-
Notifications
You must be signed in to change notification settings - Fork 2
Populate ref allele #5
New issue
Have a question about this project? Sign up for a free GitHub account to open an issue and contact its maintainers and the community.
By clicking “Sign up for GitHub”, you agree to our terms of service and privacy statement. We’ll occasionally send you account related emails.
Already on GitHub? Sign in to your account
Merged
Merged
Changes from all commits
Commits
Show all changes
15 commits
Select commit
Hold shift + click to select a range
3d52d90
add assembly parameter
khetherin 9c3d821
simplified input for testing
khetherin a64d200
added a new test file
khetherin 70681cb
added dependencies installation instructions
khetherin 16252a0
updated input fasta file
khetherin 1ae60f3
updated input fasta file
khetherin 4c5ddaa
updated input gvf file
khetherin 772d9d9
added function extract_reference_allele
khetherin 03470ec
removed TODO
khetherin 3fc952e
added unit test
khetherin aa8eea1
tidy up
khetherin a398940
handling for if no reference provided and reference_seq not in GVF
khetherin b57acea
tidy
khetherin 31a6dbb
tidy up comments
khetherin b2e4449
Fix tests
tcezard File filter
Filter by extension
Conversations
Failed to load comments.
Loading
Jump to
Jump to file
Failed to load files.
Loading
Diff view
Diff view
There are no files selected for viewing
This file contains hidden or bidirectional Unicode text that may be interpreted or compiled differently than what appears below. To review, open the file in an editor that reveals hidden Unicode characters.
Learn more about bidirectional Unicode characters
| Original file line number | Diff line number | Diff line change |
|---|---|---|
| @@ -1,2 +1,6 @@ | ||
| # convertGVFtoVCF | ||
| converts GVF file to VCF file | ||
|
|
||
| Dependencies | ||
| Install biopython: | ||
| pip install biopython | ||
This file contains hidden or bidirectional Unicode text that may be interpreted or compiled differently than what appears below. To review, open the file in an editor that reveals hidden Unicode characters.
Learn more about bidirectional Unicode characters
This file contains hidden or bidirectional Unicode text that may be interpreted or compiled differently than what appears below. To review, open the file in an editor that reveals hidden Unicode characters.
Learn more about bidirectional Unicode characters
| Original file line number | Diff line number | Diff line change |
|---|---|---|
| @@ -0,0 +1,4 @@ | ||
| >chromosome1 | ||
| ACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGT | ||
| >chromosome2 | ||
| TTTTTTT |
This file contains hidden or bidirectional Unicode text that may be interpreted or compiled differently than what appears below. To review, open the file in an editor that reveals hidden Unicode characters.
Learn more about bidirectional Unicode characters
This file contains hidden or bidirectional Unicode text that may be interpreted or compiled differently than what appears below. To review, open the file in an editor that reveals hidden Unicode characters.
Learn more about bidirectional Unicode characters
Oops, something went wrong.
Add this suggestion to a batch that can be applied as a single commit.
This suggestion is invalid because no changes were made to the code.
Suggestions cannot be applied while the pull request is closed.
Suggestions cannot be applied while viewing a subset of changes.
Only one suggestion per line can be applied in a batch.
Add this suggestion to a batch that can be applied as a single commit.
Applying suggestions on deleted lines is not supported.
You must change the existing code in this line in order to create a valid suggestion.
Outdated suggestions cannot be applied.
This suggestion has been applied or marked resolved.
Suggestions cannot be applied from pending reviews.
Suggestions cannot be applied on multi-line comments.
Suggestions cannot be applied while the pull request is queued to merge.
Suggestion cannot be applied right now. Please check back later.
There was a problem hiding this comment.
Choose a reason for hiding this comment
The reason will be displayed to describe this comment to others. Learn more.
You can add this to the requirements file.
Since the requirements file is new in the main branch, you will either need to do it in your next PR, or you can dive into the joys of git rebase/merge to see how to update your branch with the newest changes from the main branch. In theory it's as simple as:
In practice there can be merge conflicts you need to resolve, but hopefully in this case there won't be.
There was a problem hiding this comment.
Choose a reason for hiding this comment
The reason will be displayed to describe this comment to others. Learn more.
We will address the issue with the requirements in #7 and that should also fix the tests