1,535,779 2,440,835 608,468 2,118,064 1,037,658 397,975 758,415 597,266
1e-02 452,184 150,636 291,342 287,559 398,142 586,944 130,259 552,372 260,863 99,995 185,219 104,389
1e-03 72,245 22,580 44,319 41,489 65,061 88,719 17,539 80,768 49,786 13,422 28,926 12,640
1e-04 13,757 3,326 5,243 6,403 15,627 14,455 2,464 14,050 15,515 1,601 5,609 1,708
1e-05 7,078 1,101 895 1,731 7,832 3,818 400 3,915 8,209 488 1,773 250
1e-06 4,559 443 206 805 4,740 1,815 240 1,689 5,586 183 848 146

Sequence to Embedding

Use src/seq2embd.py to transfer DNA sequence (string) of each read into 768 tensor embedding using either pretrain or finetune model (src/embd/model.py), contorl by -C CKPT_LOAD_PATH.

  • -H HDF_LOAD_PATH: Path to load the HDF5 file. Sturcture data/hdf/$id.h5 is recommended.
  • -E EMBD_SAVE_FOLD: Fold to save the embedding. Sturcture data/embd/$sample is recommended. Each chromosome's embedding saves under data/embd/$sample/$c in hash structure indexed by pos of each read, i.e., data/embd/$sample/$c/$hash_fold/$hash_file.npy. We format pos of read into 9 digits int, use first 3 digits as hash_fold, second 3 digits as hash_file, and last 3 digits (1000 bp) store in each .npy. For example, for read with pos 78034 in chromosome 11, it will store in data/embd/$sample/11/000/078.npy. Each .npy is a N by 776 numpy array where N for number of reads. For each read, [0:768] is the embedding, [768] is the pos, and [769:776] is num of variants cover by each read with different p-value threshold. Note that [768:776] directly copy from columns pos, 1e+00, 1e-01, 1e-02, 1e-03, 1e-04, 1e-05, and 1e-06 of HDF5 file -H HDF_LOAD_PATH.
  • -C CKPT_LOAD_PATH: Path to load checkpoint for src.embd.model.FinetuneModel. If not provided, src.embd.model.PretrainModel will be used. Default: None.
  • -p PVAL_THRESH: P-value threshold for filtering reads, i.e., only keep reads that cover at least one variant with p-value < pval_thresh. Set to 0 to disable pval threshold filtering. Default: 0.
  • -b BATCH_SIZE: Batch size for number of reads input to tokenizer and model at same time. Default: 100.
  • -v VERBAL: control which level of tqdm bar will be print. If set as True/False, all the tqdm bar will be enabled/disabled. If set as int, print tqdm bar with position samller than or equal to verbal. For example, if verbal set to 1, print tqdm bar with position 0 and 1, i.e., level 0 and 1 for loop.
import pandas as pd
import os
import src
profile = pd.read_csv("data/profile.csv")
for i in range(len(profile)):
    embd_fold = profile.iloc[i, "embd_fold"]
    src.seq2embd(
        hdf_load_path=os.path.join(embd_fold, "sequence"), 
        embd_save_fold=embd_fold, 
        pval_thresh=1e-3
    )

To load the embedding at specific hash_idx = pos % bucket_size and then split the embedding by bucket,

import numpy as np
import os
def getEmbdByFold(
    embd_fold: str, chromosome: str, hash_idx: int,
    hash_size: int = 1000, bucket_size: int = 100
) -> dict[int, np.ndarray] | None:
    # load embd at hash_idx
    # (:768 embd, 768 pos, 769 embd_idx)
    hash_fold = f"{hash_idx:06d}.npy"[:3]
    hash_file = f"{hash_idx:06d}.npy"[3:]
    sample_path = os.path.join(embd_fold, chromosome, hash_fold, hash_file)
    if not os.path.exists(sample_path): return None
    embd = np.load(sample_path)[:, :769]    # (:768 embd, 768 pos)
    # add embd_idx to column 769
    embd = np.column_stack([embd, np.arange(len(embd), dtype=np.float32)])
    # if no embd, means no sample cover this hash_idx, return
    if len(embd) == 0: return None
    # split embd by bucket_idx
    # { bucket_idx : (:768 embd, 768 pos, 769 embd_idx) }
    bucket_idx = embd[:, 768] % hash_size // bucket_size
    return {int(b): embd[bucket_idx==b] for b in np.unique(bucket_idx)}

Acknowledgements

I would like to express my sincere gratitude to my manager, Dr. Jing He, for providing this opportunity to co-op at Regeneron Genetics Center and for her invaluable guidance on both the project and personal development throughout my co-op experience. I also had a great time working with oncology group, Dr. Silvia Alvarez, Dr. Jessie Brown, Dr. Adolfo Ferrando, and Dr. Hossein Khiabanian. Special thanks to, not only colleagues but also close friends, Jie Peng, Zhenyu Zhang, and Shiying Zheng, whose encouragement helped me navigate challenging times and made my after-work life enriching and enjoyable.